ID: 1006564503

View in Genome Browser
Species Human (GRCh38)
Location 6:34943249-34943271
Sequence AACCTAAAACTGCTGTAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006564503 Original CRISPR AACCTAAAACTGCTGTAGGC CGG (reversed) Intronic
903769184 1:25753406-25753428 ACCCCAGAACTGCTGCAGGCAGG - Intronic
905129875 1:35746239-35746261 AACTTAAGACTACTTTAGGCCGG - Intronic
905782992 1:40728932-40728954 ATCCAAAAACTGATGGAGGCTGG - Intronic
908334680 1:63109511-63109533 GACCTAAAACTGCGGAAGCCTGG + Intergenic
910382419 1:86642962-86642984 AACAGAAAAATGTTGTAGGCTGG + Intergenic
916219476 1:162429173-162429195 AAAAAAAACCTGCTGTAGGCCGG - Intergenic
920039856 1:203088553-203088575 AAGCCAAAACTGCTGAAGACTGG + Intergenic
923412602 1:233725129-233725151 AGTCAAAAACTGCTGCAGGCTGG + Intergenic
1064035904 10:11913187-11913209 AACCTTAGACTGCTGTACGCAGG + Intergenic
1067412970 10:46080745-46080767 ATCCTGGAACTGGTGTAGGCTGG + Intergenic
1067877073 10:50016658-50016680 AAAATTAAACTGCTGCAGGCCGG + Intergenic
1075283155 10:121158683-121158705 AAAATAAAACTGCCGTAGCCAGG + Intergenic
1079288723 11:19166020-19166042 AAGCAAACACTGCTCTAGGCTGG - Intronic
1079435321 11:20441768-20441790 AACCTGAAACTATTGTAGGTAGG - Intronic
1081967244 11:47177315-47177337 AACCGAGAACGGCTGAAGGCTGG - Intergenic
1086213716 11:84351774-84351796 AACCTAAATCTGCTGAAGCAAGG - Intronic
1091756236 12:3054012-3054034 AACTGAAAAGTGCTGTAGTCAGG - Intergenic
1093129497 12:15372910-15372932 GGACTAAAACTGGTGTAGGCAGG + Intronic
1098216337 12:68224166-68224188 AAGCTACAACTGCAGGAGGCTGG + Intronic
1098656388 12:73035603-73035625 AACCTAAAACTGCTCTAAAAAGG - Intergenic
1100912298 12:99378722-99378744 ATTCTAGAACTGCTATAGGCAGG + Intronic
1101006470 12:100405848-100405870 AAACTAACACAGCGGTAGGCAGG + Intronic
1109217638 13:59608034-59608056 CACCAAAAACTGCCCTAGGCAGG + Intergenic
1109594290 13:64529994-64530016 CACCTAAAACTTCTATAGGGAGG + Intergenic
1109864065 13:68239390-68239412 AACTTTAAAAAGCTGTAGGCCGG + Intergenic
1112469054 13:99671481-99671503 AATAGAAAACTACTGTAGGCTGG + Intronic
1114597157 14:23923244-23923266 AAAGTCAAAGTGCTGTAGGCTGG + Intergenic
1116897040 14:50326742-50326764 AACCTAACATTGCTTTAGGCTGG + Exonic
1116915110 14:50517446-50517468 AACTTAAAAATATTGTAGGCTGG - Intronic
1121903804 14:97721461-97721483 AACCTAATATTTCTGGAGGCTGG + Intergenic
1123705166 15:22945877-22945899 AATAAAAAAATGCTGTAGGCTGG - Intronic
1126140237 15:45431623-45431645 AACTTGAAACTGTTGGAGGCTGG + Intronic
1126511291 15:49477828-49477850 AAACTAACAGTGCTGTATGCTGG - Intronic
1126648183 15:50895632-50895654 AAATTAAAACTGCTTTAGGAGGG - Intergenic
1130309067 15:82736904-82736926 AACCTAAAAATGCTGAAGGCTGG + Intergenic
1130342729 15:83012865-83012887 CCACTAAAACTGCTGTAGCCCGG - Intergenic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1132657072 16:1045867-1045889 TACCTAACACTGCTGCAGGGAGG + Intergenic
1135343073 16:21665178-21665200 AACCTAAAACTCCAGGTGGCAGG - Intergenic
1135892006 16:26365783-26365805 AACATAGAACTGCTGGAGGAAGG + Intergenic
1136589285 16:31207721-31207743 GACCTGAAACTGCTGCAGGAGGG - Intergenic
