ID: 1006534315

View in Genome Browser
Species Human (GRCh38)
Location 6:34685737-34685759
Sequence TTCAGCCATCACTAAAAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006534315_1006534317 10 Left 1006534315 6:34685737-34685759 CCCAACTTTTAGTGATGGCTGAA 0: 1
1: 0
2: 4
3: 19
4: 142
Right 1006534317 6:34685770-34685792 TATATATTTACTAAAAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006534315 Original CRISPR TTCAGCCATCACTAAAAGTT GGG (reversed) Intronic
905023780 1:34836295-34836317 TTCAGTCCCCAGTAAAAGTTGGG - Intronic
905233990 1:36533090-36533112 TTCAGCAGTCTCCAAAAGTTGGG + Intergenic
905266000 1:36754819-36754841 TTCAGCAATCACTCAATGGTAGG + Intergenic
905661533 1:39729881-39729903 TTCCACCATCACTAGAAGTCCGG + Intronic
908264317 1:62363214-62363236 TTGAGCCATCACTTTAAGTCAGG - Intergenic
909701936 1:78534929-78534951 TTCAGCCACCAATAAATGTGGGG - Intronic
910208333 1:84770044-84770066 TTCAGCCATCTCTGAAAAATTGG + Intergenic
911472862 1:98339892-98339914 TTCAGACATGACCAAAAGCTGGG + Intergenic
918093295 1:181315506-181315528 TTCAGACATAACAAAAAGATTGG - Intergenic
918354724 1:183696755-183696777 TTCAGGGATGACTAAAATTTGGG - Intronic
920880703 1:209877795-209877817 TTCAGCCTTCACTATAAATTGGG - Intergenic
921284382 1:213595873-213595895 TTCAGGGATCACTAAAATGTGGG - Intergenic
921477128 1:215625203-215625225 TTCAGCCTTGTCAAAAAGTTTGG + Exonic
1063073511 10:2690871-2690893 TTCAGGCTTCTCTAAAAGGTGGG + Intergenic
1065725436 10:28664152-28664174 TTCAGCCAACACTGGAACTTTGG - Intergenic
1071848389 10:89543065-89543087 TACAGATATCACTAGAAGTTGGG - Intronic
1072465455 10:95658192-95658214 TTCAGCCATCCCTGAATGTCTGG - Intergenic
1077165641 11:1135770-1135792 GTCAGTCAACACTAAAATTTAGG + Intergenic
1078042151 11:7877184-7877206 TTCATCCATTACTAAAAGTGGGG - Intergenic
1079467347 11:20743539-20743561 TTTAGCCATCACCTAAAGCTAGG + Intronic
1079972739 11:27056608-27056630 TTCAGTTATCACAGAAAGTTTGG + Intronic
1080434081 11:32223752-32223774 TTCCCCCAGCACTAAAAGTAAGG + Intergenic
1085019943 11:73200173-73200195 TTCACCCATGACAAAAAGTCAGG + Intergenic
1087889819 11:103525334-103525356 TTCAGCCCCCACTCAAAGTGGGG + Intergenic
1090973530 11:131662837-131662859 TTCATCCATCACAATAAGCTGGG - Intronic
1098766759 12:74500030-74500052 GACAGCCATCACCAGAAGTTAGG - Intergenic
1099078787 12:78148326-78148348 TCCTGCAATCACTAAAACTTGGG - Intronic
1099171776 12:79373269-79373291 TTCACCTATCAGTAAAACTTTGG + Intronic
1100457896 12:94770105-94770127 TTCACACATCAATAAAAGTTTGG - Intergenic
1100998489 12:100330064-100330086 TTCAGCCCACACTCAAAGATAGG + Intronic
1101725295 12:107383649-107383671 TGCAGCCATCTCTGAAAGGTAGG - Intronic
1106328950 13:28721025-28721047 TTCAGCCATCTCATATAGTTAGG + Intergenic
1106529939 13:30581306-30581328 TTCAGCTATCATCAAAAGCTGGG - Intronic
1106693937 13:32150096-32150118 ATAATTCATCACTAAAAGTTAGG + Intronic
1107234637 13:38153596-38153618 TCCAGCCATGACTAAAAGGGGGG - Intergenic
1108738822 13:53313740-53313762 TTCACCCATCAATAAAATTTAGG - Intergenic
