ID: 1006555168

View in Genome Browser
Species Human (GRCh38)
Location 6:34859601-34859623
Sequence CAGAACTAGGAGAAGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 463}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006555168_1006555174 -7 Left 1006555168 6:34859601-34859623 CCCATCTCCTTCTCCTAGTTCTG 0: 1
1: 0
2: 4
3: 43
4: 463
Right 1006555174 6:34859617-34859639 AGTTCTGATCATTGGGTTTAAGG 0: 1
1: 0
2: 0
3: 12
4: 143
1006555168_1006555177 22 Left 1006555168 6:34859601-34859623 CCCATCTCCTTCTCCTAGTTCTG 0: 1
1: 0
2: 4
3: 43
4: 463
Right 1006555177 6:34859646-34859668 ACTATGTGCATTTCTAGATTGGG 0: 1
1: 0
2: 1
3: 16
4: 249
1006555168_1006555176 21 Left 1006555168 6:34859601-34859623 CCCATCTCCTTCTCCTAGTTCTG 0: 1
1: 0
2: 4
3: 43
4: 463
Right 1006555176 6:34859645-34859667 TACTATGTGCATTTCTAGATTGG 0: 1
1: 0
2: 1
3: 12
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006555168 Original CRISPR CAGAACTAGGAGAAGGAGAT GGG (reversed) Intronic
900123379 1:1059026-1059048 CAGAACCAGGAGAGGCAGTTTGG + Intergenic
901228368 1:7628169-7628191 CAGCACATGGAGAAGGAGAAGGG - Intronic
901689276 1:10962011-10962033 CAGAACTGAGAGGAGGAGGTTGG - Intronic
901885635 1:12220988-12221010 CAGAACAAGGAGCATGTGATTGG - Intergenic
903121926 1:21221814-21221836 CAGAACTGGGTGAAGAAGAACGG - Exonic
903915510 1:26761218-26761240 TAGCATTTGGAGAAGGAGATTGG + Intronic
904355660 1:29937445-29937467 AAGAGCTAGGAGAAGGAGACTGG + Intergenic
904715046 1:32461390-32461412 CAGCACTAGGAGAACGAGGCAGG - Intergenic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
905099658 1:35508238-35508260 CAGGACTAGGGTAAGGAGAGAGG - Intronic
905535430 1:38717876-38717898 AAGAACAAGGTGAAGGAAATGGG - Intergenic
905596316 1:39210788-39210810 CAGAACTAGGATAAAAACATAGG - Intronic
905950710 1:41948280-41948302 TAGAATTAGGAGAAGGAAAAAGG + Intronic
906180847 1:43817597-43817619 GAGAAGGAGGAGAAGGAGAAGGG - Intronic
906583737 1:46957656-46957678 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
906626531 1:47330399-47330421 CATAACTGGCAGAAGGAGACAGG + Intergenic
906704391 1:47884306-47884328 CAGAACTTGGAGAGGGAAAAAGG - Intronic
906708060 1:47909447-47909469 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
906708071 1:47909495-47909517 GAGAAGGAGGAGAAGGAGAAGGG + Intronic
907037487 1:51229240-51229262 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
907287385 1:53390536-53390558 CAGAAGGAGGAGAAGGGGAGTGG + Intergenic
907845662 1:58204212-58204234 CAGCTCTTGGAGAATGAGATTGG + Intronic
908623678 1:66015289-66015311 CAGAAGTAGGAGGAGCAGCTAGG - Intronic
908828577 1:68157054-68157076 CAGAATTGGGAGAAGGACATGGG + Intronic
910080062 1:83330987-83331009 AAGAACTTGGAGGAGGAGAATGG - Intergenic
910804815 1:91179889-91179911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
911371235 1:96997155-96997177 CAAAAGTAGCAGAAGGAGAAAGG - Intergenic
911513053 1:98831622-98831644 TAGGGGTAGGAGAAGGAGATTGG - Intergenic
911553427 1:99312734-99312756 CAGAAGTAGGAGTAGGAGGGAGG + Intergenic
912153921 1:106892440-106892462 CAGAGGTAGGAGTAGGAGCTGGG - Intergenic
912687253 1:111777293-111777315 AAGAAGTAGGAAAAGGAGGTAGG + Intronic
912716414 1:111987131-111987153 CAGGACTAGGAGAATGAAAGGGG - Intronic
914739056 1:150447965-150447987 CAAAACTGGGAGAAGGAGAAAGG - Intronic
914784065 1:150812318-150812340 GAGAACTAGGAAAAGGAAAAAGG - Intronic
916055573 1:161067076-161067098 AAGAACTGGGTCAAGGAGATGGG + Intronic
916797509 1:168180322-168180344 CAGGAGGAGGAGAAGCAGATGGG + Intronic
916987324 1:170205861-170205883 AAGAAGGAGGAGAAGGAGGTAGG - Intergenic
917372567 1:174311358-174311380 CAGACCTAGTAGAAGGTGACTGG - Intronic
917792984 1:178511752-178511774 CAAAATTAGCAGAAGGAGGTGGG + Intergenic
918188459 1:182148444-182148466 CAGTAATAGGAGAAGGAAGTAGG - Intergenic
918736553 1:188071433-188071455 CAATACTAGGGGAATGAGATTGG + Intergenic
919571460 1:199254204-199254226 CACAAGTAGGAGAATGAAATTGG - Intergenic
921034219 1:211360974-211360996 AAGGACCAGGAGAAGGAGAGAGG - Intronic
921046020 1:211478716-211478738 CAGAACCAGGAGATGAGGATGGG + Exonic
921112663 1:212054290-212054312 AAGAACAAGGAAAAGGAGACTGG - Intronic
921714447 1:218403353-218403375 CATATATAGGGGAAGGAGATGGG + Intronic
922178327 1:223214555-223214577 CTGAGCTGGGAGAAGGAGCTGGG + Intergenic
922272893 1:224050834-224050856 CAGAACAAGGAGGACCAGATGGG + Intergenic
922800787 1:228363941-228363963 CCAAACAAGGAGAAGGAGAAGGG - Intronic
924247927 1:242103080-242103102 GAGAATTTGGAAAAGGAGATTGG + Intronic
924274725 1:242374270-242374292 CAGAACCAGGAAAAGGAAAACGG + Intronic
1063053252 10:2475987-2476009 CAGAACAATGAGAAGGGCATGGG - Intergenic
1063232685 10:4081188-4081210 CAGAACTAGGAGGCTGAGATGGG + Intergenic
