ID: 1006562615

View in Genome Browser
Species Human (GRCh38)
Location 6:34926705-34926727
Sequence TTCTCCTCCTGGAAGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 303}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006562615_1006562622 29 Left 1006562615 6:34926705-34926727 CCCTCACTCTTCCAGGAGGAGAA 0: 1
1: 0
2: 1
3: 25
4: 303
Right 1006562622 6:34926757-34926779 CAGAGCCAGTCCCTGATTGGGGG 0: 1
1: 0
2: 4
3: 38
4: 272
1006562615_1006562619 27 Left 1006562615 6:34926705-34926727 CCCTCACTCTTCCAGGAGGAGAA 0: 1
1: 0
2: 1
3: 25
4: 303
Right 1006562619 6:34926755-34926777 ACCAGAGCCAGTCCCTGATTGGG 0: 1
1: 0
2: 1
3: 13
4: 121
1006562615_1006562621 28 Left 1006562615 6:34926705-34926727 CCCTCACTCTTCCAGGAGGAGAA 0: 1
1: 0
2: 1
3: 25
4: 303
Right 1006562621 6:34926756-34926778 CCAGAGCCAGTCCCTGATTGGGG 0: 1
1: 0
2: 0
3: 11
4: 192
1006562615_1006562618 26 Left 1006562615 6:34926705-34926727 CCCTCACTCTTCCAGGAGGAGAA 0: 1
1: 0
2: 1
3: 25
4: 303
Right 1006562618 6:34926754-34926776 CACCAGAGCCAGTCCCTGATTGG 0: 1
1: 0
2: 1
3: 18
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006562615 Original CRISPR TTCTCCTCCTGGAAGAGTGA GGG (reversed) Intronic
900306861 1:2014365-2014387 TTCTCATCCATAAAGAGTGATGG - Intergenic
903185439 1:21626386-21626408 TTCTCTTCCAGGAGGAGCGATGG - Exonic
903222422 1:21876230-21876252 TTGTCCCCCAGGAAGCGTGAAGG + Exonic
903859408 1:26355932-26355954 TTCTTCCCTTGGAGGAGTGAGGG - Intergenic
904109513 1:28114501-28114523 TTCTCTTCCTGGTACAGAGAGGG + Intergenic
904200119 1:28814039-28814061 TGCTCCTCCAGAAAGAGTGGCGG + Intronic
905604166 1:39282319-39282341 TTTTCCTCCTGCTGGAGTGATGG + Exonic
906742418 1:48195841-48195863 TTCTCTTCCTGGCACAGGGAGGG - Intergenic
908122016 1:60994675-60994697 TTCTCCTCCTAGAAAAATGAGGG + Intronic
911745252 1:101434811-101434833 TTCTCTTCCTTGAGGAGAGAAGG - Intergenic
911842235 1:102697798-102697820 TTTTCCTCTTGGGAGAGGGAGGG - Intergenic
912039669 1:105372718-105372740 TTCTCCTCCTTCAAAAATGAGGG - Intergenic
913557155 1:119978772-119978794 TTTTCCTCCTGGTGCAGTGAGGG - Intronic
916071269 1:161171496-161171518 TTCTCTCCATGGAAGAGGGAGGG + Exonic
916651149 1:166835829-166835851 TTCTCCATCTGCCAGAGTGAAGG - Intergenic
917072900 1:171171858-171171880 TTCTCTTCCTGGTACAGAGAGGG - Intergenic
918381824 1:183963676-183963698 TTCCCATCCTGGAAGAGCGCTGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
920253135 1:204635865-204635887 TGCTCGTCCTGGAAGAATGTTGG - Intronic
921443486 1:215216965-215216987 TTCTCCTCCTAGAAACGTTATGG + Intronic
922808832 1:228404645-228404667 TCCTCTTCCTGGTAGAGAGAGGG - Intronic
922970233 1:229729790-229729812 ATCCCCTCATGGAAGGGTGAGGG - Intergenic
1062976393 10:1686531-1686553 GGCTACTCCTGGAAGATTGATGG - Intronic
1065807216 10:29405324-29405346 ATGTCCTTCTGTAAGAGTGAAGG + Intergenic
1066316330 10:34250871-34250893 CTTTCCTCCTGGAAGTGTGGAGG - Intronic
1067360628 10:45574878-45574900 TAGTCCTTTTGGAAGAGTGAGGG - Intronic
