ID: 1006565009

View in Genome Browser
Species Human (GRCh38)
Location 6:34948605-34948627
Sequence AGGAAGCTAGAGCACTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 1, 2: 1, 3: 9, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006565009 Original CRISPR AGGAAGCTAGAGCACTTTGA GGG (reversed) Intronic
900421853 1:2559180-2559202 AGGAAGCTGGAGTGCTTTGGGGG + Intronic
901972189 1:12917152-12917174 AGTATTCTAGAGCACTTGGAAGG - Intronic
901989238 1:13099099-13099121 AGTAGTCTAGAGCACTTGGAAGG + Intergenic
901992575 1:13127665-13127687 AGTAGTCTAGAGCACTTGGAAGG - Intergenic
902012989 1:13284610-13284632 AGTATTCTAGAGCACTTGGAAGG + Intronic
902852134 1:19167580-19167602 AGGAACCTGGATCACTTTTAGGG + Intronic
903467484 1:23562040-23562062 AGGAAGCAAGTGCCCTTTAATGG + Intergenic
904964004 1:34357630-34357652 AGGAGACTAGAGCACCTTGCGGG + Intergenic
907023604 1:51093899-51093921 AGGAAATTAAAACACTTTGAGGG + Intergenic
910682319 1:89879793-89879815 ATGAAGCTAGCACACTGTGATGG - Intronic
911774601 1:101792190-101792212 GGGAAGCAAGAGAACTCTGACGG - Intergenic
913518037 1:119621973-119621995 ATGAAGCTAGAGTATTTTCAAGG + Exonic
914823850 1:151126884-151126906 AGGAACCTAGAGTTCTCTGATGG + Intergenic
917321077 1:173781833-173781855 AGGAAGTGAGAGCAGTTTGGAGG + Intronic
917961102 1:180145385-180145407 AGGAAGCAAGAGAACTTCAAGGG - Intergenic
918127878 1:181600234-181600256 GGGAGGCTTGAGCACTCTGAGGG + Intronic
919077495 1:192831034-192831056 TGGAAGGTAGAGCACATTGGAGG + Intergenic
920391748 1:205608314-205608336 AGGATGCAAAAGCACTTTGAGGG - Exonic
923654948 1:235907891-235907913 AGGAAGTTAAAGCACTGAGATGG - Intergenic
1064772909 10:18742654-18742676 AGGATGCTAAAGCAATTTCATGG + Intergenic
1067735294 10:48845852-48845874 AGGAAGCTGGAGCACAGTGCTGG - Intronic
1068341681 10:55712330-55712352 AGAAAGCTAGAGAACTTAGTAGG - Intergenic
1068952453 10:62790794-62790816 CAGGAGCTAGAGCATTTTGAGGG + Intergenic
1070069915 10:73078118-73078140 AAGAAAATAGAGCACTTTTAAGG + Intronic
1071882790 10:89917768-89917790 AGGAAGCCAGGGCACTTTCCTGG + Intergenic
1072945455 10:99805937-99805959 AGGCAACTGGAGAACTTTGATGG - Intronic
1073211631 10:101808342-101808364 AGGAGGCTAGGCCACTTTGTTGG - Intronic
1073895349 10:108150002-108150024 ATGAAACTACAGCATTTTGAAGG + Intergenic
1076171226 10:128321735-128321757 AGAAAGTTAAAACACTTTGATGG - Intergenic
1081863008 11:46345029-46345051 AGGAAGAGAGCGCTCTTTGAGGG + Intronic
1084978544 11:72816299-72816321 AGAAAGCTAGAGCCCTTGGAGGG + Intronic
1085577456 11:77619774-77619796 AGGAAGCTAGTGCCCTCTGCTGG + Intronic
1088402034 11:109431855-109431877 AGGAAGCCAGAGTACTTTGAGGG - Intergenic
1089337336 11:117734285-117734307 AGGAAGCAAGAGCACTTACGGGG + Intronic