1063506979 10:6608473-6608495 CATACCTAGGAGAGGGAGACGGG + Intergenic
1063729639 10:8681617-8681639 GAGAAGGAGGAGAAGGAGAAGGG - Intergenic
1064759214 10:18601553-18601575 CAGAACTAGGAGCAGGAAACAGG + Intronic
1065954851 10:30684405-30684427 CAGGCCTAGGATGAGGAGATGGG - Intergenic
1068584050 10:58776681-58776703 CATAAGTATGAGAGGGAGATGGG - Intronic
1069238205 10:66104792-66104814 CAGAGCTAGTCTAAGGAGATGGG - Intronic
1069677586 10:70259701-70259723 GAGAACAAGGAGGAGGGGATGGG + Intronic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070680551 10:78446080-78446102 GAGAAGGAGGAGAAGGAGAAGGG + Intergenic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1070882376 10:79861358-79861380 CAGAGGTAGGAGGAGGAGCTGGG - Intergenic
1071102650 10:82057305-82057327 CAGAAATTGGAGTAGGAGTTAGG - Intronic
1071326908 10:84527030-84527052 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1071327047 10:84528001-84528023 CAGAATTAGAACATGGAGATTGG - Intergenic
1071379767 10:85046654-85046676 CAGATATGGGAGAAGGAGAAAGG + Intergenic
1071648946 10:87377669-87377691 CAGAGGTAGGAGGAGGAGCTGGG - Intergenic
1072682728 10:97518213-97518235 CAGAGCTGGGGGAAGCAGATGGG + Intronic
1074346102 10:112687863-112687885 CAGATCTGTGAGAAGGAAATGGG + Intronic
1074569968 10:114615364-114615386 CAGAAGGAGGAGAGGGAGCTGGG - Intronic
1077078577 11:712533-712555 CAGGACTAGGAAAAGGAGGGAGG + Intronic
1077847300 11:6039524-6039546 CAGAACCAGGAGAAGGAAGGAGG - Intergenic
1077895827 11:6452528-6452550 CAGGACTAAGAGATGGAGTTGGG - Intronic
1078366770 11:10713242-10713264 CAGAAGTTGAAGAGGGAGATAGG + Intergenic
1078412758 11:11141111-11141133 CAGAACTTGGGTGAGGAGATGGG + Intergenic
1078612938 11:12837707-12837729 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078785826 11:14491372-14491394 TAGAACTGGGAGAAGGAGCCGGG + Intronic
1079155136 11:17939195-17939217 CAGAACAAGGAGAACAAGAGGGG + Intronic
1079254849 11:18819128-18819150 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1079387322 11:19992090-19992112 CACAACTAGGAGAAGAGGAAAGG - Intronic
1079541648 11:21583298-21583320 CAGAACTAGGATAAAGAAAAAGG + Intergenic
1079887259 11:26003793-26003815 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1080290546 11:30666053-30666075 TAGAACAAGAAGAAGGAGAAGGG + Intergenic
1080600359 11:33816463-33816485 CAGAACTAAGAGGAGGGAATTGG + Intergenic
1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG + Intergenic
1081354809 11:42099565-42099587 GAGAGCAAGGAGAAGGAGAGTGG + Intergenic
1081594501 11:44449977-44449999 CAGAAGTTGGAGAAGGAAAAAGG + Intergenic
1082887465 11:58102338-58102360 CAGAAAGAGCAGAAGGAGAAAGG - Intronic
1082897853 11:58212189-58212211 CATATCTAGTGGAAGGAGATAGG - Intergenic
1083276581 11:61600345-61600367 CAGAACCTGGAGAATGAGAAGGG - Intergenic
1084370200 11:68736744-68736766 CAGAAGGAGGAAAAGGAGAGAGG + Intronic
1084439625 11:69165208-69165230 CTCCACTGGGAGAAGGAGATTGG + Intergenic
1085601444 11:77859523-77859545 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1085843446 11:80039865-80039887 CAAAATTTGGAGAAGGAGAAAGG + Intergenic
1086377854 11:86219376-86219398 AAGAAATAGAAGAAAGAGATGGG + Intergenic
1086441659 11:86834798-86834820 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1086775143 11:90821365-90821387 CTGAAAAAGGAGAAAGAGATGGG + Intergenic
1087673532 11:101132621-101132643 TAGTACTAGGGGAAGGGGATGGG - Intergenic
1088379073 11:109173336-109173358 CAGAATTAGGGGAAGAAGGTTGG + Intergenic
1088915401 11:114223971-114223993 CTGAACTTGGAGAAGTAAATGGG + Intronic
1088925013 11:114293215-114293237 CAGACCTAGGAGATGTAGAATGG - Intronic
1089522124 11:119071932-119071954 CCGGAGTAGGAGTAGGAGATTGG - Intronic
1089596043 11:119580963-119580985 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1090461278 11:126893692-126893714 CAGACGTGGGAGAGGGAGATTGG - Intronic
1091829495 12:3539675-3539697 CGGAGCAGGGAGAAGGAGATGGG - Intronic
1092952609 12:13521295-13521317 CAGGGCTGGGAGTAGGAGATGGG + Intergenic
1093348671 12:18070447-18070469 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1093987570 12:25553680-25553702 CATAACTAGGAGAAGAATTTAGG - Intronic
1094806779 12:34101709-34101731 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1096351752 12:50906452-50906474 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1097442524 12:59628426-59628448 AAGAACTTAGAGAAGAAGATTGG - Intronic
1097594866 12:61616658-61616680 CAGGCAAAGGAGAAGGAGATTGG - Intergenic
1097609448 12:61800716-61800738 GATAGCTTGGAGAAGGAGATAGG + Intronic
1097970706 12:65630104-65630126 CAGCAGTAGGAGGAGGACATGGG + Intergenic
1098227368 12:68338629-68338651 CTGCAGTAGGAGAAGGAGGTTGG - Intergenic
