ID: 1006555648

View in Genome Browser
Species Human (GRCh38)
Location 6:34863925-34863947
Sequence GATGGGTATTGTAAGTGGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 98}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006555643_1006555648 -2 Left 1006555643 6:34863904-34863926 CCAGTTGTCTGAGCTGAAAGGGA 0: 1
1: 0
2: 1
3: 13
4: 204
Right 1006555648 6:34863925-34863947 GATGGGTATTGTAAGTGGATGGG 0: 1
1: 0
2: 0
3: 5
4: 98
1006555640_1006555648 18 Left 1006555640 6:34863884-34863906 CCTAATATTGGGAACTTTATCCA 0: 1
1: 0
2: 0
3: 8
4: 174
Right 1006555648 6:34863925-34863947 GATGGGTATTGTAAGTGGATGGG 0: 1
1: 0
2: 0
3: 5
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006555648 Original CRISPR GATGGGTATTGTAAGTGGAT GGG Intronic
900723152 1:4193593-4193615 GATGGGTAATGTAAGCAGAGAGG - Intergenic
901006846 1:6175960-6175982 GGTTGGTTTTGTAGGTGGATGGG + Intronic
901113852 1:6823498-6823520 GATGGGTATTATAATTCAATTGG + Intronic
901295563 1:8158487-8158509 GATGGGAGTTGTCTGTGGATGGG + Intergenic
901351538 1:8601376-8601398 GTAGGGTAGTGTAACTGGATTGG - Intronic
906508932 1:46400299-46400321 GATGGGGATTTTAAGGGGAGAGG + Intronic
907700573 1:56783402-56783424 GATGGCTATTGTAAGTGTGCTGG + Intronic
907832613 1:58079304-58079326 GATGGGCACAGTAAGTGGAGAGG - Intronic
907974856 1:59421737-59421759 GATGGGTATTGTAGATGTTTAGG + Intronic
908820421 1:68080232-68080254 GATAGGTAATGTAAGTAGAGAGG - Intergenic
909140546 1:71859091-71859113 GATTTGTATTCTAAGTGAATTGG - Intronic
912627950 1:111221811-111221833 GATGGGCATTGAAAGTGCCTCGG - Intronic
912728087 1:112076766-112076788 GGTGGGAATTGTGAGTGGAGGGG - Intergenic
915666833 1:157452853-157452875 GATAGGAATTTTAAGGGGATTGG - Intergenic
917536362 1:175877326-175877348 GATGGGTATTGTGAATGAGTGGG + Intergenic
918781387 1:188704281-188704303 CATGGGTATTGTATGTGTAATGG + Intergenic
922017926 1:221670993-221671015 GGCTGGTATTGAAAGTGGATGGG + Intergenic
1063983933 10:11480846-11480868 GATGGGTGTAGTAAGAGGCTAGG - Intronic
1064169881 10:13021691-13021713 GATGGATATTGTACAGGGATGGG + Intronic
1068318706 10:55381857-55381879 GAGGGGTATTGGGATTGGATGGG - Intronic
1074947644 10:118296700-118296722 GATGGGGAATGTGAGTTGATTGG - Intergenic
1075582828 10:123634962-123634984 GATGGGGATTGGAGGGGGATGGG + Intergenic
1076363141 10:129904116-129904138 GATGGGCATTCTAGGTGGAAGGG - Intronic
1081665212 11:44912764-44912786 CATGGGTGTTGTATGTGCATGGG + Intronic
1083156666 11:60827555-60827577 CATGGGTCTTGGAATTGGATGGG + Intergenic
1089800129 11:121021196-121021218 TATGAGTATTGTATGTGGCTGGG - Intergenic
1099813030 12:87609370-87609392 GATAAATATTGTAAGTGAATAGG + Intergenic