1113918993 13:113895204-113895226 TTCTGCCATTACCAAAAGTTGGG + Intergenic
1114064317 14:19048030-19048052 CTCAGCCAGCACTAAAAGTTGGG + Intergenic
1114097942 14:19351968-19351990 CTCAGCCAGCACTAAAAGTTGGG - Intergenic
1116741080 14:48755538-48755560 TTCAGCAATGACTAAAAGTTTGG - Intergenic
1117036404 14:51734158-51734180 TTCAGCCATGACGGAAAGATGGG + Intergenic
1127433774 15:58936582-58936604 TTCAGCCTTCTCTCAAATTTTGG - Intronic
1130945364 15:88546723-88546745 TTCAGCCAACACTAAGAGACAGG + Intergenic
1137386757 16:48049170-48049192 TTCATCCATCTCCAAAAGCTAGG - Intergenic
1139112930 16:63914284-63914306 TTCAGCCATCAAAAAGACTTTGG + Intergenic
1139141403 16:64267256-64267278 CTCAGCCTTCACCAGAAGTTAGG - Intergenic
1141051250 16:80766399-80766421 TTCAGCCTTCAGTAAATTTTAGG - Intronic
1141260359 16:82447914-82447936 GCCAGCCATCACTAGAAGCTAGG - Intergenic
1151395570 17:73820363-73820385 TACTGCCATCACTAAGAATTTGG + Intergenic
1151771910 17:76168820-76168842 TTCACACTTCACTGAAAGTTTGG + Intronic
1153624066 18:7006550-7006572 GTCATCCATCACTTAAAGATGGG + Intronic
1159465146 18:68771761-68771783 TTCAGCCATCAGTGAAAGTAGGG + Intronic
1163974292 19:20834892-20834914 ATAAGCCATAACTAAAATTTGGG + Intronic
1168087933 19:54062181-54062203 GTCAGCCATCACTAGAAGAGGGG + Intronic
1168576708 19:57517838-57517860 TTCAGCCCTCTTTAAAAGCTTGG + Intronic
1168667384 19:58214746-58214768 TGAAGCCATCACTAAAACTTTGG - Intergenic
925503272 2:4530499-4530521 TTCAGCCTTAACAAAAAGTTCGG - Intergenic
928762137 2:34596937-34596959 TTAAGCAAGCACTAAAATTTTGG - Intergenic
929197685 2:39202933-39202955 TTCAGCCAGCACTAACAAGTTGG + Intronic
932256003 2:70287419-70287441 TTCAGCAATCACTAAAACTACGG + Intronic
932411544 2:71550686-71550708 CTCAGCCAGCACACAAAGTTGGG - Intronic
933624065 2:84578665-84578687 CTCAGCCATAAATAAAAGTGTGG + Intronic
933871231 2:86567476-86567498 GACAGCCATCACTAGAAGGTAGG - Intronic
937284640 2:120742119-120742141 TTCAGACGCCACCAAAAGTTTGG - Intronic
941130634 2:161645713-161645735 TTCAGCCAACACTAAATTTTTGG - Intronic
942985436 2:182135171-182135193 TTCAGCAATCTCTTGAAGTTTGG + Intergenic
945508399 2:210669783-210669805 TTAAGCCATAACTGGAAGTTGGG - Intronic
946607171 2:221418222-221418244 TCCAGAAATCACTCAAAGTTTGG + Exonic
947219227 2:227777275-227777297 TTCATCCATCTCCAAAAGCTAGG + Intergenic
948503734 2:238413475-238413497 TTCATCCATCAGTAAATGCTTGG + Intergenic
1169566268 20:6856728-6856750 ATCAGCCAACACTACAAATTAGG - Intergenic
1169891777 20:10461328-10461350 TGCAGGCATCACTATAAGATGGG - Intronic
1170277298 20:14605554-14605576 TTCAACCCACACTATAAGTTAGG + Intronic
1172979271 20:38928634-38928656 TTTTGCTATCACTAAAATTTGGG - Intronic
1177102248 21:16913120-16913142 TTCAGCCATCACTAGGTGCTTGG - Intergenic
1180482808 22:15770656-15770678 CTCAGCCAGCACTAAAAGTTGGG + Intergenic
1182875990 22:33691322-33691344 TTCACCCATTTCTAAAAGATGGG + Intronic
1183357711 22:37368454-37368476 TTCAGGCCTCACTAAAGGTCAGG - Exonic
949762961 3:7492522-7492544 TTCAGCGGTCATTAAAAGATAGG - Intronic