1100779395 12:98008003-98008025 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1101323120 12:103691042-103691064 CAGATCTAGGTGCTGGAGATAGG + Intronic
1102166750 12:110813006-110813028 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1102889064 12:116544083-116544105 AAGGACTGGGAAAAGGAGATTGG - Intergenic
1103371578 12:120423335-120423357 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1103795207 12:123498623-123498645 CAGACCAAGGAGCAGGAGATGGG - Exonic
1104316236 12:127704425-127704447 GAGGAAGAGGAGAAGGAGATTGG + Intergenic
1104851169 12:131874865-131874887 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1105572846 13:21620348-21620370 AAGAGAAAGGAGAAGGAGATTGG - Intergenic
1106771517 13:32965290-32965312 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1106803476 13:33281248-33281270 CTGAAGTAGGATAAGGAGACAGG - Intronic
1106883346 13:34156192-34156214 CAGAGCTAGAAGAAAGAGACCGG - Intergenic
1107167427 13:37298984-37299006 CAGAAGCAAGAGAAAGAGATGGG + Intergenic
1107242107 13:38248690-38248712 CAGAAGAAGGAGGAGGAGAAAGG - Intergenic
1107407749 13:40130373-40130395 GAGAAGTAGGAGAAAGAAATGGG + Intergenic
1107749409 13:43548441-43548463 CAGAATTAAGAGATGGAGAAAGG - Intronic
1108882434 13:55137105-55137127 CAGGAGTAGGAGAAAGAGACCGG - Intergenic
1109040780 13:57333589-57333611 CTGAAACAGGAGAAGGGGATAGG + Intergenic
1109606631 13:64705813-64705835 CAGAATTAAGAGAAGGAAAAGGG - Intergenic
1110125638 13:71939567-71939589 CTGATCTAGGAGGAGGGGATGGG + Intergenic
1110262580 13:73502039-73502061 CAGAGCTAGGAGCAGGATTTAGG + Intergenic
1110797430 13:79656547-79656569 CAGAAGTAGAGGAAGGATATTGG - Intergenic
1110838351 13:80110845-80110867 CAGAGCTAGATGAAGGAGCTAGG + Intergenic
1111512115 13:89279722-89279744 CAGAAATACAAGAAGGAGATTGG + Intergenic
1111774282 13:92640006-92640028 CAGAATTAGGAGAGGGAGAAGGG - Intronic
1113069162 13:106402838-106402860 GAGAATGAGGAGGAGGAGATAGG - Intergenic
1113672434 13:112184150-112184172 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1113763961 13:112869361-112869383 CAGAACTGGGATAAGGAGTTAGG - Intronic
1115269621 14:31537403-31537425 CAAAATTAGTAGAGGGAGATGGG + Intronic
1115529365 14:34312808-34312830 AAGAAGAAGGAGAAGGAGAAGGG - Intronic
1116447128 14:45023008-45023030 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1117097885 14:52315660-52315682 CAGGGCTAGGATGAGGAGATTGG - Intronic
1118411129 14:65479565-65479587 TGGAAGTAGGAGAAGGAGAAAGG - Intronic
1118626080 14:67660578-67660600 CAGAAAGAGGAGCAGGAGAAGGG - Intronic
1119346715 14:73931112-73931134 CTCAAGTAGGAGAAGGAAATAGG - Intronic
1119722415 14:76900157-76900179 CAAAAGTAGAAGAAGGAGATGGG + Intergenic
1119848288 14:77847039-77847061 CAGGACTAGGAGGAGGTGAAGGG + Intronic
1119856660 14:77906165-77906187 CAGAATTAGGAACAGGAAATAGG + Intronic
1120230117 14:81832907-81832929 GAGAAGGAGGAGAAGGAGAGTGG - Intergenic
1120281459 14:82443675-82443697 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1120393423 14:83937553-83937575 AAGAACTCGGAGAAGGAGGATGG - Intergenic
1121704719 14:95982917-95982939 CCGAAGAAGGAGAAGGAGCTAGG - Intergenic
1121709451 14:96026780-96026802 CAGCAGAAGGAGAAGGAGATGGG + Intergenic
1122623044 14:103070603-103070625 CAGAACAAAGAGGAGGAGAGAGG - Intergenic
1123681759 15:22768889-22768911 CAGAAGCAGGAGGAGCAGATGGG - Intergenic
1124710787 15:32008347-32008369 AAGAAATAGGAGGAGGAGAAGGG - Intergenic
1126357182 15:47809283-47809305 GAAAAGTAGGAGAAAGAGATTGG + Intergenic
1127073963 15:55308388-55308410 TAGAATTAGGAGAAGGAAAAAGG - Intronic
1127074332 15:55311017-55311039 CAGAATCAGGATATGGAGATTGG - Intronic
1127547173 15:60002421-60002443 AATAACTGGGAGGAGGAGATGGG - Intergenic
1128110368 15:65072214-65072236 CAGGAAGAGGAGGAGGAGATGGG - Intronic
1128220947 15:65968170-65968192 CAGAAGGAGGAGAAGTAGAATGG + Intronic
1128332185 15:66763145-66763167 CAGAACTAGGAGATGGAAGGTGG + Intronic
1128566642 15:68705112-68705134 CATTACTGGGAGAAGGAGACGGG - Intronic
1129269770 15:74413489-74413511 CGGAACTGGGAGCAGGAGCTAGG - Intronic
1129504400 15:76069309-76069331 CAGAAAAAGCAGGAGGAGATAGG + Intronic
1130611449 15:85364884-85364906 CACAACCAGGAGAAGGCAATGGG + Intergenic
1130751433 15:86717207-86717229 GAGAACAAGGAGAAGGAGTGGGG + Intronic
1131018021 15:89073966-89073988 CAGTGCTAGGAGAAAGAGAAAGG + Intergenic
1131021731 15:89104749-89104771 CAGAAGGAGGAAATGGAGATGGG - Intronic
1131226038 15:90624936-90624958 CAGAACTAGGGGGAAGAGAAGGG + Intronic
1131302269 15:91210113-91210135 GATAATTAGGAGATGGAGATAGG + Intronic
1131955903 15:97736104-97736126 AAGAACTATTAGAAAGAGATTGG + Intergenic
