ID: 1006558269

View in Genome Browser
Species Human (GRCh38)
Location 6:34887870-34887892
Sequence CGCTGTGCCCGGGGACCCGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006558269_1006558281 17 Left 1006558269 6:34887870-34887892 CCCCCGGGTCCCCGGGCACAGCG 0: 1
1: 0
2: 1
3: 11
4: 181
Right 1006558281 6:34887910-34887932 CCCTGTCTCTCCACCTTTGTCGG 0: 1
1: 1
2: 2
3: 21
4: 268
1006558269_1006558284 21 Left 1006558269 6:34887870-34887892 CCCCCGGGTCCCCGGGCACAGCG 0: 1
1: 0
2: 1
3: 11
4: 181
Right 1006558284 6:34887914-34887936 GTCTCTCCACCTTTGTCGGAGGG 0: 1
1: 0
2: 0
3: 11
4: 88
1006558269_1006558283 20 Left 1006558269 6:34887870-34887892 CCCCCGGGTCCCCGGGCACAGCG 0: 1
1: 0
2: 1
3: 11
4: 181
Right 1006558283 6:34887913-34887935 TGTCTCTCCACCTTTGTCGGAGG 0: 1
1: 0
2: 4
3: 17
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006558269 Original CRISPR CGCTGTGCCCGGGGACCCGG GGG (reversed) Exonic
900585536 1:3430717-3430739 GGCTGGGCCCAGGGACCCGCGGG + Intronic
901063779 1:6485531-6485553 CGCCGAGCGCGGGGACCCCGGGG + Intronic
902600877 1:17539661-17539683 CGCGGCGCCCCGGGACCGGGCGG + Intergenic
903213743 1:21832025-21832047 CGCTGAGCCTGGGGTCCCTGTGG - Intronic
903614788 1:24643662-24643684 CGCTAGGCCCCAGGACCCGGCGG - Intronic
905734350 1:40315618-40315640 GGCGGTCCCGGGGGACCCGGGGG + Exonic
906535231 1:46547745-46547767 AGCTGAAGCCGGGGACCCGGGGG - Exonic
908272842 1:62437285-62437307 TCCTGGGGCCGGGGACCCGGCGG + Exonic
909958236 1:81802972-81802994 TGCAGGGGCCGGGGACCCGGCGG + Intronic
912391738 1:109307508-109307530 CGCTGTGCCCGCTGCCCCCGGGG - Intergenic
912879035 1:113390692-113390714 CGCTGAGCCCAGGGACCAGCCGG + Intergenic
915322127 1:155061939-155061961 CCCTCTGCCCGCTGACCCGGTGG + Exonic
918275813 1:182953028-182953050 CGCTGTCTCCGGGGACACGGCGG - Exonic
920394060 1:205631462-205631484 CGCGGTGCCCGGCGGGCCGGGGG + Intronic
920912522 1:210232502-210232524 CCCGGTGCCCGGGGACACGCGGG - Intergenic
922496862 1:226063606-226063628 CCCTGTGCCGAGGGACCCGAAGG + Intronic
922925118 1:229342129-229342151 CGCGGAGGCCGGGGACGCGGAGG - Exonic
923673957 1:236064722-236064744 CGCCGTGCCCGGTGCCCCGGCGG + Intronic
924475737 1:244380778-244380800 TGCTGTTCCCTGGGACCCAGGGG - Intronic
1063197932 10:3760260-3760282 CGCTGGCCCCGGGCACCCAGAGG - Intergenic
1064086317 10:12349102-12349124 CGCTGTGGCCTGTGGCCCGGGGG - Intergenic
1064364664 10:14696849-14696871 GGCTGTGCCCAGGGACACTGTGG + Intronic
1067730655 10:48808852-48808874 CCCTGTCCCCAGGGACCCAGAGG + Intronic
1072750538 10:97975372-97975394 CTCTGTGCACAGGGCCCCGGAGG - Intronic
1074814501 10:117134302-117134324 CGCTGGGCCCGGGGCGGCGGCGG + Exonic
1076402030 10:130190772-130190794 CCTCGTCCCCGGGGACCCGGGGG + Intergenic
1076574329 10:131453796-131453818 CCCTGTGCCCCGGGACCCCCTGG + Intergenic
1076615226 10:131750445-131750467 CGCTGTGCACAGGCACACGGAGG - Intergenic
