ID: 1006558360

View in Genome Browser
Species Human (GRCh38)
Location 6:34888423-34888445
Sequence TTCAACTGGCCCGAAACCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006558352_1006558360 22 Left 1006558352 6:34888378-34888400 CCCCGGGACTGGTAAACTTTCAG No data
Right 1006558360 6:34888423-34888445 TTCAACTGGCCCGAAACCGCGGG No data
1006558353_1006558360 21 Left 1006558353 6:34888379-34888401 CCCGGGACTGGTAAACTTTCAGG No data
Right 1006558360 6:34888423-34888445 TTCAACTGGCCCGAAACCGCGGG No data
1006558355_1006558360 20 Left 1006558355 6:34888380-34888402 CCGGGACTGGTAAACTTTCAGGC No data
Right 1006558360 6:34888423-34888445 TTCAACTGGCCCGAAACCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006558360 Original CRISPR TTCAACTGGCCCGAAACCGC GGG Intergenic
No off target data available for this crispr