1132425294 15:101710805-101710827 CAGAAACAAGAGAAGGAGAGGGG + Intronic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133191970 16:4140488-4140510 CAGAAGCAGGAGAAAGAGAGAGG - Intergenic
1133474650 16:6108690-6108712 CAGGACCTTGAGAAGGAGATAGG - Intronic
1135224833 16:20646711-20646733 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1137376367 16:47955461-47955483 TAAAACAAGGAGAAGGAAATTGG - Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1138044282 16:53704456-53704478 CAGAAGAAGGACAAGGAAATGGG - Intronic
1138282527 16:55783016-55783038 CAGAAAAAGGAGAAGGAAATTGG + Intergenic
1138286414 16:55813603-55813625 CAGAAAAAGGAGAAGGAAATTGG - Intronic
1138852015 16:60641009-60641031 GAGATGTAGGAGATGGAGATAGG + Intergenic
1139059639 16:63233157-63233179 CAGAACTATGAGAAAAAAATGGG - Intergenic
1139381995 16:66538377-66538399 AAGACCTAGAAGAAGGAGAGGGG - Intronic
1140199620 16:72884629-72884651 CAGGAGGAGGAGAAGGAGAAAGG + Intronic
1141001565 16:80313072-80313094 AAGAAGTAGAAGAATGAGATGGG + Intergenic
1142367456 16:89657606-89657628 CAGCACTCGGAGAGGGAGAAGGG + Exonic
1143348235 17:6266248-6266270 CAGAGCTAGGAGAAAGACATTGG - Intergenic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1145921418 17:28612987-28613009 CAGAACCAGGAAAAGAAGGTGGG + Intronic
1146605082 17:34251133-34251155 CCGAACTGGGAGAGGGGGATGGG - Intergenic
1147339919 17:39747121-39747143 CAGAGCTAGGAGAAGGAGAGGGG - Exonic
1147447030 17:40480749-40480771 CAGAACTGGGAGGTGCAGATGGG - Exonic
1148262006 17:46192760-46192782 GAGAGCGAGGAGAAGGAGAAAGG + Exonic
1148492672 17:48033388-48033410 CAGAAAGGGGAGAAGGAAATAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148717336 17:49725104-49725126 AAGAAAAAGGAGAGGGAGATGGG - Intronic
1148727092 17:49801051-49801073 CAGAACGGAGAGGAGGAGATAGG + Intronic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1148800474 17:50221866-50221888 CAGAACCAGGACCAGGAGATAGG - Intergenic
1149066423 17:52485921-52485943 CAGGAGGAGGAGGAGGAGATGGG - Intergenic
1149273760 17:55012643-55012665 TAGAATTAGGAGAAGGAAAAGGG - Intronic
1149316350 17:55442530-55442552 TAGGACTGGGAGAAGAAGATAGG + Intergenic
1150456527 17:65310881-65310903 CTGAAGGAGGAGAAGGAGCTAGG + Intergenic
1151164526 17:72192415-72192437 CAGATTTGGGAGAAGAAGATTGG + Intergenic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152713465 17:81886637-81886659 CAGCACTTTGAGAATGAGATGGG - Intergenic
1153026432 18:677019-677041 CAGTACTGGGAAGAGGAGATGGG + Intronic
1153401874 18:4690801-4690823 CAGAATTAGGAGAAGGAAAAAGG + Intergenic
1154297569 18:13163700-13163722 CAGATCCAGAAGAAGGAGAAAGG + Intergenic
1155407997 18:25511648-25511670 GAGGAATAGGAGAAGGAGACAGG - Intergenic
1156228333 18:35130557-35130579 CAGAATTATTAGAAGGAGAGAGG + Intronic
1156291044 18:35748731-35748753 AAGAAAGAGGAAAAGGAGATGGG - Intergenic
1156447886 18:37250412-37250434 CAGACCTAGGGGAGGGAGAAGGG - Intronic
1156690168 18:39697799-39697821 TAGAACCAAGAGAAGGAGAAGGG - Intergenic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1157486317 18:48089974-48089996 CAGAACTGGGTGAAGGAGGTGGG + Intronic
1159040535 18:63319906-63319928 CAGGACCAGGAGGAGGAGAAAGG - Exonic
1160057656 18:75499541-75499563 AAGGAGTAGGAGAAGGAGAAGGG + Intergenic
1161128088 19:2571386-2571408 CAGAACAAGGATAAGGATATAGG - Intronic
1161366940 19:3885564-3885586 AAGAAGAAGGAGAAGGAGAGAGG + Intronic
1163900945 19:20099770-20099792 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1164394225 19:27849995-27850017 CAGACCTGGAAGAAGTAGATTGG - Intergenic
1164763164 19:30743389-30743411 CAGCAATAAGAGGAGGAGATTGG + Intergenic
1165796458 19:38522940-38522962 GAGATCTTGGAGGAGGAGATGGG - Intronic
1166674950 19:44734663-44734685 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1167349856 19:48967894-48967916 CAGACCCAGGGGAAGGAGAAGGG - Intergenic
1167415548 19:49369536-49369558 GAGAACCAGGAGAAGGGGAAGGG + Intronic
1167574279 19:50310292-50310314 CAGAAATGGGGGAAGGAGAGTGG - Exonic
1167702110 19:51054962-51054984 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1168294240 19:55370795-55370817 CAGGACTAGCAGAGAGAGATGGG + Intergenic
926188324 2:10708808-10708830 CAGGACCAGGAGGAGGTGATGGG + Intergenic
926435349 2:12831968-12831990 CAGAACCAGGAGTAGAACATAGG - Intergenic
927291358 2:21408137-21408159 TAGAACTAGGAGAATGTGCTGGG - Intergenic
927989092 2:27434951-27434973 AAGCACTAGGAGAAAGAGGTAGG - Intronic
928183554 2:29088795-29088817 TAAAACTAGTAGAAGGAAATAGG - Intergenic
928476414 2:31631856-31631878 CAGAATCAGAACAAGGAGATTGG + Intergenic
928476556 2:31632828-31632850 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
928478396 2:31654957-31654979 CAGAACTTGGAGAAGAAGAAAGG - Intergenic
