ID: 1006526520

View in Genome Browser
Species Human (GRCh38)
Location 6:34610370-34610392
Sequence ATCCAATAGCAGGCAGCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006526518_1006526520 -7 Left 1006526518 6:34610354-34610376 CCAATGAAGTGGGACAATCCAAT 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1006526520 6:34610370-34610392 ATCCAATAGCAGGCAGCCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 139
1006526515_1006526520 25 Left 1006526515 6:34610322-34610344 CCTGTGTTCAAAGCTCAATCTCA 0: 1
1: 0
2: 1
3: 17
4: 172
Right 1006526520 6:34610370-34610392 ATCCAATAGCAGGCAGCCTGAGG 0: 1
1: 0
2: 1
3: 13
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006526520 Original CRISPR ATCCAATAGCAGGCAGCCTG AGG Intronic
900307524 1:2018520-2018542 ATCCAGAAGCACGCAGCCTCGGG + Intergenic
904383407 1:30126151-30126173 ATCCAATGGGAGGAAGCCTGGGG + Intergenic
905865383 1:41373693-41373715 ATCCTAGAGTGGGCAGCCTGGGG - Intronic
907399444 1:54215910-54215932 ATAGAAGAGCAGGCACCCTGGGG + Intronic
907803815 1:57798393-57798415 AGCCAAAGACAGGCAGCCTGAGG + Intronic
911777760 1:101836704-101836726 AGACAATAGCAGGAAGCTTGAGG + Intronic
915156154 1:153878098-153878120 AAATAATTGCAGGCAGCCTGGGG + Intronic
918304302 1:183232108-183232130 ATCCAATACCAGGTACCCAGGGG - Intronic
919177981 1:194044057-194044079 AGCCAATAACAGGCAGCCAACGG + Intergenic
922045307 1:221939698-221939720 ACCCAAGAGCTGCCAGCCTGTGG + Intergenic
1062938948 10:1407561-1407583 ATCCAACAGAATGCAGGCTGAGG - Intronic
1063428590 10:5968322-5968344 ATCCTGTACCAGGCAGGCTGGGG + Intronic
1063604124 10:7508087-7508109 ACCCAAGAGCAGGGAGGCTGTGG + Intergenic
1066329720 10:34407256-34407278 ATCCAATGCCAGGCAGTCTGTGG - Intronic
1066407490 10:35132359-35132381 GGCCAAAAGCAGGCAGCATGTGG + Intronic
1066662491 10:37750401-37750423 ATACAACAGCAGGCAATCTGGGG - Intergenic
1067003380 10:42638404-42638426 CTCCAGGAGCAGGCAGCCGGGGG - Intronic
1067757086 10:49013437-49013459 ATTCAAGAGCTGGCAGCCTGAGG - Intergenic
1070329307 10:75406358-75406380 ATCCCAAAGCAGGAAGCCGGAGG - Intergenic
1073446840 10:103586017-103586039 ATCCCTGAGCAGGCAGCCTTGGG + Intronic
1076688375 10:132208305-132208327 ATACACTGGCAGGGAGCCTGGGG + Intronic
1077315101 11:1916133-1916155 GTGAAATAGCAGACAGCCTGGGG + Intergenic
1077751100 11:4970913-4970935 ATGCAACAGCATGCGGCCTGGGG + Intronic
1077816583 11:5691485-5691507 ATCCACAAGCAGACAGCCCGGGG - Intronic
1078282808 11:9919690-9919712 ATCCACAAGCAGACAGCCCGGGG - Intronic
1079086545 11:17449668-17449690 ATCCAAGAGCAGGCATCCTGAGG - Intronic
1079243999 11:18740106-18740128 GTCCAATAGGAGGCAGCTGGAGG + Intronic
1084978329 11:72815243-72815265 ATACAATCGCAGGCGGCCAGAGG - Intronic
1085051882 11:73384134-73384156 CTCTCTTAGCAGGCAGCCTGGGG + Intronic
1085127352 11:74010871-74010893 AACCCAGAGCAGGCAGCCTTCGG - Intergenic
1085313198 11:75528215-75528237 GACCAAAGGCAGGCAGCCTGGGG - Intergenic
