ID: 1006556725

View in Genome Browser
Species Human (GRCh38)
Location 6:34873268-34873290
Sequence CAGGACTCCAGGCGGACAAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006556725_1006556735 30 Left 1006556725 6:34873268-34873290 CCTGTTGTCCGCCTGGAGTCCTG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1006556735 6:34873321-34873343 TTCTGTCTCCCTGGGGTCCCTGG 0: 1
1: 2
2: 104
3: 384
4: 990
1006556725_1006556734 23 Left 1006556725 6:34873268-34873290 CCTGTTGTCCGCCTGGAGTCCTG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1006556734 6:34873314-34873336 GTGGCTCTTCTGTCTCCCTGGGG 0: 1
1: 0
2: 2
3: 39
4: 277
1006556725_1006556733 22 Left 1006556725 6:34873268-34873290 CCTGTTGTCCGCCTGGAGTCCTG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1006556733 6:34873313-34873335 AGTGGCTCTTCTGTCTCCCTGGG 0: 1
1: 0
2: 0
3: 25
4: 244
1006556725_1006556729 4 Left 1006556725 6:34873268-34873290 CCTGTTGTCCGCCTGGAGTCCTG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1006556729 6:34873295-34873317 TCTTTCCCAGCTGTGCTGAGTGG 0: 1
1: 0
2: 3
3: 37
4: 294
1006556725_1006556732 21 Left 1006556725 6:34873268-34873290 CCTGTTGTCCGCCTGGAGTCCTG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1006556732 6:34873312-34873334 GAGTGGCTCTTCTGTCTCCCTGG 0: 1
1: 0
2: 2
3: 31
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006556725 Original CRISPR CAGGACTCCAGGCGGACAAC AGG (reversed) Exonic
900168626 1:1255311-1255333 CAGGGCTCCAGCAGGCCAACCGG - Exonic
901684269 1:10935020-10935042 CAGGACTGCAGGGGGACACTTGG - Intergenic
904224768 1:29007126-29007148 CTGCACTCCAGCCTGACAACAGG - Intronic
904484809 1:30817696-30817718 CAGGTCACCATCCGGACAACTGG + Intergenic
904810672 1:33161571-33161593 CAGAACGCCAGGCAGACAAAGGG + Intronic
910712594 1:90196966-90196988 CAGGACTCCAGGAGAAAGACGGG - Intergenic
912491826 1:110066685-110066707 CTGGACTCCAGGCAGAAAAGGGG + Intronic
913235231 1:116775280-116775302 CAAGACACCAGGCGGAGAACCGG - Intergenic
913250819 1:116910558-116910580 CCGGGCTCCCGGCGGCCAACAGG - Intronic
916876839 1:168978562-168978584 CAGGAAGCCAGGTGGATAACTGG + Intergenic
920719562 1:208374639-208374661 CAGGTCTCCAGAGGGACAATGGG - Intergenic
921046470 1:211481352-211481374 CAGGGCTCCTGGTGGACAGCCGG + Exonic
922333101 1:224595081-224595103 CTGCACTCCAGCCTGACAACAGG - Intronic
1064038012 10:11931099-11931121 CAGGACTCCAAGTAGACAAAAGG + Intronic
1067026781 10:42849220-42849242 CAAGTCTCCAGGCTGCCAACTGG - Intergenic
1067548464 10:47214736-47214758 CAGGACACCAGCCTGACAGCAGG - Intergenic
1075999250 10:126902633-126902655 CAAAACTCCAGGTGGACCACGGG - Intergenic
1076686222 10:132199609-132199631 CAGGACTCAGTGCGGACAGCAGG - Intronic
1077119600 11:900748-900770 CAGGACTCCAGCCAGACTAAGGG + Intronic
1077493012 11:2870751-2870773 CAGGAGTCCAGGCGCACCCCTGG - Intergenic
1080505501 11:32909121-32909143 CTGCACTCCAGCCGGGCAACAGG + Intronic
1083925562 11:65803994-65804016 GAGGACTCCAGGCAGGTAACAGG + Intergenic
1091421163 12:341861-341883 CTGTACTCCAGCCGGGCAACAGG + Intronic
