ID: 1006547387 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:34791463-34791485 |
| Sequence | AGCACTCCCTCCCAAATGTG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1006547387_1006547392 | 25 | Left | 1006547387 | 6:34791463-34791485 | CCCCACATTTGGGAGGGAGTGCT | No data | ||
| Right | 1006547392 | 6:34791511-34791533 | AGTAAATACATTTTGCCCATCGG | No data | ||||
| 1006547387_1006547390 | -3 | Left | 1006547387 | 6:34791463-34791485 | CCCCACATTTGGGAGGGAGTGCT | No data | ||
| Right | 1006547390 | 6:34791483-34791505 | GCTTCTGCAGTGAGCCGCTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1006547387 | Original CRISPR | AGCACTCCCTCCCAAATGTG GGG (reversed) | Intergenic | ||