1089782605 11:120884053-120884075 ATGCAGCAGCAGGCAGCGTGGGG + Intronic
1091042009 11:132290078-132290100 AAACAATAGCAGGAAGCTTGTGG - Intronic
1091056654 11:132425421-132425443 ATCCAATAGCAGGAAGACTTTGG + Intronic
1091545042 12:1496035-1496057 CTCCAATGGCAGGCAGCCCGAGG + Intergenic
1091790186 12:3267787-3267809 AACCACGAGGAGGCAGCCTGAGG - Intronic
1092798468 12:12138487-12138509 CTCCAATATCTTGCAGCCTGTGG - Exonic
1093301120 12:17457087-17457109 ATCCAGTGTCAGGAAGCCTGAGG + Intergenic
1093952197 12:25175787-25175809 ATCCAATAGAAGGCTGGGTGTGG + Intronic
1096598408 12:52712774-52712796 ATCAGAGAGCAGGAAGCCTGGGG - Intergenic
1098100043 12:67005587-67005609 ATTCAAACACAGGCAGCCTGTGG + Intergenic
1103200975 12:119087693-119087715 ATGGAATAGCAGTCAGCATGGGG + Intronic
1103242268 12:119423486-119423508 AGCCAATAGCAGGCACCATCAGG + Intronic
1104164251 12:126211715-126211737 ATACAACAAAAGGCAGCCTGTGG + Intergenic
1107757081 13:43636091-43636113 CTCCAACCTCAGGCAGCCTGAGG - Intronic
1113038543 13:106078679-106078701 ATTCAACAGCTGGCACCCTGGGG + Intergenic
1113475618 13:110578686-110578708 ATCCCATGGCAGGTGGCCTGGGG - Intergenic
1115089854 14:29560867-29560889 ATTCAATAGAAGGCAGACAGGGG + Intergenic
1117520955 14:56550909-56550931 AACCAAAAGCAGGCAGCCCGTGG - Intronic
1119146196 14:72316695-72316717 ATGCAATGGCAGGCAGCCTAGGG - Intronic
1119669941 14:76510548-76510570 ATCCAAGAGCTGCTAGCCTGGGG - Intergenic
1121425157 14:93845438-93845460 ATCCAGTAGCTGACAGCCTTTGG + Intergenic
1125417996 15:39473452-39473474 AGCTGTTAGCAGGCAGCCTGCGG - Intergenic
1132875378 16:2134877-2134899 ACCCAATAGCAGAGCGCCTGAGG + Intronic
1134519606 16:14912483-14912505 ACCCAATAGCAGAGCGCCTGAGG - Intronic
1134554325 16:15153752-15153774 ACCCAATAGCAGAGCGCCTGAGG + Intergenic
1134707278 16:16311139-16311161 ACCCAATAGCAGAGCGCCTGAGG - Intergenic
1134960263 16:18400986-18401008 ACCCAATAGCAGAGCGCCTGAGG + Intergenic
1135008026 16:18845300-18845322 AGCCTATAGGAGGCAGCCTGTGG - Intronic
1141378015 16:83549460-83549482 AACCGGCAGCAGGCAGCCTGAGG - Intronic
1142327241 16:89423795-89423817 ACGCAATGGCAGCCAGCCTGCGG + Intronic
1143130455 17:4674065-4674087 TTCCAAGGGCAGGCTGCCTGGGG - Intronic
1143852898 17:9825986-9826008 ATGCAAGAGGAGGCTGCCTGCGG + Exonic
1146300549 17:31685861-31685883 CTTTAATAGGAGGCAGCCTGAGG - Intergenic
1150294364 17:63999969-63999991 AGCCAATAGTGGGCATCCTGAGG + Intronic
1151261394 17:72918702-72918724 ATCCAGCAACAGTCAGCCTGCGG + Intronic
1152962707 18:89302-89324 ATCCAGGAGCAGGGAGCATGTGG - Intergenic
1153715531 18:7844006-7844028 TTCCAATGGCAAGCACCCTGAGG + Intronic
1153782575 18:8507102-8507124 ATCCGAGAGCCGGCAACCTGGGG + Intergenic
1156271087 18:35532534-35532556 ATCCACAAGCAGACAGCCTGGGG + Intergenic
1157139808 18:45094382-45094404 ATACAACAGCTGGCAGTCTGTGG - Intergenic