928677414 2:33663225-33663247 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
929113890 2:38428342-38428364 AAAAAATAGAAGAAGGAGATAGG - Intergenic
929249184 2:39734054-39734076 AAGAAATAGGAGTAGTAGATTGG - Intergenic
930044137 2:47154382-47154404 CAGAATAAGGAAAATGAGATGGG + Intronic
930209175 2:48617031-48617053 CCTAACTAAGAAAAGGAGATAGG + Intronic
930357910 2:50345182-50345204 GAGAACTAGGAGAAGGAGAAAGG + Intronic
930631649 2:53760177-53760199 TAGAATTAGGAGAAGGAAAAAGG + Intronic
931429676 2:62197867-62197889 AAGAACCAGGAGCAGGAGTTAGG - Intronic
931586382 2:63834391-63834413 CAGTACTAGGAGAAAGACAGAGG - Intergenic
932321357 2:70824097-70824119 CAGAGCCAGGAGAGGGAGAGAGG + Intergenic
932555380 2:72819489-72819511 CAGAGAAAGGAGGAGGAGATAGG - Intronic
933174929 2:79164399-79164421 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
933692250 2:85188324-85188346 CAAAACTAGGATATTGAGATTGG - Intronic
933854375 2:86399144-86399166 CAGAACTAGGAGACAGGGAGGGG + Intergenic
934671772 2:96218397-96218419 CAGAATTAGGAGAAGAAAAAAGG - Intergenic
935070175 2:99687140-99687162 CAGAACAAAGAGAAGGATCTAGG + Intronic
935362138 2:102254585-102254607 AAGAACGAGGAGAGGGAGAAGGG + Intergenic
935665682 2:105510072-105510094 GAGAACTAGGTGAAAGACATAGG - Intergenic
935868030 2:107413010-107413032 CAATACTAGGAGAAAGAGACGGG + Intergenic
936387197 2:112041035-112041057 TAGAATTAGGAGAAGGAAAATGG - Intergenic
938635148 2:133216797-133216819 TAGATCTAGAAGAAGGAGAGTGG + Intronic
938941123 2:136170479-136170501 CAGAAAGGGGAGAAGGAGATTGG + Intergenic
939018347 2:136927955-136927977 GAGAAGTGGGAGAGGGAGATAGG + Intronic
940124252 2:150306688-150306710 CAGTATCTGGAGAAGGAGATAGG - Intergenic
940391200 2:153134616-153134638 TAGAAGTTTGAGAAGGAGATTGG - Intergenic
941991457 2:171561242-171561264 CAGAATTAGAAGAAGGAAAAAGG - Intergenic
942580321 2:177410469-177410491 TAGAATTAGGAGAAGGAAAAAGG - Intronic
942816596 2:180060106-180060128 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
944039237 2:195335876-195335898 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
944618344 2:201485177-201485199 CACAAGTCAGAGAAGGAGATGGG - Intergenic
946415379 2:219537474-219537496 CAGAGTCAGGAGAAGGGGATGGG + Intronic
946687181 2:222282104-222282126 CAGAAATAGGAGAACAAGTTAGG - Intronic
947679790 2:232019996-232020018 AAGAATTAGGAGAAGAACATAGG + Intronic
948246081 2:236487345-236487367 TAGGAATAGGAGAAGGTGATGGG - Intronic
948354554 2:237367735-237367757 AAGGACTAGGAGAAACAGATTGG + Intronic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
949008770 2:241666872-241666894 AAGAACTGGGAGAAGGGGACGGG - Intronic
1168741070 20:191928-191950 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1168920559 20:1531861-1531883 GAGAACTAGGAATAGGGGATTGG - Intergenic
1170009469 20:11705770-11705792 CAGAATGAGGAGAGGGAAATGGG + Intergenic
1171339920 20:24419817-24419839 CAGACCTAGTAGAAGGAGGCAGG + Intergenic
1171469000 20:25354921-25354943 CAGAAAGAGAAGAAAGAGATAGG - Intronic
1172179953 20:32996806-32996828 TAGGACTAGGGGAAAGAGATAGG - Intronic
1173411922 20:42818926-42818948 CTGAAGTAGCAGAAAGAGATGGG + Intronic
1173957959 20:47049261-47049283 CAGAACTAGAAAAATGACATAGG + Intronic
1174660838 20:52211710-52211732 CAAAACTGGGAGAAGGAAAAAGG - Intergenic
1174945424 20:54980117-54980139 CTCCACTAGGAGAAGGAGACAGG - Intergenic
1174961950 20:55167578-55167600 CAGAGAGAGGAGGAGGAGATAGG + Intergenic
1174977446 20:55350977-55350999 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1175471618 20:59233975-59233997 CAGAAGTAGAAGAAGCAGACAGG - Intronic
1177244780 21:18509461-18509483 CAGAACCAGGAGGAGGTAATCGG + Intergenic
1177480282 21:21677440-21677462 CAGAACCAGAAGAAAGAGACAGG + Intergenic
1177657622 21:24039660-24039682 TAGAAATAGGAAAAGGAGAATGG - Intergenic
1178178061 21:30128053-30128075 CGGAACAATGAGAAGGAGAATGG + Intergenic
1179258809 21:39740488-39740510 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1180206927 21:46266469-46266491 CAGAACTGGAAGGAGGAGACAGG + Intronic
1182176864 22:28299095-28299117 AAGAATTGGGAGAAGGAGCTTGG - Intronic
1182835537 22:33338461-33338483 AAGAAATAGGAGGAGGAGGTAGG - Intronic
1183175846 22:36224172-36224194 CTGAACTAGGAAGAGGAGAATGG + Intergenic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1185100576 22:48838829-48838851 CTGAGCTGGGAGAAGGAGGTGGG + Intronic
1185144208 22:49121111-49121133 CAGAACTAAGTAAAGCAGATTGG - Intergenic
950120413 3:10478733-10478755 AAGAACTAGGACAAGGACATGGG - Intronic
950164359 3:10782631-10782653 CAAAACTAGTAGGAGGAAATTGG + Intergenic
951103094 3:18711946-18711968 CAGAACTAAGTGAACAAGATAGG - Intergenic
952145596 3:30528546-30528568 AAGAATTCTGAGAAGGAGATAGG - Intergenic
