ID: 1006521355

View in Genome Browser
Species Human (GRCh38)
Location 6:34572966-34572988
Sequence CTTTGGGAGGCCCCAGCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006521355_1006521365 13 Left 1006521355 6:34572966-34572988 CCTTCAGCTGGGGCCTCCCAAAG No data
Right 1006521365 6:34573002-34573024 CTCACAGCCAGCCAAGGAAGGGG No data
1006521355_1006521362 11 Left 1006521355 6:34572966-34572988 CCTTCAGCTGGGGCCTCCCAAAG No data
Right 1006521362 6:34573000-34573022 CCCTCACAGCCAGCCAAGGAAGG No data
1006521355_1006521360 7 Left 1006521355 6:34572966-34572988 CCTTCAGCTGGGGCCTCCCAAAG No data
Right 1006521360 6:34572996-34573018 TCAACCCTCACAGCCAGCCAAGG No data
1006521355_1006521364 12 Left 1006521355 6:34572966-34572988 CCTTCAGCTGGGGCCTCCCAAAG No data
Right 1006521364 6:34573001-34573023 CCTCACAGCCAGCCAAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006521355 Original CRISPR CTTTGGGAGGCCCCAGCTGA AGG (reversed) Intergenic
No off target data available for this crispr