ID: 1006520786

View in Genome Browser
Species Human (GRCh38)
Location 6:34569976-34569998
Sequence AAGTTGGCCCCTGTATGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006520786_1006520794 -5 Left 1006520786 6:34569976-34569998 CCTGCCCATACAGGGGCCAACTT No data
Right 1006520794 6:34569994-34570016 AACTTGAATGAGGGGTCCCAGGG No data
1006520786_1006520793 -6 Left 1006520786 6:34569976-34569998 CCTGCCCATACAGGGGCCAACTT No data
Right 1006520793 6:34569993-34570015 CAACTTGAATGAGGGGTCCCAGG No data
1006520786_1006520795 3 Left 1006520786 6:34569976-34569998 CCTGCCCATACAGGGGCCAACTT No data
Right 1006520795 6:34570002-34570024 TGAGGGGTCCCAGGGTCAGTCGG No data
1006520786_1006520796 10 Left 1006520786 6:34569976-34569998 CCTGCCCATACAGGGGCCAACTT No data
Right 1006520796 6:34570009-34570031 TCCCAGGGTCAGTCGGCCCCAGG No data
1006520786_1006520799 14 Left 1006520786 6:34569976-34569998 CCTGCCCATACAGGGGCCAACTT No data
Right 1006520799 6:34570013-34570035 AGGGTCAGTCGGCCCCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006520786 Original CRISPR AAGTTGGCCCCTGTATGGGC AGG (reversed) Intergenic
No off target data available for this crispr