1077141266 11:1025957-1025979 CGCAGGGGCCGGGGACCCAGAGG - Intronic
1079867617 11:25756280-25756302 GGCAGTGCTGGGGGACCCGGTGG - Intergenic
1082821229 11:57545984-57546006 TTCTGTGCCCGGGGCCCCCGGGG - Exonic
1083263938 11:61537570-61537592 CCCTGAGCCCGGGCACCAGGAGG - Intronic
1084153837 11:67303333-67303355 TGCGGAGCCCGGAGACCCGGAGG - Intergenic
1084225328 11:67711672-67711694 GGCTGAGTCCGGGGACCAGGCGG + Intergenic
1084263142 11:67991519-67991541 GGCTGAGTCCGGGGACCAGGCGG + Exonic
1084387919 11:68855572-68855594 CGCAGAGCCCCGAGACCCGGAGG + Intergenic
1089315963 11:117591744-117591766 GGCAGTGCACGGGGACCCTGGGG - Intronic
1089323295 11:117640799-117640821 CGCTGTGCCAGGGGAAACTGAGG - Intronic
1089808425 11:121112671-121112693 CGCTCTGCAAGGGGAACCGGTGG + Intronic
1090279699 11:125445329-125445351 GGCTGTCCACGGGGACCTGGAGG - Intergenic
1090749590 11:129734064-129734086 CGCTGTGCTGGGAGACCTGGAGG - Intergenic
1094841654 12:34344915-34344937 CGCTGTTCCCGGGGACCCCGGGG - Intergenic
1097058855 12:56267469-56267491 CACTGTCCCCGGGGACCCCAGGG - Intronic
1101504054 12:105330644-105330666 CGCCCCGCCCGGGGACCCGCCGG - Exonic
1103050233 12:117772813-117772835 CGATGTTCCCGTGGCCCCGGTGG - Intronic
1104714343 12:131006499-131006521 GGCTGGACCCGGGGACCCCGAGG + Intronic
1104854755 12:131896385-131896407 CCCTGGGCCCCGGGACACGGAGG - Intronic
1105013990 12:132774810-132774832 AGCTGTGCCCAGGCGCCCGGCGG - Intronic
1106735930 13:32587176-32587198 GGCGGCGCGCGGGGACCCGGCGG - Intronic
1109563409 13:64078857-64078879 AGCTTTGCCCGGGGAGCAGGAGG + Intergenic
1112344043 13:98576360-98576382 CGCAGGGCCCCGGGACCCGGCGG + Intronic
1113420888 13:110170627-110170649 GGCTGTCCCTGGGGCCCCGGAGG + Exonic
1113460546 13:110479319-110479341 CGCGGTCCCCGGTGACCCAGAGG + Intronic
1113480418 13:110616021-110616043 CGCGGTGGCCGGGGAACGGGGGG + Intronic
1113660553 13:112104309-112104331 AGCGGGGCCCGGGGACCCTGGGG + Intergenic
1113936842 13:113999365-113999387 CTCTGTGCCCGGGGTCACCGGGG - Intronic
1114558512 14:23576029-23576051 CGCTGCGGCCGGGGGCCCGCTGG + Exonic
1115203172 14:30874819-30874841 CGCCGCGCCCGGGGATCCGAAGG + Intronic
1118317993 14:64737321-64737343 CCGTGTGCTGGGGGACCCGGTGG + Intronic
1119519684 14:75277062-75277084 CGCTCAGCCCCCGGACCCGGCGG + Intergenic
1119707219 14:76790559-76790581 AGCTGTTCCCAGGGACCTGGGGG + Intronic
1122372165 14:101234765-101234787 CAGTGAGCCCAGGGACCCGGGGG + Intergenic
1122558355 14:102593202-102593224 CGCGGGGCCCGGGGCCGCGGGGG - Intronic
1122973382 14:105161388-105161410 GGCTGTGCCGGGAGACCGGGTGG - Intronic
1124496667 15:30191641-30191663 CGCTGGGACCGGGGACCTGCGGG - Intergenic
1124746909 15:32347007-32347029 CGCTGGGACCGGGGACCTGCGGG + Intergenic
1126849726 15:52789650-52789672 GGCTGTGCTCAGGGGCCCGGTGG + Exonic
1130040801 15:80404238-80404260 CGCTCTGACCGGGGAGCCGCGGG + Intergenic
1131830451 15:96351741-96351763 CGCTATGCCCGTGGATTCGGAGG + Intergenic