1092287330 12:7136259-7136281 CAGGTCTCCAGGCGGATACCAGG - Exonic
1096542197 12:52314177-52314199 CGGGTGTCCAGGCGGAGAACAGG + Intergenic
1097679652 12:62636856-62636878 CAGGACTACAGGTGCACACCCGG + Intergenic
1102208555 12:111107295-111107317 AAGGACTCCAGGTGCACACCAGG - Intronic
1103411443 12:120714725-120714747 AAGGACTCCAGGCCTACTACAGG + Intronic
1104994741 12:132646792-132646814 CTGGACTCCAGCCGGGCAACAGG + Intronic
1105002599 12:132700986-132701008 CAAAACTCCTTGCGGACAACTGG - Intronic
1105829725 13:24153279-24153301 CAGGACTGCAGGTGGAAAATGGG - Intronic
1112933482 13:104770309-104770331 CAGGACTGTAGGCAGACGACTGG - Intergenic
1114076424 14:19163764-19163786 CACGACTCCAGGTGGGCATCAGG - Intergenic
1114085744 14:19235805-19235827 CACGACTCCAGGTGGGCATCAGG + Intergenic
1114301839 14:21385486-21385508 CAGGACTCCAGGAGGTGAAAAGG - Exonic
1117130328 14:52679923-52679945 TGGGACTACAGGCGGACTACAGG - Intronic
1121588814 14:95083415-95083437 CTGCACTCCAGCCTGACAACAGG + Intergenic
1202897294 14_GL000194v1_random:17518-17540 CACGACTCCAGGCAGGCATCAGG + Intergenic
1124601595 15:31137011-31137033 CAGGACTCCATGAGGAAGACAGG - Intronic
1125457240 15:39872371-39872393 GAGGAGTACAGGCTGACAACTGG + Intronic
1127134026 15:55900198-55900220 CAGGACTCCAAGGTGACAACAGG + Intronic
1129320843 15:74773817-74773839 CAGGACTCCAGGTGGGAACCAGG + Intergenic
1131620753 15:94065743-94065765 CAGGGTTCCAGGAGGACATCAGG + Intergenic
1134115373 16:11543928-11543950 CAGGACTCCAGGAGGACTGAAGG + Intergenic
1136076921 16:27823536-27823558 CTGGTCTCCAGGAGGACAGCAGG + Intronic
1137050888 16:35712425-35712447 AGGGACTCCAGGCCGACACCAGG - Intergenic
1137400116 16:48146425-48146447 CAGGGCTCCAGGCTGCCATCAGG - Exonic
1138778008 16:59748597-59748619 CAGGAATCCAGGCAGAGCACAGG + Intronic
1140082973 16:71767897-71767919 CAGGATTCCAAACAGACAACAGG + Intronic
1143104203 17:4520259-4520281 CAGGACTGCAGGTGGACTCCTGG - Intronic
1145347241 17:22048859-22048881 CTAGACTCCAGGTGGACATCAGG - Intergenic
1145347288 17:22049079-22049101 CTGGACTCCAGGTGTACATCAGG - Intergenic
1149347563 17:55753564-55753586 CAGGACTGGAGGCAGACAGCTGG - Intronic
1151552067 17:74828006-74828028 CGGCACTCCAGGCGGGGAACAGG - Intronic
1154054902 18:11003610-11003632 CAGGGCACCAGGCGGGCATCAGG + Intronic
1154124148 18:11674663-11674685 CAGGGCTCCAGCCAAACAACTGG - Intergenic
1157197637 18:45632364-45632386 CAGGACTCCATGGGTACAACGGG + Exonic
1161313887 19:3608986-3609008 CAGGACACCAGGTGGACCTCGGG + Intergenic
1163639927 19:18456439-18456461 CAGGGCTCCAGGAGGACTGCTGG - Intronic
1166532353 19:43550709-43550731 TACAACTCCAGGCAGACAACAGG + Intronic
925919247 2:8627914-8627936 CAGCACGCCAGGCGCACGACAGG + Intergenic
927207715 2:20620581-20620603 CAGCACTGCAGGAGGAGAACTGG + Intronic
927285713 2:21354751-21354773 CAGGACTGCAGGCTGGCAGCAGG + Intergenic
927516160 2:23672738-23672760 CAGGACACCGGGCCGACACCTGG - Intronic
931632954 2:64317548-64317570 CATGACTCCAGGCTGAGAGCTGG - Intergenic
931868677 2:66437684-66437706 CAGGAGGCCAGGCGGGCAAATGG - Intronic
