ID: 1006533149

View in Genome Browser
Species Human (GRCh38)
Location 6:34674582-34674604
Sequence GAATTGAAACAGATTGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 172}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006533147_1006533149 -5 Left 1006533147 6:34674564-34674586 CCCAAAAATCAGTTGAAAGAATT 0: 1
1: 0
2: 4
3: 71
4: 624
Right 1006533149 6:34674582-34674604 GAATTGAAACAGATTGCCTCTGG 0: 1
1: 0
2: 2
3: 25
4: 172
1006533148_1006533149 -6 Left 1006533148 6:34674565-34674587 CCAAAAATCAGTTGAAAGAATTG 0: 1
1: 0
2: 2
3: 27
4: 396
Right 1006533149 6:34674582-34674604 GAATTGAAACAGATTGCCTCTGG 0: 1
1: 0
2: 2
3: 25
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006533149 Original CRISPR GAATTGAAACAGATTGCCTC TGG Intronic
902673286 1:17990789-17990811 GTAATGAAACAGATTACCTTAGG - Intergenic
903408491 1:23119472-23119494 GAAATGAAGCAGTTTGCCTAAGG - Intronic
904865222 1:33573099-33573121 GAATTAAAAGAGCTTTCCTCTGG - Intronic
905831175 1:41069391-41069413 AAATTGAAAGTGATTGCCCCTGG + Intronic
907125825 1:52050010-52050032 GAACTGAAACAGCTTGCCCAAGG + Intronic
907787186 1:57624046-57624068 GAGGTGAAACAGCTTGCCTGGGG - Intronic
908087286 1:60649591-60649613 GAAGCTAAACAGCTTGCCTCAGG + Intergenic
910472137 1:87565801-87565823 GAATTGTAAAAGATTAACTCAGG - Intergenic
911683878 1:100750481-100750503 GAATAAAAACAGATTGCATTTGG - Intergenic
911731138 1:101293526-101293548 AAATTGGGACAGATGGCCTCAGG + Intergenic
915038643 1:152949231-152949253 CAATTAAAACAGAATTCCTCTGG + Intergenic
915795498 1:158728939-158728961 GAAATTAAACTTATTGCCTCTGG + Intergenic
917224416 1:172766345-172766367 GAACTGAAACAGTTTGCTTTAGG + Intergenic
917675527 1:177315690-177315712 TAATTGAAAGCAATTGCCTCTGG + Intergenic
918083719 1:181227392-181227414 GAATTGAAAGAGGTTGCCTCTGG - Intergenic
918134254 1:181657438-181657460 GAGTTGAAAGTGGTTGCCTCTGG + Intronic
918430316 1:184453001-184453023 GAATTCAGACCAATTGCCTCTGG - Intronic
921115306 1:212084600-212084622 GATTTGAAAGAGGTTGCCTCTGG - Intronic
921352704 1:214253187-214253209 TAATTGAGAGAGATTGTCTCTGG - Intergenic
921534979 1:216336956-216336978 GAATTGATTCAGATTTCCTTAGG + Intronic
921821065 1:219618017-219618039 GAATTCAAACAGATGTGCTCAGG + Intergenic
923006667 1:230055352-230055374 GCATTGAAACTGACTCCCTCTGG + Intergenic
924328790 1:242921882-242921904 GAATTGCAACAGGGTGCCACGGG + Intergenic
1063291881 10:4758093-4758115 GGATTGAAATAGCTTGCCTCAGG - Intergenic
1066072331 10:31831369-31831391 GACTTAACACTGATTGCCTCTGG + Intronic
1067529893 10:47062628-47062650 GAATTCAAAGTGATTGCCTCTGG - Intergenic
1068177657 10:53482644-53482666 GAATTTAAATAGATTACTTCAGG + Intergenic
1068377447 10:56199904-56199926 GAATTGAATATGATTGTCTCTGG + Intergenic
1069561068 10:69429883-69429905 GAATTGAAATCAATTGCCTCTGG - Intergenic
1070840425 10:79483523-79483545 GAGTTGAGAGTGATTGCCTCTGG + Intergenic
1074592187 10:114822801-114822823 GAAAGGAAACAGATGGTCTCTGG - Intronic
