ID: 1006535593

View in Genome Browser
Species Human (GRCh38)
Location 6:34696591-34696613
Sequence GGTCCCCGCCATGGAGGGCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006535593_1006535607 29 Left 1006535593 6:34696591-34696613 CCATGCCCTCCATGGCGGGGACC 0: 1
1: 0
2: 2
3: 12
4: 147
Right 1006535607 6:34696643-34696665 CAAGCCGCCGCCGCGCCGCCGGG 0: 1
1: 0
2: 3
3: 29
4: 203
1006535593_1006535606 28 Left 1006535593 6:34696591-34696613 CCATGCCCTCCATGGCGGGGACC 0: 1
1: 0
2: 2
3: 12
4: 147
Right 1006535606 6:34696642-34696664 CCAAGCCGCCGCCGCGCCGCCGG 0: 1
1: 0
2: 1
3: 22
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006535593 Original CRISPR GGTCCCCGCCATGGAGGGCA TGG (reversed) Exonic
900205022 1:1427946-1427968 CGCCCCCGCCACGGAGGGCAGGG + Intergenic
900397044 1:2457322-2457344 GGTCCCAGCCATGGCTGGAAAGG - Intronic
902809885 1:18882061-18882083 AGTCCCTGCCAAGGAGGCCACGG + Intronic
902817091 1:18922648-18922670 GGGCCCGGACCTGGAGGGCAAGG + Intronic
906797382 1:48708832-48708854 GGTCCCAGACAGGGAGGCCAAGG - Intronic
912435313 1:109657151-109657173 GGTCCCCGGGAAGGAGGGCTGGG + Intronic
912439713 1:109688609-109688631 GGTCCCCGGGAAGGAGGGCTGGG + Intronic
912443025 1:109713058-109713080 GGTCCCCGGGAAGGAGGGCTGGG + Intronic
924645262 1:245871828-245871850 GGTCCCCGCCCTGTAGGGTGGGG - Intronic
1062993335 10:1841349-1841371 GGTTCACGCCAGGGAGTGCATGG - Intergenic
1068657906 10:59593463-59593485 GGTACCAGCCATGGTTGGCAGGG - Intergenic
1069632066 10:69903065-69903087 GGTCTCCTCCCTGGAAGGCAGGG - Intronic
1072152817 10:92696717-92696739 GGCCTCCTCCATGGAGGCCAAGG - Intergenic
1074657102 10:115603186-115603208 GTTCCCCTCCCTGGAGGACAGGG + Intronic
1077134376 11:991274-991296 GTCCCCCTCCATGGATGGCAAGG - Intronic
1077135391 11:995599-995621 GGTCCCCGCCAAGGAGTGCCAGG - Intronic
1077217273 11:1400239-1400261 GCTCCCAGCCATGGAGGGGGCGG - Intronic
1080834483 11:35927765-35927787 GGCCCCTGCCAAGGAGGGCCGGG - Intergenic
1083264724 11:61541426-61541448 GGGCCCCTCCAGGGAGAGCAGGG + Intronic
1083799134 11:65036156-65036178 GGCCCCCCCAATGGAGGTCAGGG + Intronic
1084427992 11:69096040-69096062 TGTCTCCGCCAGGAAGGGCAGGG - Intergenic
1084998902 11:73011220-73011242 GGTGCCAGCCATGGTAGGCAGGG + Intronic
1085383409 11:76140911-76140933 GGTCTCTCCCATGGAGGGGACGG - Exonic
1090559905 11:127920664-127920686 GGACCCTGACATGGAGGTCAAGG - Intergenic
1090994910 11:131857324-131857346 GGACACAGCCATGGAAGGCAAGG - Intronic
1095349390 12:41190049-41190071 GGTCGCTGCCATGGTGAGCAGGG + Intronic
1102678082 12:114672075-114672097 GGCCGCCGCCATGGAGGGCAGGG + Exonic
1105964608 13:25372636-25372658 AGTCACCGCGATGGTGGGCACGG + Intronic
1107691183 13:42955254-42955276 AGTCCCCACCCTGGAGGGCAGGG - Intronic
1113376619 13:109770116-109770138 GGCCACCACCATGGAGGGCAGGG + Intronic
1113769976 13:112901573-112901595 GGTCACCGCCTGGGAGGGGAAGG + Intronic
1113955824 13:114099533-114099555 GGTCCCAGGCAGGGAGGGAAAGG - Intronic
1114004997 14:18302675-18302697 ATTCTCTGCCATGGAGGGCATGG + Intergenic
