ID: 1006525823

View in Genome Browser
Species Human (GRCh38)
Location 6:34604004-34604026
Sequence CTGCTTAGATTAAGAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006525822_1006525823 14 Left 1006525822 6:34603967-34603989 CCTGCTCGATGCTTCATATAAAT 0: 1
1: 0
2: 1
3: 10
4: 116
Right 1006525823 6:34604004-34604026 CTGCTTAGATTAAGAAAAAAAGG No data
1006525821_1006525823 25 Left 1006525821 6:34603956-34603978 CCTTCAGGGAACCTGCTCGATGC 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1006525823 6:34604004-34604026 CTGCTTAGATTAAGAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006525823 Original CRISPR CTGCTTAGATTAAGAAAAAA AGG Intronic
No off target data available for this crispr