1077700196 11:4434257-4434279 TAATTGAATCAGATTTTCTCAGG + Intergenic
1078279488 11:9885849-9885871 GAATTGAAACAGACTCACACAGG + Intronic
1078682328 11:13488436-13488458 GTACTGAATCAGCTTGCCTCAGG + Intergenic
1079395767 11:20061939-20061961 GAACAGTAACAGGTTGCCTCCGG + Intronic
1081001551 11:37679770-37679792 GAGTGAAAACAGATTGCTTCTGG - Intergenic
1081166618 11:39815572-39815594 GAATTTAAGCAGATTTCCTGGGG - Intergenic
1081819176 11:45975011-45975033 GATTTAAAACAGATGGACTCAGG + Intronic
1085729553 11:78984592-78984614 CAACTGAAATAGATTGCCTCTGG - Intronic
1087798185 11:102476413-102476435 TAATTGAAACTGATAGCCTTAGG - Intronic
1087953917 11:104259773-104259795 GAATTGTAAAATAATGCCTCCGG - Intergenic
1088785053 11:113173920-113173942 GATTTGGAACAGGTGGCCTCTGG - Intronic
1089208665 11:116785990-116786012 GAGTGGAAACAGAGTGACTCAGG + Intronic
1089246920 11:117128408-117128430 GTATTGAATTAGAATGCCTCAGG - Intergenic
1092799418 12:12149204-12149226 GCATTGTGACTGATTGCCTCAGG - Intronic
1096185721 12:49579323-49579345 GAATTGAAACAGCTTCCAGCTGG + Intronic
1099047165 12:77736291-77736313 AAACTGAAACAGTTTGCTTCTGG - Intergenic
1099320746 12:81145316-81145338 TTATTGAAATAGATTGTCTCAGG - Intronic
1099959478 12:89382915-89382937 GTTTTGAAACAGATTGCTCCAGG - Intergenic
1107647351 13:42508820-42508842 GAATTAAAACATTTTGCCACTGG + Intergenic
1107739911 13:43438721-43438743 GACTTGAATCAAATTGCCTGAGG + Intronic
1108925479 13:55737179-55737201 GAATTTATGCAGATTGCCTGAGG - Intergenic
1109233042 13:59782430-59782452 GAATTAAAAGTGATTGCCTCTGG + Intronic
1111378139 13:87408220-87408242 GAGTTGAAAGAGGTTGCCTCTGG - Intergenic
1114893370 14:26953892-26953914 TAATTAAAAAAAATTGCCTCTGG + Intergenic
1115486846 14:33918690-33918712 GAATTGAAAGAGGCTGGCTCTGG - Intergenic
1117592721 14:57290688-57290710 GAATGGCAACAGATGGCATCAGG - Exonic
1119442655 14:74638683-74638705 GAACTGAGGCAGAGTGCCTCAGG + Intergenic
1120824230 14:88940861-88940883 GACTTGAAACAGTTTTCTTCTGG - Intergenic
1121106348 14:91282342-91282364 GAGTTGAAAGTGATTGCCTTTGG - Intronic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1126775019 15:52093087-52093109 GAATTTAAAAACATTTCCTCAGG - Intergenic
1128485528 15:68082814-68082836 GACTTGAAAGTGGTTGCCTCGGG + Intronic
1129025707 15:72571816-72571838 GATTTGAAATGGACTGCCTCAGG + Intronic
1130116874 15:81013121-81013143 GAATTGAAACCACTTGCCTAGGG + Intronic
1130434168 15:83880716-83880738 GTATTGGAACACTTTGCCTCGGG - Intronic
1132949133 16:2550806-2550828 AAATAGAAACAGCTTTCCTCCGG + Intronic
1132965455 16:2651322-2651344 AAATAGAAACAGCTTTCCTCCGG - Intergenic
1134211586 16:12281905-12281927 GAATGGAAACAGATTCTATCTGG - Intronic
1138763401 16:59570811-59570833 GAATTAAAAAAGATTGTCACTGG + Intergenic
1141868422 16:86767461-86767483 AAATTGAAACACATAGACTCTGG + Intergenic
1145196579 17:20899420-20899442 GAATTGTGACTGATGGCCTCAGG - Intergenic
1149375258 17:56037539-56037561 GAATTTACACAGATTAGCTCAGG - Intergenic