1067661326 10:48238105-48238127 ATCTGCTCCTGGAAGAGCGCTGG + Exonic
1068086999 10:52386444-52386466 ATCTCCTCTTGGAAAAGTAATGG - Intergenic
1068138495 10:52974795-52974817 TTCTCCTCCTTCATTAGTGAAGG - Intergenic
1069921839 10:71820212-71820234 CTGTCCTCCTGGCAGAGGGAGGG - Intronic
1070816998 10:79331074-79331096 TGTTCCACCTGGAAGAATGAAGG + Intergenic
1071913356 10:90261408-90261430 TTCTACTACTGAAAGAGAGAGGG + Intergenic
1073448768 10:103597087-103597109 TTCTGCTCCGGGAAGAGTCGGGG - Exonic
1073788489 10:106915889-106915911 TTCTCCTCCAGGAGGAGCAATGG + Intronic
1074081507 10:110171275-110171297 TCCTCCTCCTGGGAGAGGAAAGG - Intergenic
1074477470 10:113785681-113785703 TTCTTCTCCAGCAAGACTGAAGG - Intergenic
1074575380 10:114663901-114663923 TTTTCCTCCTGGGAGAGCCACGG - Intronic
1074821813 10:117185429-117185451 TTCTCCTCTGGGAAGTCTGAGGG + Intergenic
1075145077 10:119875759-119875781 CTGTCCTCCAGGAAGAGGGAGGG + Intronic
1077848916 11:6055318-6055340 TTCTCCACCTGGAGGAGACAGGG - Intergenic
1077938251 11:6813236-6813258 TGCCCCTCCCAGAAGAGTGATGG - Intergenic
1077985572 11:7347984-7348006 CTCTGTTCCTGGAGGAGTGAGGG + Intronic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1078747123 11:14126251-14126273 TTCTGCACATGGCAGAGTGATGG - Intronic
1080699750 11:34634580-34634602 TGCTCCTGCTGCAAGGGTGAAGG - Intronic
1080811681 11:35710685-35710707 TTCTCTTCCTGGTATAGAGAGGG + Intronic
1080971173 11:37279200-37279222 TCCTCCTCCTAGAAGCATGAGGG + Intergenic
1081735427 11:45400187-45400209 TCATCCTCCTTGAGGAGTGAGGG - Intergenic
1082034043 11:47629797-47629819 TTTTCCTCATAGAAGAATGAGGG + Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083668430 11:64287578-64287600 TTCTCCATCTGTAAGAGTGGAGG + Intronic
1083726101 11:64629186-64629208 CTCTCCGCCTGGGAGAGTGATGG + Intronic
1084289414 11:68152239-68152261 TTTTCCTCCTGGAAGGAAGACGG + Intergenic
1084818335 11:71665039-71665061 TTCTCCTCTAGGAAAAGAGATGG - Intergenic
1085272134 11:75276727-75276749 TTCTCCACCTGGCAGAGGGCTGG - Intronic
1086821047 11:91436524-91436546 TTCTACAGCTGGAAAAGTGATGG - Intergenic
1086917210 11:92544742-92544764 TTCTCCTCTGGGAACAGGGAAGG + Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087236409 11:95723761-95723783 TTCCCCTGGTGGAATAGTGAAGG + Intergenic
1089596261 11:119582723-119582745 TTCTCTTCCTGGTACAGAGAGGG + Intergenic
1089695189 11:120212165-120212187 TTCTCTGCCAGGCAGAGTGAAGG - Intronic
1089764854 11:120755823-120755845 TGCTGCTCCTGGAAGAGTCTAGG + Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091049596 11:132355437-132355459 ATGTCCTCCTGGAAGGATGATGG + Intergenic
1091823860 12:3494861-3494883 TTCTCCTCATGGAATAGGGCAGG + Intronic
1092071232 12:5633130-5633152 TTCTCCTCTTGGGTGAGAGAAGG + Intronic
1092146398 12:6217701-6217723 TTGTCCTCCTGGAAAAGCAATGG - Intronic
1093528287 12:20130928-20130950 TTCTCCTCCTAGGACAGTGTGGG + Intergenic
1095233868 12:39774203-39774225 TTCTCCTCAGATAAGAGTGAAGG - Intronic
1095513189 12:42976002-42976024 TTCTCTTCCTGGAACAAAGAAGG + Intergenic