1157823545 18:50791668-50791690 GGCCAATGGCAGGCAGCCTGTGG - Intergenic
1160600745 18:80010800-80010822 ATAAAATAGAAAGCAGCCTGGGG - Intronic
1160880178 19:1316088-1316110 ATCCCGGAGCAGGCAGGCTGAGG + Intergenic
1161735292 19:5988542-5988564 ATCCAAGTGGAGGCAGCCAGTGG + Intergenic
1162460548 19:10811641-10811663 AACTAACGGCAGGCAGCCTGGGG - Intronic
1163590772 19:18193103-18193125 CACCAATCGCAGGCAGCCTCGGG - Intergenic
1166966270 19:46530959-46530981 ATCCAATAGGAGTCAGCCCTGGG + Intronic
925439888 2:3876406-3876428 TTCCAATAACAGGAAGACTGAGG + Intergenic
927775226 2:25897581-25897603 ATCCAGAAGCAGGCAGGGTGCGG - Intergenic
931323321 2:61194058-61194080 ATACAAAAACAGGCAGCATGTGG + Intronic
934896022 2:98120819-98120841 ATCCAAAAGAAGGCAACCTATGG + Intronic
938731941 2:134153430-134153452 TGCCAATGACAGGCAGCCTGAGG - Intronic
940114119 2:150189256-150189278 AGCCTATAACATGCAGCCTGTGG + Intergenic
941111367 2:161421855-161421877 TTCCAACAGAAGGCAGCCAGAGG - Intronic
945387639 2:209222500-209222522 ATCCAATAGCAGTTTGCCAGTGG - Intergenic
948334124 2:237194322-237194344 AGCCAATGCCTGGCAGCCTGGGG + Intergenic
1171143574 20:22763517-22763539 TTCCCATGGCAGGCAGGCTGTGG - Intergenic
1176171573 20:63698753-63698775 TTCTGATGGCAGGCAGCCTGAGG - Exonic
1180155283 21:45974524-45974546 ATCCAACCGCAGGCTGCCTCCGG + Intergenic
1180189118 21:46154276-46154298 ATCCAGCAGCACGCAGCCCGGGG + Exonic
1184882880 22:47322575-47322597 CTCCTATAGCTGGCAGGCTGTGG + Intergenic
949916131 3:8965992-8966014 CTCCAGGAGCTGGCAGCCTGGGG + Intergenic
950903962 3:16520756-16520778 ATCAGACAACAGGCAGCCTGAGG + Intergenic
951736344 3:25869189-25869211 GTCAAAGTGCAGGCAGCCTGGGG + Intronic
962355152 3:134687514-134687536 ATGCACCAGCAGGCACCCTGGGG - Intronic
964511185 3:157453678-157453700 ATCCCCTACCAGACAGCCTGAGG - Intronic
966264654 3:178024741-178024763 ATTCCATGGAAGGCAGCCTGTGG - Intergenic
967661465 3:192115672-192115694 ATTCAAAAGCTGACAGCCTGAGG + Intergenic
968318269 3:197742698-197742720 ATCCCAGAGCAGGGAACCTGCGG + Intronic
969715529 4:8866436-8866458 ACCCAAAAGCAGCCAGCTTGGGG + Intronic
969715664 4:8867137-8867159 TTCCAGGAGCAGGCAGGCTGGGG - Exonic
983264394 4:165492796-165492818 ATCCACAAGCAGGCAGCCCGGGG - Intronic
985305283 4:188532909-188532931 AGCTAAAAGGAGGCAGCCTGAGG + Intergenic
986405852 5:7424254-7424276 CTCCAGTAGCAGGCACCATGTGG + Intronic
991172424 5:63644224-63644246 ATGCATTTGCAGGCAGGCTGGGG + Intergenic
992553172 5:77878512-77878534 ATTCAATAACAGGCAGCATTAGG - Intergenic
995725081 5:115173461-115173483 TTCCAATACCAAGCTGCCTGTGG - Intronic
997615144 5:135240951-135240973 TTCCAAAAGCTGGCAGCCTCTGG - Intronic
1000029928 5:157393057-157393079 ATCCTATGGCAGGCTGGCTGTGG - Exonic
1000808391 5:165827242-165827264 TTCCCATAGCAAGCAGCTTGCGG - Intergenic
1003848477 6:10198161-10198183 ATCCAAAAGCAGCCAACCTATGG - Intronic
1006526520 6:34610370-34610392 ATCCAATAGCAGGCAGCCTGAGG + Intronic