1151289731 17:73141040-73141062 GATTGGATACAGATTGCCTGTGG + Intergenic
1153595432 18:6720499-6720521 GAATTGCATCAGATTGGCTGTGG - Intergenic
1153633738 18:7096328-7096350 TAATGGAAACAGATTTCCACTGG + Intronic
1154142470 18:11836842-11836864 CATTTGAAGGAGATTGCCTCAGG + Intronic
1155890403 18:31261429-31261451 GAATTCAAAGAGGTTGCCTCTGG + Intergenic
1156087730 18:33428112-33428134 GAATTGAAAGAAATTTCTTCAGG - Intronic
1156247710 18:35318217-35318239 GAATTAAAACAGTTTCCCCCAGG + Intergenic
1158869902 18:61676020-61676042 GAATTGAAACCGGTTGCCTCAGG + Intergenic
1164455650 19:28404400-28404422 GAAATGAAACAGATGGCCTTGGG + Intergenic
928670082 2:33594048-33594070 GAATTTAAATACATTGCCTGAGG - Intronic
931304436 2:61014984-61015006 TACTAAAAACAGATTGCCTCTGG + Intronic
931556721 2:63514144-63514166 GAATTAAAATTGGTTGCCTCTGG + Intronic
936455010 2:112666279-112666301 GAATTGAAAGTGGTTGCCTCAGG - Intergenic
936603845 2:113927952-113927974 AAATTGAAAATGTTTGCCTCCGG - Intronic
939054098 2:137341844-137341866 TAATTAAAACAGAATGCTTCTGG - Intronic
939076947 2:137614694-137614716 TAATTGAATCAAATTGTCTCTGG - Intronic
939229433 2:139407617-139407639 GAATTGAATGCGATTGCATCTGG + Intergenic
939243075 2:139587340-139587362 GAACTGAAACAGATTCTCTATGG - Intergenic
939984000 2:148812658-148812680 GAAATGAGACACATTGCTTCTGG + Intergenic
940018645 2:149133449-149133471 GAAGTGAAACAGATTTACTCTGG - Intronic
940246495 2:151623710-151623732 GAAGAAAAACAGATTCCCTCTGG - Intronic
941962532 2:171268220-171268242 GAATTGAGACAGAGTGCCCAGGG - Intergenic
942219359 2:173754504-173754526 GAGTTGAAAGCGGTTGCCTCTGG + Intergenic
944454082 2:199875622-199875644 GACTTGAAACAAATGCCCTCAGG - Intergenic
944493713 2:200284577-200284599 CAATTCAAAGTGATTGCCTCTGG + Intergenic
945139742 2:206672096-206672118 TACTTCAAACAGATTACCTCTGG + Intronic
946957268 2:224944645-224944667 GATTTGAAACAGATATCCTGAGG - Intronic
947466500 2:230353272-230353294 GAAATGAAACATATTGCATAAGG - Intronic
1170292029 20:14781316-14781338 GCATTTAAACAGATGACCTCAGG + Intronic
1172953545 20:38738701-38738723 GAATTGAAAGTAGTTGCCTCTGG - Intergenic
1173240436 20:41291078-41291100 GAAGTTAAATACATTGCCTCAGG + Intronic
1178911534 21:36678233-36678255 GAATTGAAACAAATTCCCGGTGG + Intergenic
1179355335 21:40653491-40653513 TCATTGAGTCAGATTGCCTCTGG - Intronic
1182248323 22:28978727-28978749 GAATTGAAAATGGTTGCCTCTGG - Intronic
1183542444 22:38437279-38437301 GGGTTGAAACAGGTGGCCTCTGG - Intronic
949545294 3:5067312-5067334 GAATTTAAACAGATTAGCTCAGG - Intergenic
957936679 3:86952949-86952971 GTATTTAAAGTGATTGCCTCAGG - Intronic
958954782 3:100455799-100455821 GAAATGAAAGAGAATGCCTGAGG + Exonic
959841073 3:110975876-110975898 GAAGTGAAGCAATTTGCCTCAGG - Intergenic
961225621 3:125242888-125242910 GAATTGAAACATTTTGGTTCTGG - Intronic
964707427 3:159634241-159634263 GAGTTGCAATGGATTGCCTCTGG + Intronic
967657089 3:192063488-192063510 TAATTGAAAGTGATTGTCTCTGG + Intergenic