1096216953 12:49803158-49803180 TTCTCTGCCTGCAGGAGTGAGGG + Exonic
1096906978 12:54944989-54945011 TACTCCTTTTGCAAGAGTGAGGG + Intergenic
1097059361 12:56271034-56271056 TTCTTTTCCTGGGGGAGTGAAGG + Intergenic
1097143472 12:56923527-56923549 TTCTGGTCCTGGAAAAGTCATGG - Exonic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097348474 12:58521519-58521541 TCCTCCTCCTGGAAGACTTTGGG - Intergenic
1097723787 12:63051580-63051602 TGCTTCTCCAGAAAGAGTGAAGG + Intergenic
1097892842 12:64795244-64795266 ATCTCCTGCTCGAAGGGTGAAGG + Intronic
1098185506 12:67892159-67892181 TTCTGATCCTGGAGGACTGAAGG + Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1101649837 12:106667421-106667443 TTCCCCTGCCGGAAGCGTGAGGG + Intronic
1102073164 12:110038438-110038460 TTCTACACCTGCATGAGTGAAGG + Exonic
1102238974 12:111311996-111312018 TCCTCCTCCCAGAAGAGTGAGGG - Intronic
1103143699 12:118575219-118575241 ATATCCTCCTGGAAGAGGAAGGG - Intergenic
1103927449 12:124430780-124430802 TTCTGCTCCTGGGAGAGCGCAGG + Exonic
1105057670 12:133117493-133117515 TTCTACTCCTGAAAGAATGGTGG + Exonic
1105654038 13:22415157-22415179 TTCCCCTGCTGGAAGCATGAGGG - Intergenic
1105872287 13:24516251-24516273 TTCACCTGCAGGAAGAGTGAAGG - Intergenic
1105917305 13:24928361-24928383 TTTACCTGCAGGAAGAGTGAAGG + Intergenic
1106586595 13:31062407-31062429 CTCACCTCATGGAGGAGTGAGGG - Intergenic
1106667242 13:31864645-31864667 TACTCATCCTGGGATAGTGATGG + Intergenic
1107712849 13:43167872-43167894 TTTTCCTCCTGGTATAGGGAGGG + Intergenic
1107761470 13:43683781-43683803 TCCTCCTCCTGGTAGAGGGGTGG + Intronic
1109589557 13:64460263-64460285 TTCTCGTAATGAAAGAGTGATGG - Intergenic
1111001707 13:82192965-82192987 TTCTCCTCTTGGTACAGTAAAGG - Intergenic
1112380563 13:98885055-98885077 TTCCCCTCCTGAAAGACGGAAGG - Exonic
1113089845 13:106605772-106605794 TTCTCCACCTGGAAAATTTAAGG + Intergenic
1114227314 14:20750927-20750949 TTCTCCTTCTGGCACAGAGAAGG + Intergenic
1114260718 14:21034289-21034311 TCCTCCTGCTGGTAGAGTTAAGG + Exonic
1117394766 14:55298389-55298411 TTACCCTCCTGGATGAGTGGAGG + Intronic
1117794153 14:59374621-59374643 CTCCCATCCTGGAAGAGTCAGGG - Intergenic
1119058283 14:71446768-71446790 TTCTCCTTCTGAAACAGTAAGGG + Intronic
1119067169 14:71540701-71540723 TTTTCCTCCTCCAAGAGAGATGG + Intronic
1119309729 14:73635682-73635704 TTCTTCTCTTGGAATAGTGAAGG + Intergenic
1122263149 14:100534616-100534638 TCGTCCTCCTGGAGCAGTGAGGG + Intergenic
1123725421 15:23096603-23096625 TTCCCCACCTGGAAGAGCCAGGG - Intergenic
1125361976 15:38873900-38873922 CTGTCCCCCGGGAAGAGTGAGGG - Intergenic
1126648943 15:50902568-50902590 TTATCTTCCTTGAAGTGTGAAGG + Intergenic
1127689775 15:61384165-61384187 GGCTCCACCTGGAAGAGTGAAGG - Intergenic
1128549883 15:68591248-68591270 TACTCATGCTGGAAGACTGAGGG - Intronic
1128602050 15:69003774-69003796 TTGTCCATCTAGAAGAGTGAAGG + Intronic
1131070452 15:89462428-89462450 AGCTCCTCCTGGTAAAGTGAAGG - Intergenic
1131549428 15:93344243-93344265 TTTTCCTCCTGATAGAGAGATGG - Intergenic