1101062886 12:100989806-100989828 GATGGATAGTGTATATGGATAGG + Intronic
1101062907 12:100989911-100989933 GATGGATAGTGTACCTGGATAGG + Intronic
1101391333 12:104303209-104303231 GATGGGTATTGGAGGGGGCTTGG + Intronic
1102691264 12:114762997-114763019 GAAGGGTATTGGGATTGGATGGG - Intergenic
1104211383 12:126691972-126691994 TATGGGCATTGTCAGTGGATAGG - Intergenic
1117235393 14:53769200-53769222 GAAGGGTCTTATAAGTGGTTTGG + Intergenic
1124173655 15:27402166-27402188 GATGGCTTTTGTAAGTAGATTGG - Intronic
1126417755 15:48435827-48435849 GGTGAGTATTCTAGGTGGATGGG - Intronic
1129202343 15:74010991-74011013 GATGGCTGATGTAAGTGCATAGG + Intronic
1131891598 15:96977960-96977982 GATGAGTATTGTCAGAAGATAGG - Intergenic
1139843554 16:69902280-69902302 GATGGCAATTGTGAGTGGATTGG + Intronic
1150346865 17:64411302-64411324 GATGGGTATATGCAGTGGATAGG + Intronic
1151837606 17:76593523-76593545 GATGGGAATTGGAAGTGGGAGGG + Intergenic
1152056839 17:78035285-78035307 GGTGGGTCTGGAAAGTGGATTGG - Intronic
1153570431 18:6466661-6466683 GATGCTTATTGTAAGTGAAATGG + Intergenic
1154388690 18:13918218-13918240 GATGGGTATGTTCAGTAGATTGG - Intergenic
1156319210 18:36002593-36002615 GATGGGTAATATAAGTAGAGAGG - Intronic
1156816160 18:41313975-41313997 GATGGGTATGGGAAGTTGAGGGG - Intergenic
1159458826 18:68696098-68696120 GATGGGTGCTGTAGGTTGATTGG - Intronic
1164130447 19:22356860-22356882 TATGGTTATTGTAAGTGTACCGG - Intergenic
1168062689 19:53901924-53901946 TATGAGTATTTTAAGTGGGTGGG + Intronic
926491226 2:13528336-13528358 TATGGTTATTGTAAGTGTACTGG - Intergenic
927341706 2:21990820-21990842 GTTGGGTATTGTGAGTACATGGG - Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
929897921 2:45977701-45977723 CCTGGGTATTGTTAGTGGAATGG - Intronic
1185063771 22:48620744-48620766 GATGGATAGTGTGGGTGGATGGG - Intronic
1185063851 22:48621010-48621032 GATGGATAGTGTGGGTGGATGGG - Intronic
950075934 3:10187278-10187300 GATGGGAAGTGAAAGTGGAGAGG - Intronic
955258701 3:57361772-57361794 GATAGGTATTATTATTGGATAGG - Intronic
955258859 3:57363276-57363298 GATAGGTATTATTATTGGATAGG - Intronic
955292787 3:57707847-57707869 AATGGGTATGGAAAGTAGATGGG + Intergenic
955434605 3:58889294-58889316 GATGGGGTTTGTAAATGGAACGG - Intronic
956798889 3:72739286-72739308 GAGGGGGATTGTCGGTGGATGGG - Intergenic
959356535 3:105337264-105337286 ATTGGGAATTTTAAGTGGATTGG - Intergenic
964541182 3:157781716-157781738 GATGAGTATTTTAAGTGTGTAGG - Intergenic
967654318 3:192028085-192028107 GATGGGTAATGTAAGCAGAGAGG + Intergenic
970375371 4:15451719-15451741 CATGGGCATTGGAGGTGGATGGG - Intergenic
972758308 4:42074693-42074715 GATGGCTTTCATAAGTGGATAGG - Intronic
979615268 4:122735115-122735137 GATGGGTATAGAAAGTGCGTTGG + Intronic