950980766 3:17302185-17302207 TTCAGCCATTACCAGAAGCTAGG - Intronic
951758195 3:26116030-26116052 TACAGCAATAACTACAAGTTTGG - Intergenic
952495052 3:33908535-33908557 TTCAGCCATGACCAAAAGAGTGG + Intergenic
956421228 3:69087848-69087870 TTCATACTTCAGTAAAAGTTTGG + Intronic
958432202 3:94054821-94054843 TTCAGCCACCTCTCAAATTTAGG - Intronic
958722328 3:97859453-97859475 TTCAGACATCACTAGAATGTAGG + Intronic
964260440 3:154829211-154829233 TTCAAACATCACTAAAAGGTGGG + Intergenic
964291927 3:155190950-155190972 ATCAGCCAACACTAGAAGTCAGG + Intergenic
969080399 4:4613334-4613356 TTCTGCCACCACTAACAGTGTGG - Intergenic
969273714 4:6120464-6120486 TTCAGCCATCAATAACTTTTGGG - Intronic
969383791 4:6828414-6828436 TTCAGACCTCACTAACAGCTAGG + Intronic
970294187 4:14610875-14610897 TTCAGCCATCCCCAACACTTTGG + Intergenic
970881707 4:20939885-20939907 TTCAGACATTGCTAAAAGCTTGG - Intronic
971419561 4:26463085-26463107 TTCACCCCTCCCTCAAAGTTTGG - Intergenic
972485862 4:39539894-39539916 TTCAGCCCTCTTTAAAAGCTTGG - Intergenic
976341588 4:83951824-83951846 ATCAGCTCTCACTAAATGTTAGG - Intergenic
976424707 4:84888808-84888830 ATCAGCAAACACTAAAAATTGGG + Intronic
977095520 4:92738386-92738408 TTCAGAAATCACAAAAATTTAGG + Intronic
977129749 4:93220938-93220960 TTCAGTCAACACTAACAATTTGG - Intronic
977292298 4:95177333-95177355 TTCAGCCATCATGAAGTGTTTGG + Intronic
978070975 4:104468956-104468978 TTAAGCAATCACTAAAAGAAAGG - Exonic
979103259 4:116650246-116650268 TTATGCCATCACAAATAGTTTGG - Intergenic
980594911 4:134941771-134941793 GTCAGCAAGCACTAAAAGTGGGG + Intergenic
981103426 4:140855212-140855234 TCCAGCCATCCCAAAAAATTGGG + Intergenic
981326394 4:143452959-143452981 TTCAGCAATCAGTAAAACATTGG + Intronic
981811719 4:148783001-148783023 TTCATCCTTCATTCAAAGTTTGG - Intergenic
982821631 4:159947312-159947334 TTCAGTCATCAATAGAAGATGGG - Intergenic
984489282 4:180412099-180412121 TTCAGCCATCACTTTAAACTTGG + Intergenic
985938171 5:3112476-3112498 TTCTGCCATGGCTAAAAGCTTGG - Intergenic
987074269 5:14366102-14366124 TTAAGCCCTCTCTCAAAGTTGGG + Intronic
994619325 5:102144793-102144815 TTTAGCTTTCACTAAAAATTGGG - Intergenic
994670772 5:102758977-102758999 TTCAGCCCACACTAAACGTTTGG + Intronic
995154135 5:108890465-108890487 GTCAGCCATCACCAGAAGCTAGG - Intronic
995602760 5:113816308-113816330 TGCAGCCATCACTAAAATCAAGG - Intergenic
995767082 5:115630219-115630241 TTCACCTATCACTGAAGGTTGGG - Intronic
995782740 5:115795369-115795391 TTCACCCCTCACTAAATGTTTGG + Intergenic
996489232 5:124072998-124073020 TTCTGGCATCATTAAAAGTTAGG - Intergenic
997489847 5:134264572-134264594 GACATCTATCACTAAAAGTTAGG - Intergenic
1000757016 5:165174167-165174189 TTCAGCTAGCAATAAAGGTTTGG + Intergenic
1001174956 5:169459607-169459629 GACAGCCAACACTAAAAGCTAGG - Intergenic
1001236425 5:170033456-170033478 AACAGCCATCACTACGAGTTTGG + Intronic
1001849513 5:174951528-174951550 TTCATCCTTCAGTAAAAGTCTGG + Intergenic
1003531052 6:6937684-6937706 TTCAGCCATTAAAAAAAGTCTGG - Intergenic
1006534315 6:34685737-34685759 TTCAGCCATCACTAAAAGTTGGG - Intronic