1131761627 15:95629120-95629142 TACTCCTCATGGGACAGTGAAGG - Intergenic
1134210558 16:12272870-12272892 TTCTCATCGTGGAAGAGGAAGGG + Intronic
1134450552 16:14360774-14360796 TTCCCCTCCTGGAAGAGGTGAGG + Intergenic
1134564207 16:15236916-15236938 ATCACCCCCTGGAGGAGTGAAGG - Intergenic
1134738287 16:16519783-16519805 ATCACCCCCTGGAGGAGTGAAGG + Intergenic
1134929213 16:18192380-18192402 ATCACCCCCTGGAGGAGTGAAGG - Intergenic
1135623309 16:23974581-23974603 CCCTCGTCCTGGAAGAGTGCAGG + Intronic
1135949727 16:26902908-26902930 TTCACCGTCTGGAAGAGTGATGG + Intergenic
1138052356 16:53792810-53792832 TTCTCCTCTTGGAAATGTCAAGG + Intronic
1139312100 16:66036161-66036183 TTCTACTACTAGAAGAGAGAAGG - Intergenic
1139344018 16:66290407-66290429 TTCACCTCCTGGCAGAATGTGGG - Intergenic
1139860128 16:70013628-70013650 TTCTCCACCTGGCAGAGTGAGGG - Intergenic
1141754400 16:85981915-85981937 TGCCCCTCCTGGAGCAGTGATGG + Intergenic
1143152723 17:4817222-4817244 CTGCCCTCCTGGAAGTGTGAAGG - Exonic
1143469730 17:7165110-7165132 CTCTCTTCCTGGAAGAGGGCTGG - Intergenic
1143885130 17:10059589-10059611 TTCTCCTCCTGCAGGAGTGGCGG + Intronic
1146773990 17:35596232-35596254 TTCACTTCCGGGAACAGTGAAGG - Intronic
1147298387 17:39503529-39503551 ATCTCCTCATGGAGGAGTAAAGG - Intronic
1147359264 17:39921005-39921027 TTCGCTTCCTGGAAGGCTGAGGG - Intergenic
1148346982 17:46909925-46909947 TCCTCCTCCTGGCAGGCTGAAGG + Intergenic
1151205990 17:72507271-72507293 TTCTCCTCCTGGAAAGCAGAGGG + Intergenic
1152180861 17:78820951-78820973 CTCTCCTACTGCAAAAGTGAAGG + Intronic
1152454277 17:80404083-80404105 TACTCCTTCTGCAAGAGTGAGGG - Intergenic
1153056359 18:950020-950042 TTCTCCTGCTGGGGGAGTGGTGG + Intergenic
1154365682 18:13706581-13706603 TTGCCCTTCTAGAAGAGTGAAGG - Intronic
1155560092 18:27066257-27066279 TACTACACCTGGAAGAGAGAGGG - Intronic
1158154309 18:54408121-54408143 TTCACCTGCTGAAAGTGTGAGGG + Intergenic
1161059677 19:2208639-2208661 CTCTGCTTCTGGAAGAGGGAGGG - Intronic
1163285949 19:16347988-16348010 TTCTCATCCTGGAACAGTTGTGG - Intergenic
1164520307 19:28973750-28973772 TTCTCCACCTGAAAGATGGAAGG - Intergenic
1166088485 19:40492605-40492627 TTCTCCACATGGCAGAGAGAGGG - Intronic
1166774226 19:45302754-45302776 TTCCCCTCCTGTAGAAGTGAAGG - Exonic
1168054511 19:53854570-53854592 ATCTCCTCCTGGAAGCTTGATGG + Intergenic
925607060 2:5670182-5670204 TTCTCCCCCTGGTAAATTGAAGG - Intergenic
926231766 2:11009878-11009900 TTCTCATCCCGGAAGCTTGAGGG + Intergenic
926527036 2:13993364-13993386 TTCTCTTCCTGGAAGAGATATGG + Intergenic
926764889 2:16315578-16315600 TGCTCCTGGTGGAAGCGTGATGG + Intergenic
927297632 2:21472855-21472877 GTCTCCTCATGGAGGAGGGATGG + Intergenic
928452389 2:31388192-31388214 TTCTCCCCCTGGAAGCCTGGGGG - Intronic
928604903 2:32936564-32936586 TTCTTTTACTGGAAGAGTTAGGG + Intergenic
929600558 2:43201743-43201765 GGCTCCTCCAGGAAGTGTGAGGG + Intergenic
930751798 2:54941734-54941756 CTCTCCCCATGGGAGAGTGATGG + Intronic
931459839 2:62441098-62441120 TTCTCCTCCTGGGACAGAGAGGG - Intergenic
