ID: 1006519534

View in Genome Browser
Species Human (GRCh38)
Location 6:34563317-34563339
Sequence CTGAGGGTAGGGAGGGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006519520_1006519534 26 Left 1006519520 6:34563268-34563290 CCTTTGTGTCCAGCCGCTGCCTT No data
Right 1006519534 6:34563317-34563339 CTGAGGGTAGGGAGGGTAGTGGG No data
1006519527_1006519534 -7 Left 1006519527 6:34563301-34563323 CCAGAGAAGACTACGTCTGAGGG No data
Right 1006519534 6:34563317-34563339 CTGAGGGTAGGGAGGGTAGTGGG No data
1006519525_1006519534 -6 Left 1006519525 6:34563300-34563322 CCCAGAGAAGACTACGTCTGAGG No data
Right 1006519534 6:34563317-34563339 CTGAGGGTAGGGAGGGTAGTGGG No data
1006519523_1006519534 7 Left 1006519523 6:34563287-34563309 CCTTCTGCCTCTGCCCAGAGAAG No data
Right 1006519534 6:34563317-34563339 CTGAGGGTAGGGAGGGTAGTGGG No data
1006519521_1006519534 17 Left 1006519521 6:34563277-34563299 CCAGCCGCTGCCTTCTGCCTCTG No data
Right 1006519534 6:34563317-34563339 CTGAGGGTAGGGAGGGTAGTGGG No data
1006519522_1006519534 13 Left 1006519522 6:34563281-34563303 CCGCTGCCTTCTGCCTCTGCCCA No data
Right 1006519534 6:34563317-34563339 CTGAGGGTAGGGAGGGTAGTGGG No data
1006519524_1006519534 0 Left 1006519524 6:34563294-34563316 CCTCTGCCCAGAGAAGACTACGT No data
Right 1006519534 6:34563317-34563339 CTGAGGGTAGGGAGGGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006519534 Original CRISPR CTGAGGGTAGGGAGGGTAGT GGG Intergenic
No off target data available for this crispr