1137280097 16:46969260-46969282 AACTTAAAACTGTTGTAGGCAGG + Intronic
1148924383 17:51070555-51070577 AACCAAAAACTTCTGTTGGTTGG - Intronic
1151228454 17:72664353-72664375 CACATAAAACTGCAGAAGGCAGG + Intronic
1158965871 18:62621841-62621863 CACCCAAAACTGATGTAGACGGG + Intergenic
1163639870 19:18456150-18456172 CACCTCAAACTGCTCTTGGCAGG - Intronic
1163753619 19:19093310-19093332 AATCTAAAACTGCTCTCAGCTGG - Intronic
1167875060 19:52405232-52405254 AACCCAAAACTACAGTAGGTTGG + Intronic
925709202 2:6721547-6721569 AACCCAAAGCTGCTCTGGGCTGG - Intergenic
926334547 2:11853469-11853491 AGCCTAAAACTGTGGCAGGCAGG + Intergenic
927197172 2:20555986-20556008 AAGGTAAAAGTGCTGTAGACAGG + Intergenic
929498015 2:42463638-42463660 AAATCAAAACTGCTATAGGCAGG - Intronic
931097008 2:58952020-58952042 TGCCGAAAACTGCTGAAGGCTGG + Intergenic
933537015 2:83588499-83588521 AACCAAAAAATACTGAAGGCAGG + Intergenic
947576501 2:231279128-231279150 GACCTGAAACTGATGTATGCTGG - Intronic
1171333505 20:24361828-24361850 AACAAAAAACTGATGTAAGCTGG - Intergenic
1172664656 20:36590853-36590875 AATCTAAAACAGCTATGGGCTGG - Intronic
1173908230 20:46644317-46644339 AACCTCATACTGCTGTGGGGAGG - Intronic
1176702273 21:10069757-10069779 ATACTAAAAGTGTTGTAGGCTGG - Intergenic
1177879800 21:26678714-26678736 AACCTAAAACTGCCATACGCTGG + Intergenic
1177914682 21:27074217-27074239 AACCTCAAACTGCTGGACTCAGG - Intergenic
1178140335 21:29675756-29675778 GAGCTAAGACTGCTGGAGGCTGG + Intronic
1182228813 22:28820888-28820910 AACAAAAAACTGCTTTGGGCTGG + Intergenic
1182497936 22:30723738-30723760 AATCTAAAACTGCTGTAAATAGG - Intronic
1183706851 22:39479480-39479502 AACCTAAACCTGCTGTGGGGAGG - Intronic
956400780 3:68877539-68877561 GACCTAAATCTGCTGTAGAGAGG - Intronic
961020357 3:123500859-123500881 AACATATACCTGCTGTAGGCTGG - Intronic
961185146 3:124908268-124908290 AATCTAAAACTGCGGTCGACAGG - Exonic
962707312 3:138057383-138057405 AAAGTAAAACTTCTGTAGTCAGG + Intergenic
965424269 3:168501984-168502006 AACCTAAAAATGGTCTAGCCAGG - Intergenic
972498829 4:39658712-39658734 AAACAAAAAAAGCTGTAGGCCGG - Intergenic
972963905 4:44486490-44486512 CACCTACAACTGCTGAAGGAGGG - Intergenic
978318658 4:107468510-107468532 AAACTGAAATTGCTATAGGCAGG - Intergenic
980374448 4:131926173-131926195 ATACTAAAAGTGCTGTAGGCTGG - Intergenic
981907735 4:149942079-149942101 AACCTAAAAGTTCTTTAGTCTGG + Intergenic
984029464 4:174585565-174585587 TACATAGAACTGATGTAGGCTGG - Intergenic
984317429 4:178144413-178144435 AACATAAAACTGCTGTAAAAAGG + Intergenic
985551166 5:534363-534385 AACCTCAACCTCCTGCAGGCGGG + Intergenic
989134952 5:38144536-38144558 TACCTAAACCTACTCTAGGCTGG + Intergenic
989430267 5:41346175-41346197 AACTAGAAACTGCTCTAGGCTGG - Intronic
990012315 5:51014481-51014503 AACCTCAATCTTCTGTTGGCAGG - Intergenic
995238064 5:109852956-109852978 AAAATAACACTGCTGGAGGCTGG - Intronic
1002231494 5:177768016-177768038 GACCTACAACTGATGTAGGGAGG - Intronic
1002263845 5:178015732-178015754 GACCTACAACTGATGTAGGGAGG + Intronic
1002889825 6:1322983-1323005 AACCTAAAAATGCAATAGCCTGG + Intergenic
1003137391 6:3444290-3444312 AACCTTAATCTTCTGCAGGCTGG - Intronic
