ID: 1006547248

View in Genome Browser
Species Human (GRCh38)
Location 6:34790485-34790507
Sequence CAGTCCTACTGGAGGGGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006547237_1006547248 27 Left 1006547237 6:34790435-34790457 CCTGTTATATATTCTGGTGAGAG No data
Right 1006547248 6:34790485-34790507 CAGTCCTACTGGAGGGGAGTGGG No data
1006547236_1006547248 28 Left 1006547236 6:34790434-34790456 CCCTGTTATATATTCTGGTGAGA No data
Right 1006547248 6:34790485-34790507 CAGTCCTACTGGAGGGGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006547248 Original CRISPR CAGTCCTACTGGAGGGGAGT GGG Intergenic
No off target data available for this crispr