952703712 3:36354122-36354144 CAGAACTTGTAGACAGAGATTGG - Intergenic
952979044 3:38720599-38720621 CAGTCCCAGGGGAAGGAGATGGG + Intronic
954362675 3:50130520-50130542 CAGCTCTGGGAGAGGGAGATTGG - Intergenic
955535087 3:59915085-59915107 CAGAACTGTGAGAAGCAGGTAGG + Intronic
955581110 3:60423702-60423724 CAGGACTGGTAGAAGGAGTTGGG - Intronic
956682275 3:71791880-71791902 CAGACCTAGGAAAAGGAGGTGGG - Intergenic
956999953 3:74874060-74874082 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960005535 3:112777416-112777438 CAGGAGTGGGAGGAGGAGATGGG - Intronic
960203728 3:114869651-114869673 CAGAACTTAGATAAGGAAATAGG - Intronic
961006663 3:123410152-123410174 CAGAACTAGGAGAATGAGAAAGG + Intronic
961354424 3:126327005-126327027 CAAAACTAGGAAATGAAGATGGG + Intergenic
961670550 3:128525408-128525430 CACAACTGGGAGAAGGGAATGGG - Intergenic
961996733 3:131253372-131253394 CAGAATTAGGAGAAAGAAAGAGG + Intronic
962005796 3:131348417-131348439 AAGAACTATGAGAAGGAGCCTGG + Intronic
962509264 3:136082605-136082627 CAGATGTAGGAGAAGGAGTTTGG + Intronic
962725190 3:138218527-138218549 CAGGACTTGGATAAGCAGATGGG - Intronic
963188291 3:142442095-142442117 TAGAATTAGGAGAAGGAAAAAGG + Intronic
963286899 3:143442100-143442122 CTGAAATAGGAGAGGGAGACAGG + Intronic
963729133 3:148954500-148954522 ACAAAGTAGGAGAAGGAGATGGG - Intergenic
963916090 3:150860092-150860114 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
965029418 3:163345191-163345213 CAGACCTTGTAGAAGGAGATAGG - Intergenic
965054470 3:163696144-163696166 TAGAATTAGGAGAAGGAAAGAGG - Intergenic
965578550 3:170243797-170243819 CAGAACTAAGAGAAGTAGCTGGG - Intronic
965825269 3:172723294-172723316 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
966113603 3:176433276-176433298 GAGAAGTAAGAGAAGAAGATTGG - Intergenic
966118620 3:176496361-176496383 CCGAACTAGGAGGAAGAGGTAGG - Intergenic
966223445 3:177572907-177572929 CAGAAATAGTAGAAAGAGAAAGG - Intergenic
966353891 3:179058902-179058924 TAGAATTAGGAGAAGGAAAAAGG + Intronic
966480817 3:180406448-180406470 CAAAAGGAGAAGAAGGAGATGGG + Intergenic
966680295 3:182634818-182634840 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
966921858 3:184617282-184617304 AAGAAGAAGGAGAAGGAGAAGGG + Intronic
967149878 3:186638744-186638766 CAGAACAAAGAGGAGGAGAATGG - Intronic
967313699 3:188130716-188130738 AAGAAGGAGGAGAAGGAGAAGGG + Intergenic
967623878 3:191664339-191664361 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
967769110 3:193314366-193314388 CAGAATATGGAGAGGGAGATGGG - Intronic
968391065 4:193451-193473 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
971561963 4:28089911-28089933 CACAACTAGGATAATGACATTGG - Intergenic
972781025 4:42287039-42287061 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
974525564 4:63046110-63046132 CAGAAAAAGTAGAAAGAGATGGG - Intergenic
976464623 4:85353355-85353377 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
977481435 4:97582118-97582140 CAGAAGTAGGAGATGGGGTTGGG - Intronic
977617904 4:99105995-99106017 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
978151918 4:105446515-105446537 CAGAAGGAAGAAAAGGAGATGGG + Intronic
978586465 4:110280433-110280455 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
978669479 4:111228788-111228810 CTGAACCAGGAGAAGCAGACTGG - Intergenic
978978782 4:114915818-114915840 AAGAAGGAGGAGAAGGAGAGGGG + Intronic
980444553 4:132887889-132887911 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
981514012 4:145587715-145587737 GAGAAGAAGGAGAAGGGGATGGG + Intergenic
981723311 4:147823139-147823161 CAGAACTTGGAGAAGCTGCTGGG + Intronic
983667048 4:170194085-170194107 CAGAATCAGAACAAGGAGATTGG - Intergenic
984578460 4:181479389-181479411 GAAAACTAGGAGAAGGATTTTGG + Intergenic
984724064 4:183003154-183003176 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
985241940 4:187939625-187939647 CATAACAGGGAGAGGGAGATTGG + Intergenic
985443744 4:190007027-190007049 CACAAGTAGGAGAATGAAATTGG - Intergenic
985690137 5:1304322-1304344 AAGAAGAAGGAGAAGGAGAAGGG - Intergenic
985957720 5:3277175-3277197 CAGAACTCTGAGAAAGAGACGGG + Intergenic
986051457 5:4094284-4094306 GAGAACATGGAGAAGGAAATTGG + Intergenic
986392620 5:7300297-7300319 CGGAAGCAGGAGAAGCAGATGGG - Intergenic
986623180 5:9697066-9697088 GAGGACGAGGAGAAGGAGAAAGG + Intronic
988104643 5:26728986-26729008 CAGAAATAAGAGCAGAAGATTGG - Intergenic
988426620 5:31072690-31072712 CAGAAATAGGAGAAGAAGAAGGG - Intergenic
988632077 5:32942324-32942346 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
988956980 5:36329923-36329945 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
