ID: 1006521356

View in Genome Browser
Species Human (GRCh38)
Location 6:34572979-34573001
Sequence GGTTGAAAGGATGCTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006521356_1006521364 -1 Left 1006521356 6:34572979-34573001 CCTCCCAAAGCATCCTTTCAACC No data
Right 1006521364 6:34573001-34573023 CCTCACAGCCAGCCAAGGAAGGG No data
1006521356_1006521360 -6 Left 1006521356 6:34572979-34573001 CCTCCCAAAGCATCCTTTCAACC No data
Right 1006521360 6:34572996-34573018 TCAACCCTCACAGCCAGCCAAGG No data
1006521356_1006521370 30 Left 1006521356 6:34572979-34573001 CCTCCCAAAGCATCCTTTCAACC No data
Right 1006521370 6:34573032-34573054 GTGCTTATCCCCATTTCAGAGGG No data
1006521356_1006521362 -2 Left 1006521356 6:34572979-34573001 CCTCCCAAAGCATCCTTTCAACC No data
Right 1006521362 6:34573000-34573022 CCCTCACAGCCAGCCAAGGAAGG No data
1006521356_1006521365 0 Left 1006521356 6:34572979-34573001 CCTCCCAAAGCATCCTTTCAACC No data
Right 1006521365 6:34573002-34573024 CTCACAGCCAGCCAAGGAAGGGG No data
1006521356_1006521369 29 Left 1006521356 6:34572979-34573001 CCTCCCAAAGCATCCTTTCAACC No data
Right 1006521369 6:34573031-34573053 AGTGCTTATCCCCATTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006521356 Original CRISPR GGTTGAAAGGATGCTTTGGG AGG (reversed) Intergenic
No off target data available for this crispr