934077770 2:88442425-88442447 TTAACCTCCTGGAAGAGTAGAGG - Intergenic
934700473 2:96435737-96435759 TTCTCTTCCTGGTACAGAGAGGG - Intergenic
937213807 2:120297377-120297399 TTCTCCACTTGGAAGGGTGAGGG + Intergenic
939579145 2:143927711-143927733 TTCTCCCCTTGGAAAAATGATGG - Intergenic
940426408 2:153536132-153536154 TCCTCCTGCTGGAAGCATGAGGG + Intergenic
940856503 2:158732406-158732428 GTCCCCTACTGGAAGACTGATGG + Intergenic
941819110 2:169827449-169827471 GGCTCCTCCAGGGAGAGTGAGGG - Intronic
942659549 2:178249888-178249910 CTCTCCTACTGGAAGTGGGAAGG - Intronic
942766068 2:179458667-179458689 TTCTTTTCTTGGTAGAGTGAGGG - Intronic
943799010 2:192034405-192034427 TTTTCCCCATGGAGGAGTGATGG - Intronic
943801660 2:192067324-192067346 TTCTCCTGGAGGAAGAGGGATGG + Intronic
944752159 2:202721106-202721128 CTCTCCTCATGGAAGAGGGGAGG - Intronic
944918056 2:204381328-204381350 TTCTGCTCATGGAAGGTTGAGGG + Intergenic
944934026 2:204548675-204548697 TTTTGCTTCTGGAATAGTGATGG + Intronic
945269495 2:207924293-207924315 ATCTCCTCAAGGAAGAGTGCTGG + Intronic
946082154 2:217130379-217130401 TTCTCCTCCTGGAGGACGGAGGG + Intergenic
946093693 2:217253171-217253193 TTTTCCTGCTGGAAGTGAGAAGG + Intergenic
946156100 2:217807834-217807856 TTCTAACCCTGGGAGAGTGAAGG + Intronic
948317766 2:237042260-237042282 TTCTCCTCCTGGAGTAGGAATGG - Intergenic
1168942995 20:1729343-1729365 TACTCCTTTTGCAAGAGTGAGGG + Intergenic
1169560706 20:6797822-6797844 ATCCCCACCTGGCAGAGTGAAGG - Intergenic
1169695006 20:8377400-8377422 TTCTTCTGATGGAAGAGGGAAGG + Intronic
1169988738 20:11474981-11475003 TTCTCCTTGAGGAAGAGAGAGGG + Intergenic
1170398764 20:15957695-15957717 GTCTCCTCTGGGAAGTGTGAGGG + Intronic
1170520045 20:17175540-17175562 TTCTCCTGCTTGAAAAGTCATGG - Intergenic
1172995427 20:39066798-39066820 TTTTCCTTTTGGATGAGTGATGG + Intergenic
1173655179 20:44695323-44695345 TTATTCTACTGGAGGAGTGAGGG - Intergenic
1173681700 20:44886345-44886367 GGCTCCTCCTGGATGAGTAAGGG + Intronic
1179260774 21:39756735-39756757 GTATCCTCCTGGAAGATTCAGGG - Intronic
1179422948 21:41250592-41250614 TTAGTCCCCTGGAAGAGTGACGG - Intronic
1180639538 22:17287276-17287298 ACCTCCTCCTGGAAGAGTCCTGG + Intergenic
1181599113 22:23938517-23938539 TTCTCTTCCTGGTAAAGGGAGGG + Intergenic
1182121002 22:27786710-27786732 CCCTCCTCCTGGACGAGTGATGG + Intronic
1182550771 22:31099763-31099785 TTCTCCTCCAGCTGGAGTGATGG + Exonic
1183226570 22:36554233-36554255 TCCTCCTCCTGGAAGTGGGCCGG + Intergenic
1183330013 22:37214337-37214359 TCCTCCTCCTGGCATAGGGAGGG - Intergenic
1183722440 22:39570582-39570604 TAATCCTCATGCAAGAGTGAGGG + Intergenic
1183803714 22:40190737-40190759 TTCTCCTTTTCGAAGAGTGCTGG + Intronic
1184077796 22:42194383-42194405 TTCGCCTCCTGGCAGGGCGAGGG - Intronic
949338308 3:3001309-3001331 TCTTTCTCCTGGAAGAGTGAAGG - Intronic
950702006 3:14757356-14757378 TGCTCCTCCTTGCAGAGGGAAGG + Exonic
951187212 3:19727649-19727671 ATGTCCTTGTGGAAGAGTGAAGG - Intergenic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
