ID: 1006547387

View in Genome Browser
Species Human (GRCh38)
Location 6:34791463-34791485
Sequence AGCACTCCCTCCCAAATGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006547387_1006547392 25 Left 1006547387 6:34791463-34791485 CCCCACATTTGGGAGGGAGTGCT No data
Right 1006547392 6:34791511-34791533 AGTAAATACATTTTGCCCATCGG No data
1006547387_1006547390 -3 Left 1006547387 6:34791463-34791485 CCCCACATTTGGGAGGGAGTGCT No data
Right 1006547390 6:34791483-34791505 GCTTCTGCAGTGAGCCGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006547387 Original CRISPR AGCACTCCCTCCCAAATGTG GGG (reversed) Intergenic