1132466179 16:78303-78325 CGCTGCGCGCGGGCATCCGGCGG - Exonic
1132946090 16:2532186-2532208 CTCTGTGCCCGGGGCCGCGCGGG - Intergenic
1133060305 16:3170611-3170633 GACGGTGTCCGGGGACCCGGTGG - Intergenic
1133273746 16:4624760-4624782 CGACGTGCCCCGGGACCGGGAGG + Intronic
1133924246 16:10181106-10181128 CGCTGTGCCTGGGGAACTTGGGG + Intronic
1135034744 16:19067705-19067727 GGCTGCGCCCGGGGGCCCGGCGG + Exonic
1136751336 16:32638243-32638265 CGCTCTGCCAGGGGAACCTGGGG - Intergenic
1139390640 16:66604868-66604890 CGCGGAGCCCGGGGACCGCGGGG - Exonic
1140224357 16:73066474-73066496 CGGTGTCTCCGGGGAGCCGGAGG - Intergenic
1141469035 16:84226072-84226094 CGGTGTGCCCAGGGCCCAGGGGG - Intronic
1142033068 16:87847974-87847996 TGCTGGGCCCTGGGTCCCGGTGG - Intronic
1142202193 16:88766577-88766599 AGCTGGGCCCAGGGCCCCGGAGG - Intronic
1203053470 16_KI270728v1_random:897498-897520 CGCTCTGCCAGGGGAACCTGGGG - Intergenic
1142571567 17:878286-878308 CGATGTGTCTGGGGACCCTGGGG + Intronic
1143089349 17:4439816-4439838 CTCTGTGCCAGGGGACCCAGTGG - Intronic
1143503657 17:7352432-7352454 CGATCTGCCCGGGGTCTCGGAGG + Exonic
1143548624 17:7614920-7614942 CGCTGCGCGCGGGGCCCCGAGGG + Intronic
1143554763 17:7653145-7653167 CACTGTGCCCTAGGACCAGGAGG + Intronic
1145925772 17:28645380-28645402 CGCGGGGCTCGGGGACCCGCGGG + Intronic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1147645709 17:42032651-42032673 CACTGTGCCCGGGGTCCGGCAGG + Intronic
1148077148 17:44944324-44944346 CGCTTGGACCGGGGACTCGGAGG - Intronic
1150003618 17:61456528-61456550 CGCTGGGCCCGGGGCCCGGAAGG - Exonic
1151530014 17:74698214-74698236 GGCAGTGCCAGGGGACCGGGGGG - Intronic
1152728467 17:81958988-81959010 CCCTGTGCCTGGGGACACAGAGG + Exonic
1152748449 17:82051771-82051793 CGCAGCGCCGGGGGTCCCGGCGG - Exonic
1153238740 18:3012809-3012831 CGGGGTGCGCGGGGAGCCGGGGG - Intronic
1153595228 18:6718428-6718450 CTCTTTGCCAGGGGACCTGGAGG - Intergenic
1154032862 18:10768285-10768307 CGCTGTGTTCAGGGACACGGAGG + Intronic
1160164215 18:76495721-76495743 CGCAGTGCCCAGGTACCCGCCGG - Exonic
1160912676 19:1482100-1482122 CGCTGGGCCTGGGCACACGGCGG - Exonic
1161622082 19:5303343-5303365 CCTTGTGCACGGGGACCAGGAGG - Intronic
1163118073 19:15200173-15200195 CTCTGGCCGCGGGGACCCGGAGG - Intronic
1163666406 19:18606038-18606060 CGCGCAGCCCGGGGTCCCGGGGG - Intronic
1164593971 19:29521537-29521559 CGCTGTGCACAGAGACCTGGAGG - Intergenic
1166747184 19:45146916-45146938 CCCTGTGCCCGGGGCCACAGGGG - Exonic
1168280873 19:55304786-55304808 TGTTGTCCCCGGGGTCCCGGTGG - Exonic
924987765 2:287739-287761 CGCGGAGCCCCGGGAGCCGGCGG - Exonic
927685528 2:25168245-25168267 CGCTGTCTCCAGGGAGCCGGCGG - Intronic
933747926 2:85584414-85584436 CGCAGTGCCAGCGGCCCCGGAGG - Exonic
935233391 2:101118406-101118428 CACTGTGCCCGGCTACCTGGTGG - Intronic
936370644 2:111899202-111899224 CGCTCTGGCCGGAGTCCCGGGGG + Intronic