1114627288 14:24137850-24137872 GGTCCCTGCCATTTAGGGCCTGG + Intronic
1115475882 14:33812307-33812329 GTTCCCCACCAGGGAGGGGATGG - Intergenic
1118319996 14:64747472-64747494 GGTTCCCGCCCTGGTGAGCAAGG - Exonic
1122278451 14:100607601-100607623 GGTACCCTCCAGGGTGGGCAGGG - Intergenic
1124882027 15:33651689-33651711 GGTCCTCAGCATGGAGGGCAAGG - Intronic
1129676030 15:77632779-77632801 GGTCCCGGCCCCGGAGGGCGCGG - Intronic
1129892745 15:79082361-79082383 GGTCCCCTCCACTGAGGGGAAGG - Intronic
1132238274 15:100238078-100238100 GGTCCCCACCATGGACAGCAGGG - Intronic
1133213104 16:4273779-4273801 GGGCCCCGGCAGGGAGGGGAGGG + Intergenic
1135106197 16:19652001-19652023 GATGCCCGCCAGGGAGGGGATGG - Exonic
1135773903 16:25239174-25239196 TCTCACCTCCATGGAGGGCAAGG + Exonic
1136627717 16:31472179-31472201 GCGCCCCGCCATGGAGGACCTGG + Exonic
1137747923 16:50836806-50836828 GGTCCCATCCATGAAGGCCATGG + Intergenic
1141948503 16:87325743-87325765 GGTGCCCTCCAGGGAGAGCAGGG - Intronic
1142139774 16:88467720-88467742 GGTCCCAGCCACAAAGGGCACGG - Intronic
1142157054 16:88537424-88537446 TGTCCCCACCATGCAGGGCTGGG + Intergenic
1142561669 17:813387-813409 GGCCCCCGGCTTGGAGGACAAGG + Intronic
1142742577 17:1939831-1939853 GGCCCCCACCCTGGAGGGCCAGG + Intronic
1146651272 17:34608031-34608053 TGTCCCCTCCTTGGAGGTCAGGG + Intronic
1147383158 17:40067461-40067483 GTACCACTCCATGGAGGGCAGGG - Intronic
1149660648 17:58332523-58332545 GGTTCCCTTCAGGGAGGGCAGGG + Intergenic
1153431987 18:5027856-5027878 GGTCCCCTCCAGGGAGGACACGG + Intergenic
1154063285 18:11083540-11083562 GGTGCCAGCCCTGCAGGGCACGG + Intronic
1154242895 18:12668480-12668502 GGTCCCAGCTATGGAGGCTAAGG + Intronic
1154954589 18:21242110-21242132 GGTCCCCGCTGCGGAGGCCAGGG + Intergenic
1157498133 18:48170924-48170946 GGTCCCTGCCCTGTGGGGCAGGG - Intronic
1157533771 18:48443501-48443523 GCTCCCCTCCAGGGAGGCCAGGG + Intergenic
1158352704 18:56578971-56578993 TGTCCCACCCAAGGAGGGCAAGG + Intergenic
1160184059 18:76660904-76660926 GGGCCCCGCCCTGGAGGGGCTGG + Intergenic
1160765801 19:807119-807141 GGCCCCCGCGAGGGAGGGCCAGG - Intronic
1160818947 19:1049228-1049250 GGACTCAGCCATGGAGGTCATGG - Intronic
1161393842 19:4034528-4034550 GGTCCCCTCTGTGGAGGGCTGGG + Intronic
1161425633 19:4201273-4201295 GGTCACAGGCATGGTGGGCAGGG + Intronic
1161580844 19:5080005-5080027 GGCCCCCGCCGTGCAGGACATGG - Intronic
1161741042 19:6021456-6021478 GGTCGCCGCCACGGAGGGACTGG + Intronic
1161783638 19:6309969-6309991 GGTCCTAGCCAGGCAGGGCACGG + Intronic
1162123378 19:8485982-8486004 GGGCCCTGCCATCGAGCGCATGG + Exonic
1162909272 19:13840649-13840671 GGGCGCCGCCATGCTGGGCACGG - Intergenic
1164715365 19:30386900-30386922 GGTCGCCGGCATGGACAGCAGGG + Intronic
1165094955 19:33405220-33405242 GGTCCCTGCCATGGGGCCCAGGG - Intronic
1166694832 19:44846515-44846537 GGCCCGGGCCATGGAGGGCCCGG - Exonic
1166872239 19:45877692-45877714 GGTGCCTGCCAGGGAGGGCTTGG - Intergenic
930177533 2:48315328-48315350 GGGCCCCGCCAAGTAGTGCACGG + Intronic
