ID: 1006530960

View in Genome Browser
Species Human (GRCh38)
Location 6:34653451-34653473
Sequence TGGGAGGATCACTTCAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45156
Summary {0: 1, 1: 9, 2: 334, 3: 4909, 4: 39903}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006530960_1006530966 -2 Left 1006530960 6:34653451-34653473 CCTCATCTGAAGTGATCCTCCCA 0: 1
1: 9
2: 334
3: 4909
4: 39903
Right 1006530966 6:34653472-34653494 CACCTCGGCCTCCCAAAGCTGGG 0: 9
1: 61
2: 431
3: 1471
4: 2854
1006530960_1006530969 6 Left 1006530960 6:34653451-34653473 CCTCATCTGAAGTGATCCTCCCA 0: 1
1: 9
2: 334
3: 4909
4: 39903
Right 1006530969 6:34653480-34653502 CCTCCCAAAGCTGGGATTACAGG 0: 54
1: 170
2: 478
3: 1204
4: 6789
1006530960_1006530965 -3 Left 1006530960 6:34653451-34653473 CCTCATCTGAAGTGATCCTCCCA 0: 1
1: 9
2: 334
3: 4909
4: 39903
Right 1006530965 6:34653471-34653493 CCACCTCGGCCTCCCAAAGCTGG 0: 11
1: 89
2: 306
3: 595
4: 1083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006530960 Original CRISPR TGGGAGGATCACTTCAGATG AGG (reversed) Intronic
Too many off-targets to display for this crispr