ID: 1006531924

View in Genome Browser
Species Human (GRCh38)
Location 6:34662936-34662958
Sequence AGCCAGGCTGGGACTACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006531919_1006531924 14 Left 1006531919 6:34662899-34662921 CCTTGTCTCTATAAAATTTAAAA 0: 3
1: 55
2: 769
3: 5765
4: 30998
Right 1006531924 6:34662936-34662958 AGCCAGGCTGGGACTACACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006531924 Original CRISPR AGCCAGGCTGGGACTACACA GGG Intronic
No off target data available for this crispr