1089418333 11:118312419-118312441 AGGGAACTAGAGAACCTTGAAGG - Intronic
1090233357 11:125126545-125126567 TTGAGGCTAGAGCACTATGAGGG - Intergenic
1093612269 12:21175768-21175790 AGGAAATTAGAGGACTCTGACGG - Intronic
1100631284 12:96391829-96391851 AGCAATCTAGAGCAGTTTGTAGG - Intronic
1102484823 12:113248463-113248485 AGGAAGCCTCAGCGCTTTGAGGG + Intronic
1102545904 12:113655279-113655301 AGGAAGCTGGAGATCTCTGAAGG + Intergenic
1111014184 13:82355616-82355638 AGAAAGGTAGAGGAATTTGAAGG - Intergenic
1111645560 13:91027713-91027735 AGTAAGATGGAGGACTTTGAGGG + Intergenic
1114082030 14:19209684-19209706 AGGAAGGTAAAGCATTTTCAGGG + Intergenic
1114860235 14:26509476-26509498 ATGAAGCTTGAGAACTTTGGAGG - Intronic
1117448360 14:55826795-55826817 AGGAAGGGAGCCCACTTTGAAGG - Intergenic
1118827482 14:69397599-69397621 AGCAGGCTAGAGCATTTGGAGGG + Intronic
1122344941 14:101052619-101052641 AAGAAGCTAGTGCACTGCGATGG - Intergenic
1122881210 14:104691239-104691261 AGGAAGTAACTGCACTTTGATGG - Intronic
1124087220 15:26562280-26562302 AGGAAGCAAGACAGCTTTGAGGG + Intronic
1125161215 15:36646763-36646785 AGGAAAATAGAGCATTTTAAAGG + Intronic
1129160883 15:73747082-73747104 AGGAAGCCAGAGCAGCTGGAGGG - Intronic
1129380837 15:75165113-75165135 AGGAAGTTAGAGAACTTAGGGGG + Intergenic
1130182626 15:81645852-81645874 TGGAAGTTGGAGCACTTTCACGG - Intergenic
1130566572 15:85001272-85001294 ATGAAGGTAGAGCACTAAGAAGG + Intronic
1131123467 15:89838028-89838050 AGGAGGCTGAAGCACTTTAAAGG - Intronic
1133596571 16:7299434-7299456 AGAAAGCTAGAGGAGTTTGAGGG + Intronic
1135552613 16:23409684-23409706 GGGAAGCCAGAGCCCCTTGAAGG + Intronic
1136376389 16:29867950-29867972 ATGAATCCAGAACACTTTGAAGG - Intergenic
1138957296 16:61986523-61986545 AGGAAGAATGCGCACTTTGAGGG + Intronic
1140661060 16:77191562-77191584 AGGAAGCTAGAGAAGGTGGAGGG + Exonic
1140921237 16:79540607-79540629 GGGAAGCCAGACCACTTTGCTGG + Intergenic
1144058913 17:11564187-11564209 TAGGAGCTAGAGAACTTTGAGGG + Intergenic
1146499803 17:33354589-33354611 AGGAACCCAGAGCACATAGAAGG - Intronic
1147170055 17:38613056-38613078 AGAAAACTAGAGGGCTTTGAAGG - Intergenic
1147813905 17:43194501-43194523 TGGAAGATTCAGCACTTTGAAGG + Intronic
1147982795 17:44285078-44285100 AGGAAGCAAGAAAACTTTCAAGG + Intergenic
1148144583 17:45355022-45355044 AAGAAGGTAGGGCATTTTGATGG + Intergenic
1154039596 18:10841268-10841290 AGTAAGCTTGAGCAATTTTAGGG - Intronic
1155914094 18:31539081-31539103 ACCACACTAGAGCACTTTGAGGG + Intronic
1159654436 18:71014909-71014931 AGGTAGCAAGAGAACTTTGGAGG - Intergenic
1165790702 19:38489999-38490021 AGGAAGCAAGAGAAGTTTCAAGG + Intronic
926004991 2:9366541-9366563 AGGAAGCTAATGCCCTGTGAAGG - Intronic