980534639 4:134101501-134101523 CATGGGTATTTTACTTGGATAGG + Intergenic
982714629 4:158793848-158793870 GATGGGGTTTGTAAATGGAACGG + Intronic
992347040 5:75889856-75889878 GATGTGTACTGTAAGCGGTTTGG + Intergenic
996905547 5:128595709-128595731 TATGGGTATTGTAAAAGGAAAGG + Intronic
1001535009 5:172492121-172492143 CATGGGCACTGTAAGTGGCTAGG + Intergenic
1005998599 6:30947851-30947873 GATGGGTAGAGTAAGGAGATGGG - Intronic
1006555648 6:34863925-34863947 GATGGGTATTGTAAGTGGATGGG + Intronic
1008328474 6:50216433-50216455 GAGTGGTATTGTAAGAGGATAGG + Intergenic
1012199201 6:96384753-96384775 GGTGGGTGTTGAGAGTGGATAGG - Intergenic
1014154015 6:118090982-118091004 GATGGGACTTGTCAGTAGATTGG + Intronic
1015972928 6:138761009-138761031 GATGGGTATTGTAATAAGAGAGG + Intronic
1016612468 6:146006921-146006943 GAAGGGTATTGGGGGTGGATAGG + Intergenic
1018360392 6:163061904-163061926 AATGTGCATTGTATGTGGATGGG + Intronic
1019766058 7:2851358-2851380 GATGGGAATTATAAGAGGAAGGG + Intergenic
1020043671 7:5023556-5023578 TATGGTTATTGTAAGTGTACTGG - Intronic
1026569187 7:71514531-71514553 GATGGGTATTGGATGAGGATGGG - Intronic
1028042689 7:86075472-86075494 GAAAGATATTGTAAGTGGAAAGG - Intergenic
1028229619 7:88291033-88291055 AATGGGTATTTTAAATAGATTGG + Intronic
1029226194 7:99030353-99030375 GATGGGTGATGGAAGTGGGTGGG + Exonic
1030275027 7:107711467-107711489 GAGAGGTATTGTGAGTGGCTGGG + Intronic
1040013816 8:42683896-42683918 AATGTGTCTTGGAAGTGGATTGG + Intergenic
1041804957 8:61839857-61839879 AATGGGTAATGTAAGTAGAGAGG - Intergenic
1044093635 8:88033996-88034018 GATGGGTATTGCCTGTTGATAGG - Exonic
1044381551 8:91539889-91539911 GGTAGCTATTGTAAGTGGAATGG + Intergenic
1045811622 8:106227420-106227442 AATGGGTATTGTCAGGGGAGAGG - Intergenic
1046871709 8:119211059-119211081 GATGAGTATTCTAAATGGAGGGG - Intronic
1049523840 8:143110485-143110507 AATGGATATTGTACGTGGACTGG - Intergenic
1050375630 9:4969989-4970011 GATGGTCAATTTAAGTGGATTGG - Intergenic
1051434995 9:17021332-17021354 GATGGGGATTGTCAGTGTTTGGG + Intergenic
1052293580 9:26871984-26872006 ATTGGGCTTTGTAAGTGGATGGG + Intronic
1055727080 9:79242110-79242132 TATGGGCATTTTAAGTGCATGGG - Intergenic
1055851455 9:80635740-80635762 GATGGGTAATGTAAGCAGAGAGG - Intergenic
1056435509 9:86572138-86572160 GATGTGTGTTGTAAGAGGACAGG - Intergenic
1058307486 9:103461382-103461404 AATGGGTAATGTAAGTAGGTAGG + Intergenic
1188794619 X:34446604-34446626 GAAGGGTAGTGGAAGTTGATGGG - Intergenic
1193197780 X:78654919-78654941 GATGGGTTATGGAAGTGGCTAGG + Intergenic
1196582470 X:117393576-117393598 GATGGGTTTTGGAATTGCATGGG - Intergenic
1198441898 X:136671697-136671719 GATGGGTTTAGGAAGTGGCTGGG - Intronic