951762472 3:26161754-26161776 TTGTCCTTTTGCAAGAGTGAGGG + Intergenic
953658349 3:44871776-44871798 TTCTGCTGCAGGAAGAGGGAAGG + Intronic
953900458 3:46838092-46838114 GTCTACTGCTGGAAGAGTGAGGG + Intergenic
955648489 3:61166847-61166869 TTTCCATCCTGGAAGTGTGAGGG + Intronic
957434849 3:80161480-80161502 TCCTACTCTTGGAAGAGTCAGGG - Intergenic
958749873 3:98182862-98182884 TTCTTTCCCTGGAAGATTGAGGG + Intronic
962899470 3:139746559-139746581 TTCTCCTGCTGGAAACATGAGGG - Intergenic
965892428 3:173530387-173530409 TTGTCGTCCTGGAAGAGAGAGGG + Intronic
965957036 3:174383118-174383140 TTCTCTTCCTGGAACTGAGAGGG + Intergenic
966398146 3:179522521-179522543 TACTCCTTTTGCAAGAGTGAGGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
966933380 3:184690301-184690323 TCCTCCTCCCGGAGCAGTGAAGG + Intergenic
967290358 3:187913816-187913838 TGCTGTGCCTGGAAGAGTGAGGG - Intergenic
969433918 4:7173082-7173104 CTCTGCTCATGGCAGAGTGAGGG + Intergenic
970721404 4:18993437-18993459 TTCTCTTCCTGGTATAGAGAGGG + Intergenic
971196761 4:24477521-24477543 TGACCCTCCTGGAAGTGTGAGGG + Intergenic
971319661 4:25595204-25595226 TTCTCTTCCTGGATTAGAGAGGG + Intergenic
971773900 4:30934869-30934891 TTCTCTTTCTGGAAATGTGATGG - Intronic
972404738 4:38734909-38734931 TTTGCCTCCTGGTAGAATGATGG + Intergenic
972618391 4:40722451-40722473 CTGTGCTCCTGGAACAGTGAAGG + Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
973866593 4:55120264-55120286 TTACCCTCCTGGAAGAGTGCTGG - Intronic
976287221 4:83382410-83382432 TTCTCCTCCTGGTGCAGAGAGGG + Intergenic
976322733 4:83734143-83734165 TTCTCTTCCTGGTACAGAGAGGG - Intergenic
976976587 4:91172720-91172742 TTTTCCTCCTAGAAGAGTAGTGG + Intronic
977111537 4:92962643-92962665 TTCCCCTGCTGGAAGCATGAAGG + Intronic
978266248 4:106829242-106829264 TTCTCCTCCTGAAAGACTTTTGG + Intergenic
979493983 4:121363775-121363797 TTCTCTTAGTGAAAGAGTGAAGG - Intronic
980110544 4:128632228-128632250 TTCTCCCCCTCAAAGAGTGCTGG + Intergenic
983056343 4:163102456-163102478 TACTCCTTTTGCAAGAGTGAGGG + Intergenic
984321242 4:178199082-178199104 TTCTTCTGCTGGAAGCATGAAGG - Intergenic
984835112 4:184012058-184012080 TTCTCCTCCTGCAGAAATGACGG + Intronic
985805452 5:2039558-2039580 TTTTCTGCCTGGCAGAGTGATGG + Intergenic
986638505 5:9848974-9848996 TTCTTCTCATGGAAGTGTCAAGG - Intergenic
987858247 5:23449476-23449498 TTCTCTTCCTCGTAGAGTAATGG - Intergenic
989100944 5:37822361-37822383 TTCTGTGCCTGGAAGGGTGAGGG + Intronic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
990435832 5:55790663-55790685 TGCTACTCCTGGAAGACTGATGG + Exonic
990902025 5:60761928-60761950 TTCTCCTTCTGTAAGATCGAAGG + Intronic
991114678 5:62940481-62940503 TTCTTATCCTGTAAGTGTGAGGG - Intergenic
991949040 5:71930223-71930245 TTCTCCTCCTGGTGCAGAGAGGG + Intergenic
991960167 5:72036460-72036482 TTCTCCTACTGGAGGTGAGATGG - Intergenic
994591922 5:101784201-101784223 TTCTCCTCCTGGGGAAGTGAAGG + Intergenic
994994912 5:107048471-107048493 TTCTCTTGGTGGAAGAGGGATGG + Intergenic
