ID: 1006562888

View in Genome Browser
Species Human (GRCh38)
Location 6:34928798-34928820
Sequence CAGAGCTGCCATTTTCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006562884_1006562888 -10 Left 1006562884 6:34928785-34928807 CCCTTCAGTTAGCCAGAGCTGCC 0: 1
1: 0
2: 3
3: 10
4: 174
Right 1006562888 6:34928798-34928820 CAGAGCTGCCATTTTCAAGGTGG No data
1006562883_1006562888 -4 Left 1006562883 6:34928779-34928801 CCATCTCCCTTCAGTTAGCCAGA 0: 1
1: 0
2: 0
3: 20
4: 173
Right 1006562888 6:34928798-34928820 CAGAGCTGCCATTTTCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006562888 Original CRISPR CAGAGCTGCCATTTTCAAGG TGG Intronic
No off target data available for this crispr