937260934 2:120586549-120586571 CCATGGGCCCGGGGACCCCGTGG - Intergenic
937986346 2:127639862-127639884 CACTGTGCCTGGGGTCCCTGGGG + Intronic
945245334 2:207711998-207712020 GGCGGTGTCCGGGGACGCGGTGG + Exonic
946396963 2:219448119-219448141 GGCTGGGCCGGGGGTCCCGGCGG - Exonic
947718267 2:232352504-232352526 CGCTGTGCCAGGCGGCCCGAGGG - Intergenic
948912677 2:241012191-241012213 CGCTGTGGCCGAGGTCCCTGGGG - Intronic
1170991122 20:21303020-21303042 TTCTGTGCCCAGGGAGCCGGAGG + Intergenic
1172484028 20:35287811-35287833 CGCAGTGCCCGGGGAGACAGCGG + Exonic
1176068832 20:63215769-63215791 CGCAGAGCCCGGGGTCGCGGAGG - Intronic
1178135023 21:29617555-29617577 CACTGGGCCCGGGTACCTGGGGG - Intronic
1179421626 21:41241078-41241100 CGGTGTGCCAGGGGTGCCGGTGG - Intronic
1180127731 21:45803666-45803688 GGCAGTGCCCAGGGACCCTGGGG - Intronic
1181155449 22:20917379-20917401 CGCTGGGCCCCGGCTCCCGGCGG - Intergenic
1181562923 22:23716146-23716168 AGCTGGGCCCGGGGATCGGGAGG - Intergenic
1181768851 22:25111504-25111526 TGCTCAGCCAGGGGACCCGGGGG + Intronic
1184421714 22:44386028-44386050 CGCTTTGCCCGTGGAGCCCGGGG - Intergenic
950472808 3:13197052-13197074 CCCTGTGCCCTGGGACACTGTGG + Intergenic
950540420 3:13609153-13609175 GGCAGTGACCAGGGACCCGGAGG + Intronic
950560489 3:13718665-13718687 AGCTGTGCCCGGGCACCCGCTGG + Intergenic
951080410 3:18445096-18445118 CGCTGCGCCCGGGGGCTCGGCGG + Intronic
953660249 3:44886733-44886755 CTCTGTGCCAGGGAACCCAGAGG + Intronic
957078581 3:75619456-75619478 GGCTGAGTCCGGGGACCAGGCGG + Intergenic
961929368 3:130517091-130517113 CGCTGGGCCCGGGGCCGCCGGGG + Intergenic
963603565 3:147396519-147396541 CGCTCTTCCCTGGGCCCCGGGGG + Intronic
968457103 4:705551-705573 CGCTGTGCTGAGGGACCCGACGG - Intergenic
969021664 4:4143429-4143451 GGCTGAGTCCGGGGACCAGGCGG + Intergenic
969442897 4:7227757-7227779 CGCTCTGCCTGAGGACCCAGAGG - Intronic
969625962 4:8305920-8305942 GGCTGTGCCTGGGGAGGCGGTGG + Intronic
969732204 4:8963986-8964008 GGCTGAGTCCGGGGACCAGGCGG - Intergenic
971195749 4:24471001-24471023 CGCTGCGCCCCGGGCCCGGGAGG + Intergenic
977176886 4:93829202-93829224 CGCTGCGCCCCGGGACGAGGTGG + Exonic
979205613 4:118033794-118033816 CGCGGTGCCCGGGGTCCGGCGGG - Intronic
979278101 4:118835848-118835870 CGCCCGGCCCGGGGACGCGGCGG - Intronic
983537957 4:168878113-168878135 CGCTGAGCCCGAGGCCCCGTGGG + Intronic
985555402 5:555578-555600 CTCTGTGCCCTGGAACCCGACGG + Intergenic
991964708 5:72079511-72079533 TGCAGTCCCCGGGGACACGGGGG + Intergenic
998407683 5:141883219-141883241 GGCAGCCCCCGGGGACCCGGTGG + Intergenic
999248368 5:150167220-150167242 CGGTGTGCCCGGGCCCCCGAGGG - Exonic
1001287809 5:170436408-170436430 AGCTGTGCCCTGTGACCCAGTGG - Intronic
1003139113 6:3456609-3456631 CGCTGTGCCCGGGGCGCCCGCGG - Intronic
1006535616 6:34696659-34696681 CGCCGGGCCCGGGGACCTGGAGG + Exonic
1006558269 6:34887870-34887892 CGCTGTGCCCGGGGACCCGGGGG - Exonic
