ID: 1006521364

View in Genome Browser
Species Human (GRCh38)
Location 6:34573001-34573023
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006521356_1006521364 -1 Left 1006521356 6:34572979-34573001 CCTCCCAAAGCATCCTTTCAACC No data
Right 1006521364 6:34573001-34573023 CCTCACAGCCAGCCAAGGAAGGG No data
1006521354_1006521364 13 Left 1006521354 6:34572965-34572987 CCCTTCAGCTGGGGCCTCCCAAA No data
Right 1006521364 6:34573001-34573023 CCTCACAGCCAGCCAAGGAAGGG No data
1006521358_1006521364 -5 Left 1006521358 6:34572983-34573005 CCAAAGCATCCTTTCAACCCTCA No data
Right 1006521364 6:34573001-34573023 CCTCACAGCCAGCCAAGGAAGGG No data
1006521357_1006521364 -4 Left 1006521357 6:34572982-34573004 CCCAAAGCATCCTTTCAACCCTC No data
Right 1006521364 6:34573001-34573023 CCTCACAGCCAGCCAAGGAAGGG No data
1006521353_1006521364 16 Left 1006521353 6:34572962-34572984 CCACCCTTCAGCTGGGGCCTCCC No data
Right 1006521364 6:34573001-34573023 CCTCACAGCCAGCCAAGGAAGGG No data
1006521355_1006521364 12 Left 1006521355 6:34572966-34572988 CCTTCAGCTGGGGCCTCCCAAAG No data
Right 1006521364 6:34573001-34573023 CCTCACAGCCAGCCAAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006521364 Original CRISPR CCTCACAGCCAGCCAAGGAA GGG Intergenic
No off target data available for this crispr