996116564 5:119626852-119626874 TTCTGATCCTTGAAGAGTCAGGG - Intronic
996726289 5:126675608-126675630 TCCTCCTCCTGGAGGAGCCAGGG + Intergenic
998584866 5:143416685-143416707 TGCTCCTTCTGGAAGAGACAGGG + Intronic
999896886 5:156043981-156044003 TTCTCCCCCTAGAAGATTGTAGG - Intronic
1000195416 5:158952431-158952453 TTGTCCTCCTGGTACAGTGATGG + Intronic
1000423671 5:161065310-161065332 TTCTCCTCCTGTAAAATAGAAGG - Intergenic
1000552769 5:162687166-162687188 AGCTTCTCCTGGAAGAGAGAAGG + Intergenic
1001020022 5:168174860-168174882 TCCTCCTCCTTCAAGAGTGTTGG + Intronic
1001079057 5:168653583-168653605 TTCTGCTCCTGAAATAGGGAGGG + Intergenic
1001554207 5:172625172-172625194 CTCTCTTCCTGGAAGACTGTGGG - Intergenic
1003503758 6:6723757-6723779 TTCTGCCCCCGGAAGGGTGATGG - Intergenic
1003911678 6:10749076-10749098 TTATCCTCATGGTACAGTGAAGG + Intronic
1004488674 6:16093020-16093042 TTCTCCTACTGTAAGAGGGCAGG - Intergenic
1004952456 6:20689165-20689187 TTCCCCTACTGGAAGCATGAGGG + Intronic
1005409577 6:25529226-25529248 TTCTACCCATGGAAGTGTGAAGG - Intronic
1006562615 6:34926705-34926727 TTCTCCTCCTGGAAGAGTGAGGG - Intronic
1011670074 6:89674771-89674793 TACTTCTCCTGAAAGACTGAGGG - Intronic
1011715352 6:90099221-90099243 TTCTCCTCCAGGAGAAGTGTGGG + Intronic
1012549970 6:100457164-100457186 TCCTCTTCCTGTCAGAGTGAGGG - Intronic
1013070452 6:106724311-106724333 TTTTACAACTGGAAGAGTGATGG + Intergenic
1015263775 6:131268202-131268224 CTCTCATCCTGGGAAAGTGAAGG - Intronic
1016513449 6:144868730-144868752 TTCTCTTCCTGGTACAGAGAGGG + Intergenic
1017523092 6:155219406-155219428 TGCCCCTCCTGGAAGAGAGGCGG + Intronic
1019483150 7:1275385-1275407 TTCTCCTCCTGGCACTTTGAGGG + Intergenic
1019521797 7:1464028-1464050 TCCTCTCCCTGGAAGAGTGGAGG - Intergenic
1020003783 7:4771049-4771071 GTCTCACCCTGGAGGAGTGAAGG + Exonic
1021077312 7:16320919-16320941 TACTGTTTCTGGAAGAGTGATGG - Intronic
1021140068 7:17013338-17013360 TTCTCCTACTTGAGGAGTAAAGG + Intergenic
1021620790 7:22549771-22549793 TTCTCATCCTGGGATAGCGAGGG + Intronic
1022617966 7:31951876-31951898 ATCTCCTTGTGGAAGAGGGAAGG - Intronic
1022823488 7:33984614-33984636 TTATCCTCCTGGTAGATGGAAGG + Intronic
1023971151 7:44991987-44992009 TTCTCTTCCTGGTACAGAGAGGG + Intergenic
1024522522 7:50318408-50318430 TTCTCCCCGTGTAAGAGTGCTGG + Intronic
1024702871 7:51923749-51923771 TTCTCCTGTTGGAGCAGTGAGGG + Intergenic
1027001221 7:74656083-74656105 TTCTCCACCTGGAGGGGTCAGGG - Intergenic
1027826098 7:83118525-83118547 TTCTACCCTTGGAAGAGGGAGGG + Intronic
1027900023 7:84100992-84101014 TTCTCCTACAGGATGAGAGATGG - Intronic
1029686717 7:102153493-102153515 TGCTGCTCCCGGAAGAGTCAAGG + Intronic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1029906722 7:104100373-104100395 TTCTTCTTCAGGAAGAGTGCAGG - Intergenic
1030196077 7:106855082-106855104 TTCTCCTCCTGCAAGATGGCAGG - Intergenic
1031742511 7:125452683-125452705 GTATCCTCCTAGAACAGTGAAGG + Intergenic
1032962701 7:137056951-137056973 TTCAGCTCAAGGAAGAGTGAAGG - Intergenic