1006581493 6:35080182-35080204 CTCTGTGCCTGGGGACAGGGAGG + Intronic
1007368162 6:41408917-41408939 AGCGGGGCCCGGGGACCCGCTGG + Intergenic
1015315089 6:131808146-131808168 CGAGGCGCCCGGGGACCCGCAGG + Exonic
1016988182 6:149910386-149910408 AGCTGTGCCTGGGGCCACGGTGG - Intergenic
1017282232 6:152637149-152637171 AGCTGGGGGCGGGGACCCGGAGG + Intronic
1017446185 6:154509704-154509726 TGCGGTGCCCGGCGACCCGGGGG - Intronic
1017446356 6:154510350-154510372 AGCTGTGCCCGGGATCCCGGCGG - Exonic
1018058397 6:160071247-160071269 CCCTGTGCCCAGGGCCCAGGAGG + Intronic
1020001929 7:4761146-4761168 CCGTGTGTCCGGGGACCCCGGGG - Exonic
1020005197 7:4780106-4780128 TGCTGTGCCAGGGGACTCTGGGG - Intronic
1020309077 7:6855459-6855481 GGCTGAGTCCGGGGACCAGGCGG + Intergenic
1022943187 7:35258359-35258381 CGCCGCGCCTTGGGACCCGGAGG - Intergenic
1023381126 7:39609698-39609720 CCATGTGGCCGGGGACCGGGAGG - Intronic
1025236347 7:57237292-57237314 CGCTGTTCTCGGGGAGCTGGCGG - Intergenic
1029124492 7:98287196-98287218 CGCTCTCCCCAGAGACCCGGGGG + Intronic
1029139832 7:98401490-98401512 TGCTGGCCCCGGGGACCCCGAGG + Intergenic
1029821209 7:103149332-103149354 CGCTTTGCGCGGGGACTCTGTGG - Intronic
1029926952 7:104328570-104328592 GGCTGTGCCAGGCGAGCCGGAGG + Intergenic
1033657119 7:143381710-143381732 CGCTGGGCCCCGGGTGCCGGGGG - Exonic
1033742226 7:144284258-144284280 AGCTGTGGCCGGGGGCCAGGAGG + Intergenic
1033751676 7:144365356-144365378 AGCTGTGGCCGGGGGCCAGGAGG - Exonic
1034269706 7:149797639-149797661 CCCTGTGCCCGGGTCCCCAGGGG + Intergenic
1035283645 7:157793078-157793100 CGCTGTGCCCGGGGAGAGGAAGG + Intronic
1036644348 8:10602433-10602455 AGCTGTGCCTGTGGACACGGGGG + Intergenic
1038136640 8:24793123-24793145 CTCTGTGCTCAGGGACCCTGAGG - Intergenic
1040038917 8:42897059-42897081 CGCTCTGTCGGGGGATCCGGGGG - Exonic
1043847419 8:85178024-85178046 CGCTTTGCCCGGAGACACCGTGG + Intronic
1048981580 8:139705511-139705533 CTCTGGGCCCGGGGTCCCTGAGG - Intergenic
1054798678 9:69325557-69325579 CGCGGAGCCCGGGGCCGCGGCGG - Intronic
1055945708 9:81689439-81689461 CTCTGTGCCCCGCGTCCCGGAGG - Intergenic
1060554185 9:124499961-124499983 GGCAGTACCTGGGGACCCGGAGG - Intronic
1061540849 9:131277309-131277331 CCCTGCGCCCAGGGAGCCGGAGG - Intergenic
1061802729 9:133121080-133121102 CGCTGTTTCCGGGCTCCCGGCGG - Exonic
1062024031 9:134332294-134332316 TGCCCTGCCCTGGGACCCGGGGG - Intronic
1062197971 9:135285084-135285106 CTGTGTGCCTGGGGACCCAGAGG - Intergenic
1185476608 X:419315-419337 CGAGGTGCCCGGGGAGGCGGCGG - Intergenic
1185736473 X:2500445-2500467 GGCCATGGCCGGGGACCCGGGGG - Intronic
1186355278 X:8783814-8783836 CGCTGTGCCTGGGGCCGCAGGGG + Intergenic
1187181533 X:16947213-16947235 GGCTGCCCCCAGGGACCCGGAGG + Intronic
1190732333 X:53234276-53234298 GGCTGTGCCAGGGGGCCCAGAGG + Exonic
1200000182 X:153056235-153056257 TTGTGTGCCCGGGGGCCCGGGGG + Intergenic