991511130 5:67377309-67377331 CAGAACTGGGAAAAGGAGAGGGG - Intergenic
994342533 5:98647927-98647949 CAGAACCAGGTGAACGACATTGG - Intergenic
995465968 5:112449799-112449821 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
996849679 5:127938084-127938106 CAGGAGTAGGAGAAGGAAAATGG - Intergenic
998155404 5:139783923-139783945 AAGAGCTAGCAGAAGGAGAAAGG - Intergenic
998651769 5:144128564-144128586 CATCACTAGGAGAAGGAGTGAGG + Intergenic
999071647 5:148749761-148749783 TAGAACTAGTAGAAAGAGAAAGG + Intergenic
999131333 5:149285654-149285676 CTGAACTAAGAGAGGCAGATAGG - Intronic
1000564691 5:162833332-162833354 AAGAACTAGGAAAAGGTGTTTGG - Intergenic
1001275685 5:170349538-170349560 CGGAAGTAGGACAAGCAGATGGG - Intergenic
1001554438 5:172626355-172626377 CAGCAAGAGGAGAAGGAGAGAGG - Intergenic
1001751241 5:174133240-174133262 CTGAACCAGGAGGAGGAGAGGGG - Intronic
1001865199 5:175097851-175097873 AGGAACAAGGAGCAGGAGATGGG - Intergenic
1002526878 5:179820033-179820055 CAGAACTGGGGCAAGGAGAGGGG - Intronic
1003904836 6:10689608-10689630 CAGAACTAGTAGAAGGGGATAGG + Intronic
1004046662 6:12031629-12031651 CAGAACTGGGATAGGGAGACAGG + Intronic
1006429692 6:33988146-33988168 CAGGACCAGGAGAAGGAGCTTGG - Intergenic
1006555168 6:34859601-34859623 CAGAACTAGGAGAAGGAGATGGG - Intronic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007597603 6:43061039-43061061 TAGAACTAGCAGAAGGATTTAGG - Intronic
1009372650 6:62926484-62926506 CAGAATTTGGTGAAGGTGATGGG - Intergenic
1010677080 6:78757277-78757299 CAGAAGTAGGATCAGAAGATCGG + Intergenic
1011077110 6:83449153-83449175 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1011179077 6:84598851-84598873 CATAACAAGGAGCAGGAGCTGGG - Intergenic
1011860211 6:91745922-91745944 AAGAACTAGGCAAAAGAGATGGG - Intergenic
1012494436 6:99818965-99818987 CAGCTCTAGGAGAAAGAGAGAGG - Intergenic
1013543513 6:111134181-111134203 CAGAATCAGAAGATGGAGATTGG + Intronic
1013543880 6:111136848-111136870 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1013572715 6:111445805-111445827 CAGACATAGGAAAAGGAGACTGG + Intronic
1015053137 6:128865959-128865981 CTGCAATAGGAGAAAGAGATTGG - Intergenic
1015317458 6:131832470-131832492 AAGATCTGGGAGAAGGAGAAAGG + Intronic
1015865159 6:137720170-137720192 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1016050972 6:139529831-139529853 AAGAACCAGTAGAAGGAGATTGG + Intergenic
1016438541 6:144061784-144061806 AATAACTAGAAGAGGGAGATTGG - Intronic
1016460911 6:144279432-144279454 CAGTAGTAGGAGCAGGAGAGGGG + Intergenic
1018440970 6:163813061-163813083 CAGGAGTAGGAGAAAGAGTTGGG - Intergenic
1018757276 6:166861238-166861260 CAGTGCTGGGAGTAGGAGATAGG + Intronic
1020508197 7:9019651-9019673 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1021363978 7:19753161-19753183 GAGAATTAGGAGAAAAAGATGGG - Intronic
1021655316 7:22868564-22868586 CAGAACTGGGATAAGGAGAGAGG - Intergenic
1022282015 7:28920453-28920475 GAGACGCAGGAGAAGGAGATGGG - Intergenic
1023622199 7:42085346-42085368 CAAAACTAGCAGAAGCAGGTAGG + Intronic
1024094132 7:45970998-45971020 CAGAAATAGGAGAAACAGACTGG - Intergenic
1024206821 7:47170148-47170170 CATCTCTAGGGGAAGGAGATTGG - Intergenic
1025888288 7:65620424-65620446 CAGAACAAGGAGGTGGAAATGGG + Intergenic
1027537710 7:79426327-79426349 AACAAGTAGGAGAAGGAGAAAGG - Intronic
1028493799 7:91442009-91442031 CAGGACTAGGTGAAGGCAATTGG + Intergenic
1030226211 7:107154327-107154349 CAAAACTAGGAAAATGACATTGG + Intronic
1030324191 7:108202795-108202817 AAGAACTAAGAGAATGAGAATGG - Intronic
1030607720 7:111655677-111655699 CAGAACTAGAGGAAGAAGAAAGG + Intergenic
1030843170 7:114380318-114380340 TAGAATTAGGAGAAGGAAAATGG - Intronic
1030847089 7:114432392-114432414 CACAGATAGGAAAAGGAGATTGG + Intronic
1031150666 7:118050350-118050372 CAGAAGCAGGGAAAGGAGATTGG - Intergenic
1031209044 7:118798578-118798600 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1031346088 7:120669278-120669300 GTGAACTTGGAGAAGGACATGGG - Intronic
1031507939 7:122609709-122609731 CAGAACTACAGGAAGGAAATAGG + Intronic
1031854146 7:126901542-126901564 CAGAACAAGGAGGTGGAAATGGG - Intronic
1031874486 7:127122972-127122994 CAGGAACAGGAGAAGAAGATGGG + Intronic
1032561182 7:132894465-132894487 CAAAAGTAGGAGAAGCAGCTAGG - Intronic
1034122581 7:148640899-148640921 CAGAGATATGAGATGGAGATAGG - Intergenic
1035902562 8:3473003-3473025 CAGAACCAGGAGACAGAGTTAGG - Intronic
1037024940 8:14023725-14023747 AAAAACTAGGAGAAGGAGCCAGG + Intergenic
1038762413 8:30396497-30396519 CAGAACGAGGAGAGGGATGTGGG + Intronic
1038813572 8:30877763-30877785 CAAAACTAGGAAAATGACATTGG + Intronic
1040003911 8:42601903-42601925 CAGCACTGGGAGATGGAGATGGG - Intergenic
