ID: 1006521370

View in Genome Browser
Species Human (GRCh38)
Location 6:34573032-34573054
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006521356_1006521370 30 Left 1006521356 6:34572979-34573001 CCTCCCAAAGCATCCTTTCAACC No data
Right 1006521370 6:34573032-34573054 GTGCTTATCCCCATTTCAGAGGG No data
1006521358_1006521370 26 Left 1006521358 6:34572983-34573005 CCAAAGCATCCTTTCAACCCTCA No data
Right 1006521370 6:34573032-34573054 GTGCTTATCCCCATTTCAGAGGG No data
1006521366_1006521370 0 Left 1006521366 6:34573009-34573031 CCAGCCAAGGAAGGGGCTGCCAA No data
Right 1006521370 6:34573032-34573054 GTGCTTATCCCCATTTCAGAGGG No data
1006521359_1006521370 17 Left 1006521359 6:34572992-34573014 CCTTTCAACCCTCACAGCCAGCC No data
Right 1006521370 6:34573032-34573054 GTGCTTATCCCCATTTCAGAGGG No data
1006521367_1006521370 -4 Left 1006521367 6:34573013-34573035 CCAAGGAAGGGGCTGCCAAGTGC No data
Right 1006521370 6:34573032-34573054 GTGCTTATCCCCATTTCAGAGGG No data
1006521363_1006521370 8 Left 1006521363 6:34573001-34573023 CCTCACAGCCAGCCAAGGAAGGG No data
Right 1006521370 6:34573032-34573054 GTGCTTATCCCCATTTCAGAGGG No data
1006521361_1006521370 9 Left 1006521361 6:34573000-34573022 CCCTCACAGCCAGCCAAGGAAGG No data
Right 1006521370 6:34573032-34573054 GTGCTTATCCCCATTTCAGAGGG No data
1006521357_1006521370 27 Left 1006521357 6:34572982-34573004 CCCAAAGCATCCTTTCAACCCTC No data
Right 1006521370 6:34573032-34573054 GTGCTTATCCCCATTTCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006521370 Original CRISPR GTGCTTATCCCCATTTCAGA GGG Intergenic
No off target data available for this crispr