1035094923 7:156346338-156346360 TCTTCTTCGTGGAAGAGTGAAGG - Intergenic
1035149327 7:156854465-156854487 TTTTCCTGCTGGAAGCTTGAAGG - Intronic
1037297226 8:17413639-17413661 GTGGCCTCCTGGAAGAGAGATGG + Intergenic
1038863970 8:31418711-31418733 TTCCCCTCTTGGCAGAGTGGTGG + Intergenic
1038905157 8:31893372-31893394 TTCTCCTTATAGTAGAGTGAAGG + Intronic
1039817969 8:41111405-41111427 ATGCCCACCTGGAAGAGTGAGGG - Intergenic
1040402721 8:47068473-47068495 ATGCCCTCCTAGAAGAGTGAAGG - Intergenic
1040717825 8:50279922-50279944 TTCTCTTCCTGGAGCAGAGAGGG + Intronic
1040793966 8:51269114-51269136 TTCTCCTGCTGGAAGTATGAGGG + Intergenic
1041182349 8:55261944-55261966 TCCACGTCCTGGAAGAGAGATGG + Intronic
1042737059 8:72001281-72001303 TTCCCCTCCTGGAGGAGCCAGGG + Intronic
1043799027 8:84583669-84583691 TTATATTTCTGGAAGAGTGAAGG + Intronic
1044903687 8:96976470-96976492 TTCTACTTCTTGAAGAATGATGG - Intronic
1045683636 8:104688935-104688957 TTCTCTTCCTAGAAAAGAGAAGG + Intronic
1045697559 8:104827256-104827278 TTCTCTTCCAGCAAGAGTAAAGG - Intronic
1047510337 8:125511038-125511060 TCCTCCTCCAGGAAGATGGAAGG - Intergenic
1048309229 8:133305515-133305537 TTCTAATCCTGGATGAATGAGGG - Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1052276090 9:26678362-26678384 CTCTGCTCCTGTAACAGTGAAGG + Intergenic
1052574984 9:30280581-30280603 TTCTACTCCTTCAGGAGTGAAGG - Intergenic
1055281107 9:74675734-74675756 AGCTCCTCCTGGAAGACTGACGG - Intronic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1056558914 9:87712514-87712536 TTCTCCTCAGGGTAGAGAGAAGG + Intergenic
1057058699 9:91983883-91983905 TTCTCTTCCTGGTACAGGGAGGG - Intergenic
1057439087 9:95069268-95069290 TTCACCTCCAGGGAAAGTGAGGG + Intronic
1057716881 9:97502253-97502275 TTCTCCGCCTGCAAGAGTCTGGG + Intronic
1059217707 9:112581611-112581633 TTCACTTCCTGGATGAGTGAGGG - Intronic
1060918055 9:127402988-127403010 TTCTCTTCCTGGGACAGTAAGGG - Intronic
1062145573 9:134987971-134987993 ATCTCCTCCTTGAGTAGTGACGG + Intergenic
1186321181 X:8426964-8426986 TTCTCCTCCTCAAGGACTGAGGG - Intergenic
1186504876 X:10083236-10083258 TTGTGCTCCTGGAAGAGAGGCGG + Intronic
1189664857 X:43343327-43343349 CTCTCCTCCTGGTATAGAGAGGG - Intergenic
1191609718 X:63100048-63100070 TCCCCCTCCTGGGAGAGAGAGGG + Intergenic
1194920380 X:99758295-99758317 TTCTGCTCCAGGAGGAGAGAGGG + Intergenic
1195177376 X:102323773-102323795 TGCTGCTCCTGGGAGAGGGAGGG - Exonic
1195181488 X:102363320-102363342 TGCTGCTCCTGGGAGAGGGAGGG + Exonic
1195291730 X:103436631-103436653 CTCCTCTCCTGGAAGAGTAATGG + Intergenic
1195826019 X:109001629-109001651 TTCCCCTGCTGGAAGCATGAAGG - Intergenic
1198706975 X:139460339-139460361 TTCTCCTTCTGGACAAGTGTTGG - Intergenic
1199293300 X:146129409-146129431 TTCCCCTGCTGGAAGCATGAGGG + Intergenic
1199866415 X:151853837-151853859 GCCTTCTCCTGGAAGAGGGATGG + Intergenic
1201146783 Y:11069081-11069103 TTCCCATGCTGGAAGAGTGCTGG - Intergenic
1202590962 Y:26482672-26482694 TGCTCCTCCTGACAGATTGAGGG + Intergenic