969851350 4:9959546-9959568 GAGTTGTAAGAGATTGCCTCTGG + Intronic
970067777 4:12118796-12118818 GAACTAAAACATATTGCCTGAGG + Intergenic
970327231 4:14938929-14938951 GATTTGAAATGGGTTGCCTCTGG + Intergenic
970328392 4:14953147-14953169 CAATTGAAAGAGGTTGGCTCTGG - Intergenic
970468632 4:16352975-16352997 GAATTGAAAGAGGTTGTCTTAGG + Intergenic
970472213 4:16390060-16390082 GAAATGAAACAGACTCCCTGGGG - Intergenic
970698863 4:18710934-18710956 GAATTGAGAGTGATTGCTTCTGG + Intergenic
971228442 4:24777243-24777265 GGATTGAAATATATTGCTTCTGG - Intergenic
976129371 4:81868415-81868437 GAACTGACACTGATTGCCTCAGG + Intronic
977663483 4:99617649-99617671 GATTGGAATCAGATTGCCTGGGG - Intronic
977862395 4:101979247-101979269 GAAAAAAAACAGACTGCCTCTGG + Intronic
979342370 4:119541457-119541479 TATTTGAAACAGATTTCCACTGG + Intronic
979477402 4:121174174-121174196 GTGTTGAAATATATTGCCTCAGG - Intronic
979806162 4:124973829-124973851 GTATTGACACTGATTTCCTCTGG + Intergenic
980617570 4:135251067-135251089 TGATTGAAACAGAATGCATCTGG - Intergenic
986396979 5:7340933-7340955 GGATTGAAACAGAATTCATCAGG + Intergenic
987696445 5:21340449-21340471 GTGTTGACACAGATGGCCTCAGG - Intergenic
988943566 5:36171021-36171043 CATTTAAAATAGATTGCCTCTGG + Intronic
989206825 5:38817540-38817562 GAGCTGAAACTAATTGCCTCTGG - Intergenic
989600547 5:43196697-43196719 GAGTTCAAAATGATTGCCTCTGG - Intronic
990015670 5:51059079-51059101 GAATGGAAGCAGACTGCCACTGG - Intergenic
990666107 5:58073828-58073850 GACTTGAAATAGATTCCCTTAGG - Intergenic
991443421 5:66675363-66675385 GAAGGGAAAGAGATTGCCACTGG + Intronic
991513863 5:67412133-67412155 AAATAGAAACACATTGACTCTGG - Intergenic
993137116 5:83983370-83983392 GAAATGAAAGAGATTGGATCAGG + Intronic
994140924 5:96340266-96340288 GAAATGAAACAGTTTGCCAGAGG - Intergenic
995023538 5:107393621-107393643 GAATTGAGAAATATTGCCTGTGG - Intronic
995720314 5:115123700-115123722 GAATGGAACCAGATTCCCTAGGG - Intergenic
997129082 5:131258492-131258514 GAATTGTAACAAAATGCCTCTGG - Intronic
997346429 5:133195726-133195748 GATGTGAAACAGATTCACTCTGG - Intergenic
998622670 5:143812124-143812146 GAATTGGACCAGAATGACTCTGG - Intergenic
998965531 5:147536069-147536091 GACTTGAAACAACTTGCCTAAGG + Intergenic
1000577339 5:162990564-162990586 GGAATGAAACAGATTGGCTAAGG - Intergenic
1000645074 5:163751253-163751275 GAAATAAAACAGTTTGGCTCTGG - Intergenic
1002315243 5:178339158-178339180 GAACTAAAACCCATTGCCTCAGG + Intronic
1005469419 6:26147410-26147432 GTGTTTAAACAGATTGACTCTGG - Intergenic
1006533149 6:34674582-34674604 GAATTGAAACAGATTGCCTCTGG + Intronic
1007744393 6:44034555-44034577 GAATTGCAACAGCTGGCCACGGG + Intergenic
1008236367 6:49056834-49056856 CACTAGAAACAGATTGCCTCAGG - Intergenic
1009444127 6:63719862-63719884 GAATTAAAAATGGTTGCCTCTGG - Intronic
1009804262 6:68582046-68582068 GAATTCAAACAGATTTCTGCAGG + Intergenic
1010760234 6:79714195-79714217 GAATTGGAGCATAATGCCTCTGG - Intergenic
1011516375 6:88158792-88158814 TCATTGAAACAGATTGCTACAGG + Intronic