934566089 2:95342180-95342202 GGGCCCGGCCATGGGGGGCAAGG + Intronic
935763771 2:106344556-106344578 GCTCCCTGCCATGGAGGGCATGG + Intergenic
937907201 2:127058145-127058167 GGTCCCCCACCTGGTGGGCAGGG - Intronic
938099429 2:128488189-128488211 TGTCCACGCCATGTGGGGCATGG + Intergenic
938540360 2:132280062-132280084 GGTCCCCGCCACAGGGGCCACGG - Intergenic
946327216 2:218990890-218990912 GGCCCAGCCCATGGAGGGCAGGG + Exonic
946396999 2:219448240-219448262 GGTGCCCGCCAGGGAGGGCCCGG - Exonic
947919156 2:233854467-233854489 GCTGCGCGCCATGGAGGGCGAGG - Exonic
948830517 2:240596356-240596378 GGTGCCAGCCACGGGGGGCATGG - Exonic
1169831453 20:9830040-9830062 GGTCCCAGCTATGCAGAGCAAGG + Intronic
1170623637 20:18014138-18014160 GGTCCCAGCCATGGTGGGGCAGG + Intronic
1171382736 20:24745802-24745824 GGTCCCTGCCCTGGAGGTCCTGG - Intergenic
1178500828 21:33124313-33124335 GGTTTCCCCCATGTAGGGCAGGG - Intergenic
1179527943 21:41996044-41996066 TGTCCCCTCCATGAGGGGCAGGG + Intronic
1179888197 21:44323491-44323513 GATCCACTCCATGGAGGGCAAGG - Intronic
1180008448 21:45034115-45034137 TGTCCCCGCCATGCCGGCCAAGG - Intergenic
1181028863 22:20140556-20140578 GGTCCAGGCCAGGGTGGGCAGGG - Intronic
1183393549 22:37559687-37559709 GCCCACCTCCATGGAGGGCAGGG - Intergenic
1184729238 22:46363965-46363987 GATCCCCGCCCTGGAGGCCCAGG + Intronic
1185184918 22:49393269-49393291 GGTCCCCGCTGTGGCGTGCATGG - Intergenic
950358604 3:12433822-12433844 GGGCCCCGCCTTGGAGGCCTAGG - Intronic
950729856 3:14947830-14947852 GGCCCCCGGCGCGGAGGGCAGGG - Intronic
950741679 3:15057169-15057191 GGCCCCGGCCAGGGAGAGCACGG - Intronic
954790550 3:53130209-53130231 GGACCCCGCAATGGAGGGGGTGG - Intronic
963006612 3:140732211-140732233 GGTCACTGCCATGGATGGCTGGG - Intergenic
967840931 3:194003869-194003891 GGTTCCCGCCGTGGTGGCCACGG + Intergenic
967843974 3:194030084-194030106 GGTCCCAGCTGTGGAGGGGAAGG - Intergenic
968612055 4:1561759-1561781 GGTCCCCACCATCCAGGACAGGG + Intergenic
968805424 4:2768787-2768809 GGTCCCCAGGATAGAGGGCAGGG + Intergenic
968894110 4:3388719-3388741 TGTCACTGCCGTGGAGGGCAGGG - Intronic
969426755 4:7128819-7128841 GCTGCCCGCCAGGGAGAGCATGG - Intergenic
986591939 5:9379935-9379957 GGTTCCCTTCATGGTGGGCAAGG + Exonic
986654585 5:9998831-9998853 GGTCAACGCCATGCAGAGCATGG - Intergenic
993384863 5:87251875-87251897 GGTGCCAGCCATGGATGCCAGGG - Intergenic
997629584 5:135356670-135356692 GGCCCCCACCATTTAGGGCAGGG + Intronic
998476649 5:142427777-142427799 GGAACCCGCTATGGAGGGAATGG + Intergenic
999203503 5:149832796-149832818 GCTCCCTGCCAAGGAGGACAAGG + Exonic
999392777 5:151206267-151206289 GGTAGCCCCCAAGGAGGGCATGG - Intronic
1001056982 5:168457776-168457798 GGTTCCTGCCATGGCTGGCATGG + Intronic
1003180084 6:3783672-3783694 GGTGCCACCCTTGGAGGGCAAGG + Intergenic
1003497872 6:6679788-6679810 GCTCCCTGCCAGGGTGGGCAGGG + Intergenic
1003892654 6:10577249-10577271 GGTGACAGCCATGTAGGGCAGGG + Intronic
1006535593 6:34696591-34696613 GGTCCCCGCCATGGAGGGCATGG - Exonic