1009280891 6:61749770-61749792 ATCTAAGAGCAATCAGCCTGGGG + Intronic
1010123849 6:72410619-72410641 ATCAAAAAGCAGAGAGCCTGGGG - Intergenic
1011018420 6:82783969-82783991 ATGCAGAAACAGGCAGCCTGTGG + Intergenic
1011783686 6:90819416-90819438 ATCCTCAAGCAGGCAGCCCGAGG + Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1013950880 6:115780560-115780582 AGCCAATAGCAAGTTGCCTGAGG + Intergenic
1017117102 6:150988310-150988332 AGCCAAGAGCATTCAGCCTGAGG + Intronic
1018053075 6:160028574-160028596 ATTCTCTAGCAGGCAGCCAGGGG + Intronic
1018320521 6:162603394-162603416 AACCAATAGCAGGCTGCATCTGG - Intronic
1018402771 6:163442090-163442112 ATCACATAGCACGCAGCCTCTGG - Intronic
1018796260 6:167187642-167187664 ATCCAAGAGCTGTGAGCCTGTGG + Intronic
1019215466 6:170440150-170440172 AGCCAACAGCAGACAGCCTGGGG - Intergenic
1019502204 7:1369925-1369947 ATCCCATTACAGGCTGCCTGGGG - Intergenic
1022220566 7:28309649-28309671 ATCAAAAAGGAGCCAGCCTGAGG - Intronic
1026240556 7:68571138-68571160 AACCAAAAGCAGGCAGTTTGTGG + Intergenic
1030166872 7:106564102-106564124 ATCCAAGAGCAGGCTGACTTTGG + Intergenic
1031528717 7:122851443-122851465 TTCCCACAGCAGGAAGCCTGAGG + Intronic
1032313885 7:130815773-130815795 ATCCAGTAGCAGTCAACCTGAGG - Intergenic
1034677015 7:152899149-152899171 ATACAGAAGCTGGCAGCCTGTGG + Intergenic
1035388435 7:158489769-158489791 CTCCTCGAGCAGGCAGCCTGCGG + Exonic
1035691834 8:1564413-1564435 AACACACAGCAGGCAGCCTGTGG + Intronic
1036054768 8:5239257-5239279 ATGCACTAGCAAGCAGCTTGGGG - Intergenic
1037720723 8:21441636-21441658 ATCCAACAGCCTGCAGCCTCAGG - Intergenic
1043178670 8:77055100-77055122 ATCCAAGATCAGGCACCATGGGG - Intergenic
1044271949 8:90255088-90255110 ATCCAATAGTAGGCAGACAAAGG + Intergenic
1045650935 8:104341146-104341168 TTTCAATAGCAGTAAGCCTGTGG + Intronic
1048049572 8:130804665-130804687 ATAAAATGGCAGGCAGCCAGGGG + Intronic
1057215056 9:93223403-93223425 CTCCAGTTTCAGGCAGCCTGGGG - Intronic
1058963367 9:110013139-110013161 ATCCACTTGCAGGCTGACTGGGG + Intronic
1059514597 9:114881279-114881301 ATCCCAGAGCAGGCATCCAGAGG + Intergenic
1061614699 9:131772192-131772214 GTCCTCTTGCAGGCAGCCTGGGG - Intergenic
1061952371 9:133943632-133943654 ACCCCATAGCCGCCAGCCTGGGG - Intronic
1062039393 9:134397067-134397089 ACCCCAGAGCAGGAAGCCTGGGG - Intronic
1062651678 9:137581007-137581029 ATCTGAAAGCAGGCTGCCTGAGG + Intergenic
1062735432 9:138134816-138134838 ATCCAGGAGCAGGGAGCATGTGG + Intergenic
1187482523 X:19670941-19670963 TTCCAACAGCACGGAGCCTGAGG + Intronic
1189952585 X:46247733-46247755 CCACAATAGCAGGCAGCCAGTGG + Intergenic
1192034146 X:67545457-67545479 ATCCAGGACCAGGTAGCCTGTGG - Exonic
1193553834 X:82930447-82930469 CTCCAATTGCAGCCATCCTGAGG - Intergenic
1200317071 X:155145635-155145657 ATCCACAAGCAGGTTGCCTGAGG - Intronic
1201941587 Y:19466253-19466275 ACCAAATAGCAGGGAGACTGGGG + Intergenic