933493000 2:83012197-83012219 CTGGACTCCAGCCTGGCAACAGG + Intergenic
934047957 2:88187347-88187369 CTGGACTCCAGGAGGACAGAAGG + Intergenic
938548963 2:132361787-132361809 CAGGACACCAGGCCGAGCACAGG - Intergenic
941548766 2:166888499-166888521 CAGGTCTCTAGGCAGACAAAAGG + Exonic
948883032 2:240870019-240870041 CAGGACCCCAAGTGGACATCAGG + Intronic
1171520271 20:25770434-25770456 CCGGACTCCAGGTGTACATCAGG + Intronic
1171520321 20:25770654-25770676 CTAGACTCCAGGTGGACATCAGG + Intronic
1171556598 20:26085839-26085861 CTAGACTCCAGGTGGACATCAGG - Intergenic
1171556648 20:26086059-26086081 CCGGACTCCAGGTGTACATCAGG - Intergenic
1171877788 20:30594348-30594370 CAGGACACCACGCGGAGCACAGG - Intergenic
1172448639 20:35006372-35006394 CAGGACTCCAGGTGAACTTCTGG + Intronic
1176127615 20:63482935-63482957 CCTGACTCCAGGCGGCCAGCCGG + Intergenic
1176616979 21:9033507-9033529 CACGACTCCAGGCGGGCATCAGG + Intergenic
1176654406 21:9576721-9576743 CTGGACTCCAGGTGTACATCAGG + Intergenic
1176654456 21:9576941-9576963 CTAGACTCCAGGTGGACATCAGG + Intergenic
1176708151 21:10130139-10130161 CATGACTCCAGGCGGGCATCAGG - Intergenic
1179584755 21:42367447-42367469 CAGGAGTCCAGGGGACCAACTGG - Intergenic
1179987185 21:44928343-44928365 ATGGACTCCAGGGGGAAAACCGG + Intronic
1180292230 22:10857388-10857410 CACGACTCCAGGTGGGCATCAGG - Intergenic
1180495035 22:15886810-15886832 CACGACTCCAGGTGGGCATCAGG - Intergenic
1180940756 22:19658430-19658452 CCAGACTCCAGGTGGACACCAGG + Intergenic
1183267558 22:36838642-36838664 CAAAACACCTGGCGGACAACAGG - Intergenic
1183529778 22:38347144-38347166 CAGGACTCCAGGCTGAGCCCAGG + Intronic
1184110550 22:42391422-42391444 CAGGACTCCAGGCAAGAAACGGG + Intronic
954197038 3:49003043-49003065 CATGACTCCAGGTGGACAAGAGG - Intronic
954451191 3:50572582-50572604 GAGGGCTCCAGCCGGACACCTGG + Intronic
957221773 3:77391456-77391478 CTGGACTACAGGTGGACTACAGG - Intronic
957506291 3:81125476-81125498 CAGCTCTCCAGGCGGACACTGGG - Intergenic
958974641 3:100653839-100653861 CAGAACTCCAGGAGCACAAAAGG + Intronic
965510523 3:169563696-169563718 CAGGACACTACGCGGACATCAGG + Intronic
969398656 4:6939232-6939254 CAGGCCTGCAGGAGGACAGCAGG - Intronic
969467880 4:7368437-7368459 CAGGACTCCCGGCAGGCAGCAGG - Intronic
971875721 4:32306011-32306033 AAGGAGGCCAGGCGGACAGCGGG - Intergenic
976475140 4:85475012-85475034 CAGGACTCGAGCCGCACTACAGG - Intergenic
976796691 4:88941693-88941715 CAGGGCTCCAGGAGGAAGACAGG - Intronic
981948243 4:150375229-150375251 CAGGACTGCAGGAGGAGAACGGG - Intronic
987092819 5:14522860-14522882 AAGGAGTCCAGGTGGACAAAAGG - Intronic
989465183 5:41746796-41746818 CAGGACTGCAGGAGGAGAAGGGG - Intronic
989522767 5:42421021-42421043 CAGAGCTCCAGGCTAACAACTGG - Intergenic
992233321 5:74684618-74684640 CGGGACGCCAGGCCGACACCGGG - Intronic
992895288 5:81240133-81240155 CAGGCTTCCAGGCGGTCAGCGGG - Intronic
995505994 5:112861266-112861288 CAGGACTTCCGGCGGAAAAGCGG + Exonic
995865614 5:116686793-116686815 CAGGACTCCAGGGTGGTAACTGG + Intergenic
1001873087 5:175174547-175174569 CAGCACTCCAGCCTGGCAACAGG + Intergenic