1003854521 6:10259454-10259476 AACCTAAAACTGCTCTACAAAGG + Intergenic
1004966862 6:20861839-20861861 AAGCTAAAATTTCTGTGGGCTGG - Intronic
1006564503 6:34943249-34943271 AACCTAAAACTGCTGTAGGCCGG - Intronic
1006686839 6:35842297-35842319 CACCTAAAACTTCTGTGTGCTGG - Intronic
1008384658 6:50875160-50875182 AACCTAAAATAGCTGAAGACTGG + Intergenic
1009972839 6:70643199-70643221 AACGTAAAACTAGTTTAGGCTGG - Intergenic
1010971651 6:82269307-82269329 TAACTAAAACTGCTTTAGGCAGG + Intergenic
1012179570 6:96135461-96135483 ATACTCAAACTGCTTTAGGCTGG + Intronic
1014142566 6:117961314-117961336 AAGCTAGAACTACTGCAGGCAGG + Intronic
1016076297 6:139800352-139800374 ATCCTAACACAGCTGTAGGCAGG - Intergenic
1016588036 6:145711327-145711349 AACGTAGAACTTTTGTAGGCTGG - Intronic
1017266056 6:152448299-152448321 ACCCCAGAACTGCTGTAGGGAGG - Intronic
1017782005 6:157722556-157722578 TTGCTAAAAATGCTGTAGGCTGG - Intronic
1021068495 7:16207581-16207603 TACATAAAACTGCTGCAAGCAGG + Intronic
1022202804 7:28134040-28134062 AACCCAAACTTCCTGTAGGCAGG + Intronic
1024144299 7:46496528-46496550 AACCTAAAACTGCTCTATAAGGG + Intergenic
1034205369 7:149309924-149309946 AACCTACAAATGTTGGAGGCAGG + Intergenic
1034250732 7:149688519-149688541 AACCTAACAATGCCATAGGCTGG - Intergenic
1035098327 7:156375360-156375382 ACCATAAAACTGTTATAGGCAGG - Intergenic
1037233955 8:16694531-16694553 AACCTCAAACGGCTATAGGTAGG + Intergenic
1038055649 8:23855207-23855229 AGAGTAAAACTGCTGTAAGCAGG - Intergenic
1039714268 8:40091139-40091161 AATCTAAAACTGTTGTAAACAGG - Intergenic
1039865446 8:41497108-41497130 AACATAAAAATGCAGTAAGCTGG - Intronic
1041988283 8:63953766-63953788 CTCATAAAACTGCTGCAGGCTGG + Intergenic
1042165912 8:65946126-65946148 AACCTGAAACTGCTCTAGTCTGG + Intergenic
1044888230 8:96803160-96803182 AACCAAAAAATGCTGAGGGCAGG + Intronic
1045581292 8:103483259-103483281 AACCGAAAAATGATGTAAGCAGG - Intergenic
1046408275 8:113803656-113803678 ATCCTTAAACTGCTGTAATCTGG - Intergenic
1048234718 8:132678288-132678310 AACCTAACAATGCTGTACACTGG + Intergenic
1048415604 8:134224742-134224764 AACCTCAAACTGCAGCAGGTAGG - Intergenic
1048481955 8:134805462-134805484 AACCTAAATCAGCTGGAGACAGG - Intergenic
1052500021 9:29276791-29276813 TAATTAAAAATGCTGTAGGCTGG - Intergenic
1053393981 9:37755622-37755644 AAGCTAACACTCCTGAAGGCGGG - Intronic
1053639420 9:40056155-40056177 ATACTAAAAGTGCTGTAGGCTGG - Intergenic
1053766659 9:41408954-41408976 ATACTAAAAGTGCTGTAGGCTGG + Intergenic
1054320222 9:63652814-63652836 ATACTAAAAGTGCTGTAGGCTGG - Intergenic
1054545327 9:66320464-66320486 ATACTAAAAGTGCTGTAGGCTGG + Intergenic
1057984220 9:99693431-99693453 AAATTAAAGCTGCTGGAGGCAGG - Intergenic
1060846392 9:126840931-126840953 AACTTAAAACTGCTGTGGTCGGG + Intergenic
1060846549 9:126842142-126842164 AACTTAAAACTGCTCTGGTCAGG - Intergenic
1190290346 X:48988319-48988341 AACCTGAGATTGCTGTTGGCTGG - Intronic
1191864144 X:65690414-65690436 AACCCAAAAGTGCTGGAGGAAGG + Intronic
1192295615 X:69844621-69844643 AACCTAAAACTGTTGAGGGATGG - Intronic
1201713517 Y:17017932-17017954 AAACAACAACAGCTGTAGGCAGG + Intergenic