1041663538 8:60421524-60421546 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1041846977 8:62340465-62340487 GTGAAATAGGAGAAGGAGAAAGG + Intronic
1042056222 8:64767116-64767138 TAGAATTAGGAGAAGGAAAAAGG + Intronic
1042364602 8:67922384-67922406 TAGAATTAGGAGAAGGAAAAAGG + Intergenic
1042491910 8:69409354-69409376 AAGAACTAGCAGAAAGAGAAGGG + Intergenic
1042853624 8:73241600-73241622 CAGAACCTGGAGGAGGAGGTGGG + Exonic
1045415559 8:101963318-101963340 AAAAACCAGGAAAAGGAGATTGG - Intronic
1045949021 8:107830539-107830561 CAGAATTGGGAGAAGGGGAAAGG - Intergenic
1046758144 8:117992500-117992522 CAGGACTAGGAGAAGATGTTGGG - Intronic
1047062329 8:121241575-121241597 TAGAAATAGGAGGAAGAGATGGG + Intergenic
1047541880 8:125775696-125775718 CAGAACTAGGTGAAGAAGAGAGG + Intergenic
1047574609 8:126138955-126138977 CAGAAGTAGGAGCAAGAGAGAGG - Intergenic
1047894122 8:129345919-129345941 CAGACATAAGAGATGGAGATAGG + Intergenic
1048282313 8:133114417-133114439 CAGTACTAGGAGAGGGAGGCAGG - Intronic
1048788376 8:138076538-138076560 CAGAACTAGGATAAGGTGAAAGG - Intergenic
1048862139 8:138731418-138731440 CAGCACTGGAAGAAGGTGATAGG + Intronic
1049252844 8:141598385-141598407 CTGAATTAGGAGGCGGAGATGGG - Intergenic
1050652918 9:7792375-7792397 CAGAACTAGGATTAGAAGCTGGG + Intergenic
1051171030 9:14317505-14317527 CAGAAAAAGGAAAATGAGATAGG + Intronic
1052810278 9:33052198-33052220 CAGAACTAGGAAATTGACATTGG - Intronic
1056271583 9:84953054-84953076 CAGCACCAGGAGAAGGGGCTGGG - Intronic
1056575955 9:87856321-87856343 CAGAGGTAGGAGGAGGAGCTGGG + Intergenic
1056704594 9:88941239-88941261 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1056705368 9:88948057-88948079 CAGAATTAAGTGAAGGAGGTAGG + Intergenic
1057003230 9:91532084-91532106 AACAGCTATGAGAAGGAGATTGG + Intergenic
1058853042 9:109032059-109032081 CAGAACTGGGAGAGGGAGAGAGG - Intronic
1059068617 9:111110810-111110832 TAGGACTAGAAGAAGGATATGGG + Intergenic
1060294076 9:122331464-122331486 CAGAACTAGGAGTAGGCGTGAGG - Intergenic
1060527198 9:124327312-124327334 CAGGGCGAGGAGAAGGAGATTGG - Intronic
1060545323 9:124455944-124455966 CAGAACTGGGACTAGGACATGGG + Intronic
1060860023 9:126946571-126946593 CAGAGTTAGGAAAAGGAAATGGG + Intronic
1061083156 9:128384298-128384320 CAGCACCAGAGGAAGGAGATGGG - Intronic
1061622963 9:131823725-131823747 CAGACCTGGGACAGGGAGATGGG - Intergenic
1062592875 9:137281832-137281854 CAGGGCTAGGGGAAGGAGCTGGG + Exonic
1185553468 X:1002245-1002267 CAGACCCTGGAGAAGGAGAGGGG + Intergenic
1186512557 X:10140940-10140962 CAGAGCTAGGGGAGGGAGAACGG - Intronic
1186694835 X:12019287-12019309 CAGAACTAGGATAATGACAACGG - Intergenic
1186882018 X:13875857-13875879 CAGAGGTGGGGGAAGGAGATGGG + Intronic
1187249729 X:17586077-17586099 CAGAACCAAGACAAGGAGATGGG - Intronic
1187363584 X:18649344-18649366 GAAAACTAGGAGAATGAGGTGGG - Intronic
1188974641 X:36658469-36658491 CAAAACTTGGACAAGGAGCTTGG + Intergenic
1189014995 X:37087736-37087758 CAGAACGAGGAGAGGGATGTGGG + Intergenic
1189067384 X:37824807-37824829 AAGAAATAGGAGAGGGAGATTGG - Intronic
1189095789 X:38137836-38137858 CACAGCTTGGAGAAGGAGCTAGG - Intronic
1189684395 X:43548808-43548830 AAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1190239254 X:48644598-48644620 AATAAGTAGGAGAAGGAGAAGGG - Intergenic
1190760507 X:53434237-53434259 TGGAACTAGGAGAAAGAGATCGG - Intronic
1192939639 X:75899509-75899531 CAGAATTAGGAGAAGGAAAAAGG - Intergenic
1194391828 X:93328272-93328294 CTGAACAAGGAAAAAGAGATAGG + Intergenic
1194973838 X:100373295-100373317 TAAAACTAGGAGAAGGAGGCTGG - Intronic
1195285887 X:103383303-103383325 CAGAACTGGGAGAAGTGGGTGGG - Intergenic
1195508030 X:105681248-105681270 GAGAACAAGGAGGAGGAGACAGG + Intronic
1195707789 X:107750575-107750597 CAGAACAAGGAGAGAGAGCTGGG + Intronic
1196324906 X:114391202-114391224 CAGAAGTTGGAGAAGAAGAGAGG + Intergenic
1196329488 X:114453753-114453775 AAGAACTAGAAGAAGGAGGGAGG + Intergenic
1196712677 X:118779510-118779532 TAGAACGAGGGGAAGGAAATGGG + Intronic
1197287016 X:124607602-124607624 CAGAGGTGGGAGAAGCAGATTGG + Intronic
1197355141 X:125430325-125430347 CAGAGACAGGAGAAGGAGAAGGG - Intergenic
1197645152 X:129009495-129009517 CAGATTTAGGAGAAGGGGACTGG - Intergenic
1197916677 X:131543252-131543274 CAGGGCTAGGGGAAAGAGATGGG + Intergenic
1197954478 X:131931258-131931280 TAGAATTAGGAGAAGGAAAAAGG - Intergenic
1198426522 X:136526278-136526300 TAGAAATAGGAGAAGCATATTGG - Intergenic
1199263974 X:145808734-145808756 CAGGAGGAGGAGAAGGAGAAGGG + Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200827417 Y:7659009-7659031 CAGCACTACGGGAAGGAGTTAGG + Intergenic
1201724004 Y:17134344-17134366 TAGAATTAGGAGAAGGAAAATGG - Intergenic