1003975655 6:11341289-11341311 CAAGTCTCCAGGCAGACAGCTGG - Intronic
1004407954 6:15352132-15352154 CAGGATTTCAGGAGGGCAACGGG - Intronic
1006556725 6:34873268-34873290 CAGGACTCCAGGCGGACAACAGG - Exonic
1008611314 6:53187025-53187047 CAGCACTCCAGGAGGCCAAGCGG - Intergenic
1011582618 6:88886960-88886982 CAGTACTTCAGGAGGCCAACAGG + Intronic
1011595034 6:89008016-89008038 CGGGACTACAGGTGCACAACTGG + Intergenic
1013415385 6:109920057-109920079 CAGCACCCCAGAAGGACAACAGG - Intergenic
1015024807 6:128520216-128520238 CAGGACTCCAGGCGTTCGTCGGG + Intronic
1020218923 7:6218966-6218988 CTGTACTCCAGGCTGGCAACGGG + Intronic
1022952674 7:35353529-35353551 TAGGACTCCAGGCTGAGATCAGG - Intergenic
1023267005 7:38417239-38417261 CAGGTTTCCAGGCAGACAAATGG + Intronic
1024617814 7:51130262-51130284 AAGCACTCCAGGAGGCCAACTGG + Intronic
1025280765 7:57625389-57625411 CTGGACTCCAGGTGTACATCAGG + Intergenic
1025280814 7:57625609-57625631 CTAGACTCCAGGTGGACATCAGG + Intergenic
1025303916 7:57839898-57839920 CTAGACTCCAGGTGGACATCAGG - Intergenic
1025303965 7:57840118-57840140 CTGGACTCCAGGTGTACATCAGG - Intergenic
1025976299 7:66372987-66373009 CAGCACTCCAGCCTGGCAACAGG - Intronic
1026137767 7:67678482-67678504 CTGGAATCCAGGCTGACACCAGG - Intergenic
1029643553 7:101836777-101836799 CATGTCTCCAGGCAGACAACGGG - Intronic
1030043683 7:105475431-105475453 CAGCACTCCAGGAGGCCAAGGGG - Intronic
1030097889 7:105917262-105917284 TAGGACTCCAGGAGGACACCAGG - Intronic
1036149978 8:6288098-6288120 CAGCACTCCAGCCTGGCAACAGG + Intergenic
1052603887 9:30672723-30672745 CAGTCCTCCAGGCAGACATCAGG - Intergenic
1052965082 9:34334369-34334391 GAGAACTCCAGGCTGACAGCAGG - Intronic
1053645114 9:40115653-40115675 CATGACTCCAGGCGGGCATCAGG - Intergenic
1053751934 9:41266123-41266145 CAGGACACCAGGCCGAGCACAGG + Intergenic
1053760604 9:41347875-41347897 CATGACTCCAGGCGGGCATCAGG + Intergenic
1054257457 9:62830453-62830475 CAGGACACCAGGCCGAGCACAGG + Intergenic
1054326137 9:63713551-63713573 CATGACTCCAGGTGGGCATCAGG - Intergenic
1054333857 9:63785269-63785291 CAGGACACCAGGCCGAGCACAGG - Intergenic
1054539459 9:66260318-66260340 CATGACTCCAGGCGGGCATCAGG + Intergenic
1055346918 9:75349687-75349709 CAGGACTCTGTGCAGACAACAGG - Intergenic
1056880288 9:90385069-90385091 CAGGAGGCCATGCAGACAACAGG + Intergenic
1057070324 9:92092696-92092718 CTGCACTCCAGCCTGACAACAGG + Intronic
1202792914 9_KI270719v1_random:99108-99130 CATGACTCCAGGCGGGCATCAGG - Intergenic
1203632127 Un_KI270750v1:80179-80201 CTGGACTCCAGGTGTACATCAGG + Intergenic
1191234277 X:58121559-58121581 CGAGACTCCAGGCTGACCACAGG + Intergenic
1192579625 X:72270354-72270376 CAGGACTCCAGCCAGTCACCTGG - Intronic
1194204234 X:90992973-90992995 CATGAATCCAGGCAAACAACAGG + Intergenic
1198232070 X:134699708-134699730 CAGGACTCTAGAAGGGCAACAGG - Intronic
1198715226 X:139551499-139551521 CAGGATTCCAGACAGGCAACTGG + Intronic
1200550073 Y:4568411-4568433 CATGAATCCAGGCAAACAACAGG + Intergenic
1201150378 Y:11092358-11092380 CACAACTCCAGGCGGGCATCAGG + Intergenic