1007757292 6:44108202-44108224 GGTCCCCATAATTGAGGGCAAGG - Intergenic
1017816297 6:158018937-158018959 GGTCATCACCATGGAAGGCAAGG - Intronic
1017941996 6:159061278-159061300 TGACCCAGCCATGGAGGGGAGGG - Intergenic
1018740953 6:166728297-166728319 GGTCTCTGCCATGAGGGGCAGGG - Intronic
1019047856 6:169162023-169162045 GGTCCCCAGTGTGGAGGGCAGGG - Intergenic
1019320273 7:411965-411987 GGTCCCCGTCCTGGACGGCTGGG - Intergenic
1019448720 7:1084890-1084912 GCTGCCTACCATGGAGGGCATGG + Intronic
1019606051 7:1910786-1910808 GGGCCCCGCCCTGGGGAGCATGG + Intronic
1020092266 7:5348387-5348409 GCTCCCCGCCCTGGAGAGAAAGG - Intronic
1021125992 7:16851420-16851442 CTACCCCGCCATGCAGGGCACGG - Intergenic
1024230726 7:47361299-47361321 AGGCCCCACCATGGAGGGCCAGG - Intronic
1024298278 7:47863601-47863623 GGTCCCCGGCAGGGAGAGAATGG + Intronic
1024301716 7:47892091-47892113 GGTCACTGCTCTGGAGGGCAGGG - Intronic
1028089721 7:86683673-86683695 GGTCCCCACCATGTCTGGCATGG - Intronic
1030059914 7:105614065-105614087 GGTCCCCTGCGTGGAGCGCAAGG + Exonic
1031535929 7:122932614-122932636 GGCCCTGGCCATGGTGGGCAGGG - Intergenic
1032210651 7:129911032-129911054 GGTGGTCGCAATGGAGGGCAGGG + Intronic
1035028578 7:155843163-155843185 GGTCCCCGCCCTTGAGAACAGGG - Intergenic
1035736567 8:1891632-1891654 GGTCCCTGGCATGAAGGTCATGG - Intronic
1035760367 8:2064378-2064400 GGTCACCCCCACGGTGGGCACGG - Intronic
1036454089 8:8893046-8893068 GGGCCCCGCCATGGCTGGGATGG - Exonic
1038981454 8:32763864-32763886 GCTGACCGCCATGGAAGGCATGG - Exonic
1039601233 8:38839607-38839629 GGGCACCACCATTGAGGGCAGGG + Intronic
1042877495 8:73452397-73452419 GGTCTCAGCCAAGGAGGACAGGG - Intronic
1047473484 8:125202200-125202222 GGTGCAGCCCATGGAGGGCAAGG - Intronic
1049346376 8:142141296-142141318 GGTCCCATCCATGGGGGCCAGGG - Intergenic
1051513698 9:17906817-17906839 GGTCCCCGCCATGGGGACCATGG + Intergenic
1052195787 9:25713434-25713456 GGTCCAAGCCCTGGAGGTCATGG + Intergenic
1059721006 9:116960076-116960098 CGTCACAGCCAGGGAGGGCAGGG + Intronic
1061061103 9:128250847-128250869 AGCCCCCGGCCTGGAGGGCACGG - Exonic
1061896561 9:133651564-133651586 GGTCCTGGCCATGGACGGGAGGG + Intronic
1062680524 9:137776803-137776825 GGGCTCGGCCCTGGAGGGCAGGG + Exonic
1203779533 EBV:93417-93439 CGTGGCCGTCATGGAGGGCATGG - Intergenic
1186611151 X:11139357-11139379 AGCCCCCGCGACGGAGGGCAGGG - Exonic
1187056959 X:15749779-15749801 GGTCCCCTCAGTGGAGGGCAGGG - Intronic
1187467804 X:19542152-19542174 GGTCCCCGGCTTGGGCGGCAGGG + Exonic
1188495724 X:30781156-30781178 GGTCCTCCCCCTCGAGGGCAGGG + Intergenic
1190102715 X:47534608-47534630 GGTCCCAGCTTTGGAGGTCAAGG + Intergenic
1192185436 X:68943863-68943885 GGTCTCTGCCATTCAGGGCATGG - Intergenic
1192361824 X:70445374-70445396 GGCCCCCGCCTGCGAGGGCAAGG - Exonic
1192451169 X:71245955-71245977 GGACCCAGCCAGGAAGGGCAGGG + Intronic
1197796600 X:130305188-130305210 GGCATCAGCCATGGAGGGCAGGG + Intergenic
1198583708 X:138096272-138096294 GGTACCAGCCATGGTGGGAAGGG - Intergenic