1008172594 6:48227365-48227387 TTCAGCTTTCTCTTAAAGTTTGG - Intergenic
1008266763 6:49437263-49437285 ATCAGCAAACACTAAAAATTAGG - Intronic
1008894716 6:56539719-56539741 TTCACCACTCACAAAAAGTTGGG + Intronic
1014693527 6:124591006-124591028 TGCAGCCATCACCAACAGGTGGG + Intronic
1016674744 6:146750773-146750795 TTCACCCCTCACCAATAGTTTGG - Intronic
1018145824 6:160887704-160887726 ATCAGCAAACATTAAAAGTTAGG - Intergenic
1018793524 6:167168813-167168835 CTCAGTCATCTCTACAAGTTGGG - Intronic
1018823191 6:167389565-167389587 CTCAGTCATCTCTACAAGTTGGG + Intergenic
1022166350 7:27766668-27766690 TTACGCCACCACAAAAAGTTAGG - Intronic
1023857104 7:44190709-44190731 TTCTGCCAACACGAGAAGTTTGG + Intronic
1024473981 7:49791490-49791512 TTCAGCCATCAGCAAATATTGGG - Intronic
1027683101 7:81245169-81245191 CTCAGCCATAACTAATAGTTAGG + Intergenic
1028554885 7:92112310-92112332 TTCAGCCATCTCATATAGTTAGG + Exonic
1028849780 7:95525139-95525161 TCCAGCCATCACCAGAAGGTAGG + Intronic
1034700068 7:153088046-153088068 TTCAGCCATCACCAAGAGGCAGG + Intergenic
1035342076 7:158169098-158169120 TGCAGCCATCACTGACAGTAAGG + Intronic
1036491211 8:9227311-9227333 TGCAGCCATCACTTGAAGGTAGG + Intergenic
1038751000 8:30295847-30295869 TTTCGCCAACATTAAAAGTTCGG - Intergenic
1041206317 8:55501721-55501743 TTCATCCATCAGTAAACATTTGG + Intronic
1041496953 8:58495835-58495857 ATCAGCCATCAATAGAAATTTGG + Intronic
1043795139 8:84527056-84527078 TTCAACATTCTCTAAAAGTTAGG - Intronic
1044099829 8:88120981-88121003 TTCAGTCAAAACTAAAATTTTGG + Intronic
1045213853 8:100127193-100127215 TACATCCATCAATAAATGTTTGG + Intronic
1045668748 8:104522589-104522611 TTCAGCTGTCATTAAAAGGTAGG + Intronic
1046289732 8:112141789-112141811 TTAAGCCATTACTACAATTTAGG - Intergenic
1048103448 8:131380786-131380808 TTGAGCCATCAGTAAATGGTAGG + Intergenic
1050667922 9:7962494-7962516 TTCAGACAACACTAAAGCTTTGG + Intergenic
1054838017 9:69700363-69700385 TTCATCCTACACTAAAAATTGGG + Intergenic
1055496687 9:76861873-76861895 TTCTTCCATCACAAAAAGTTAGG + Intronic
1055644719 9:78352249-78352271 TTCATCCATCAATAATATTTGGG + Intergenic
1058378446 9:104352443-104352465 TTTAGCTCTTACTAAAAGTTTGG + Intergenic
1059531798 9:115042291-115042313 CTCAGACATCACTGAAAATTCGG - Exonic
1187998261 X:24952786-24952808 ATCAGCCATCACTTAAAAGTTGG + Intronic
1188743556 X:33814586-33814608 TTCTGCCATGACTGTAAGTTTGG + Intergenic
1192012468 X:67289572-67289594 TTCTGCCAACCCTGAAAGTTTGG - Intergenic
1193383871 X:80848048-80848070 TTCAGCCATAATGAAAAGTGAGG - Intergenic
1196225829 X:113165513-113165535 CTTAGCCATCACTAGAAGCTTGG - Intergenic
1199805761 X:151298839-151298861 TTGAGCCACCACTAACAGCTTGG - Intergenic
1201351834 Y:13052486-13052508 TTCAGTAATCCCTAAAAGTTCGG - Intergenic
1201460651 Y:14219719-14219741 TACAGCTATCACAAATAGTTTGG - Intergenic
1201689992 Y:16752834-16752856 TTCTGCCATTACTAAGGGTTAGG - Intergenic
1202336704 Y:23819431-23819453 TTCAGCCATCTTTAAAAATTTGG - Intergenic
1202534061 Y:25850640-25850662 TTCAGCCATCTTTAAAAATTTGG + Intergenic