1013070429 6:106724110-106724132 TTATTGAAACAGATTCTCTCTGG + Intergenic
1013835849 6:114334263-114334285 GAATTGGAAAAGCTTGCCACGGG - Intronic
1013867429 6:114715510-114715532 TAATTGAAATAGATTCTCTCAGG + Intergenic
1017673556 6:156791546-156791568 GAATTGAAACTTGCTGCCTCAGG + Intronic
1018109657 6:160522955-160522977 GAATTGGAAGTGTTTGCCTCTGG - Intergenic
1018246511 6:161829525-161829547 GAATTGAAACAGGTTTCCTGAGG + Intronic
1020546510 7:9540009-9540031 CAATTGAAACACAGTTCCTCAGG - Intergenic
1022673184 7:32475144-32475166 AAATTGGAACAGCTTGCCTCAGG - Intergenic
1023338555 7:39195341-39195363 CAATTGAAAATGATAGCCTCTGG - Intronic
1023975524 7:45027042-45027064 GAAATTAAACAGCGTGCCTCTGG - Intronic
1024643956 7:51355942-51355964 GAATTTAAACAGAAGGCCACTGG - Intergenic
1027404220 7:77842620-77842642 GACTTTAAAATGATTGCCTCTGG - Intronic
1028409928 7:90518936-90518958 GAATGGAACCAGATTCCCTAGGG - Intronic
1030327428 7:108235652-108235674 GGGTGGAAACAAATTGCCTCTGG - Intronic
1032027126 7:128452479-128452501 CAATTCAAACATATTTCCTCTGG - Intergenic
1033422296 7:141214617-141214639 GAATTCAAAGAGATTACCTAGGG + Intronic
1035400492 7:158562092-158562114 GAACTGTAACAGAATGCCACAGG + Intronic
1036215898 8:6879548-6879570 GAATTGAAACAAATTGCCCAAGG + Intergenic
1037097143 8:14999725-14999747 GAATTGACTCAGACTGCCTGGGG - Intronic
1038291769 8:26256162-26256184 AAATTCAAACAGATTGACCCAGG - Intergenic
1038593099 8:28858946-28858968 TAAATGAGACAGATTGCCTCAGG - Intronic
1038974366 8:32676507-32676529 AAATTTAAACAGATTGCCAAGGG - Intronic
1043513394 8:80972489-80972511 GGAATGAAACAGAATGCCACAGG + Exonic
1044622055 8:94200330-94200352 GAATTGAAATAGATTTCCAGAGG + Intronic
1045266669 8:100624369-100624391 GATTTGAAAGTCATTGCCTCTGG + Intronic
1045839965 8:106568043-106568065 AAATGGAAACACATTTCCTCAGG + Intronic
1048402423 8:134084115-134084137 GTATTGATACAGATTGTCTCTGG - Intergenic
1054131325 9:61369134-61369156 GAATTGACACACATTGCCAATGG - Intergenic
1055149845 9:72983604-72983626 GACTTGAAACAGATTGCTGCAGG - Intronic
1055937826 9:81619850-81619872 GAATTTAAACAAGATGCCTCTGG + Intronic
1056373828 9:85987136-85987158 GAAATGGAAGAGACTGCCTCTGG + Intronic
1056498668 9:87186476-87186498 GAATTTAAGCAGTTTGCCTCAGG - Intergenic
1058761569 9:108138717-108138739 GAATAGAAAGAGATTTCCACGGG + Intergenic
1059683035 9:116604898-116604920 GAGTGGATACAGATGGCCTCTGG + Intronic
1060688989 9:125639334-125639356 GAAGTTAAACAGCTTGCCTTAGG - Intronic
1187735569 X:22300411-22300433 AAACTGAATGAGATTGCCTCTGG + Intergenic
1187854706 X:23625584-23625606 AAATTGAAACAGTTTTCCCCTGG - Intergenic
1192355881 X:70403173-70403195 GAATGAAAATTGATTGCCTCTGG + Intronic
1193750816 X:85341276-85341298 CAATTGAAAATGATTGCCTCTGG + Intronic
1195116902 X:101708070-101708092 GAAATAAATAAGATTGCCTCTGG - Intergenic
1196542064 X:116921889-116921911 GAATTCAAACACATTGCCCGGGG - Intergenic
1198209414 X:134502900-134502922 GAATGTAAACTGATTTCCTCTGG + Intronic