927024259 2:19049343-19049365 AGGATGCTGTAGCACTTGGAAGG - Intergenic
927518236 2:23684484-23684506 AGGAAGCTAGAACATTTTGGTGG - Exonic
930376183 2:50569900-50569922 ATGAAACCAGAGCACTGTGAAGG + Intronic
931190083 2:59991851-59991873 AGGAAGGAAGAGCAGGTTGAGGG + Intergenic
932673894 2:73761361-73761383 AGGAAGCCAGAAACCTTTGATGG - Intergenic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933312322 2:80676199-80676221 ATGAAGCTGGAGCCCTTTGGAGG - Intergenic
934541996 2:95183265-95183287 AGAAAGCTAGAGGAATTTGTAGG + Intronic
938494553 2:131786899-131786921 AGGAAGATAAAGCATTTTCAGGG - Intergenic
944721584 2:202428112-202428134 AGGGAGCTACAGCTCTTTGTTGG - Intronic
945175514 2:207039493-207039515 AGGAAGCTAGAGTACATAGGAGG - Intergenic
945210240 2:207375253-207375275 AGGAAGATAGAGCACTAAGCAGG + Intergenic
945580090 2:211582339-211582361 TGGAAGCTATAATACTTTGAAGG - Intronic
945955061 2:216078965-216078987 AGGACCCTAGTCCACTTTGAAGG - Intronic
947241317 2:227997353-227997375 AGGAATCTACAGCAGTTGGATGG - Intronic
1169732603 20:8802369-8802391 AGGAAGAGAGAGCACAATGATGG - Intronic
1172645581 20:36467276-36467298 AGGAAACAAGAGCCCTTTGAGGG + Intronic
1176613379 21:9007371-9007393 AGGAAGATAAAGCATTTTCAGGG + Intergenic
1176711798 21:10156422-10156444 AGGAAGATAAAGCATTTTCAGGG - Intergenic
1177106235 21:16958818-16958840 AGCTAGCTAGAGCATTTTGAAGG - Intergenic
1180498744 22:15912986-15913008 AGGAAGGTAAAGCATTTTCAGGG - Intergenic
1181312178 22:21951265-21951287 AGGAAGCTACACCACTCTGAAGG + Intronic
1181673035 22:24434721-24434743 AGGAAGCCACAGCAGGTTGAGGG + Intronic
1181890232 22:26056373-26056395 TGGAAGCTAGAGAGGTTTGATGG + Intergenic
949474244 3:4427872-4427894 AGTAAACTAGATCACTTTTAAGG - Intronic
950997327 3:17516865-17516887 AGGTAGCCAGAGCATGTTGAGGG - Intronic
953210287 3:40869401-40869423 AGGAAGAGTGAGCACTTTCAAGG + Intergenic
957299801 3:78377349-78377371 AGGCAGCAAGAGAAGTTTGATGG - Intergenic
959359629 3:105371731-105371753 AGGGAGCTAGAACTCTTTGATGG - Intronic
959540427 3:107531300-107531322 TGGAACCTAGAGCTCTTTGGTGG - Intronic
961146823 3:124600989-124601011 AGTAAGCTAGAGCTTTTTGTGGG + Intronic
962902187 3:139771248-139771270 AGGAAGCCAGAGAAGTTTGGAGG + Intergenic
963110901 3:141687056-141687078 TGGAGGGTAGAGCACTGTGACGG + Intergenic
967369800 3:188731406-188731428 AGGAAGCTTGATCTTTTTGATGG + Intronic
975988257 4:80227041-80227063 AGGAATCTAGAGTAATTTCAAGG - Intergenic
977222828 4:94357676-94357698 GGGAAGGTAGAGCAATGTGATGG - Intergenic
978735482 4:112079630-112079652 AGGACTCCAGAGCTCTTTGAAGG - Intergenic
980099290 4:128525111-128525133 AGGAAGCTTGATCACTTACAAGG - Intergenic
987958150 5:24766855-24766877 ATGAACCTAGAGCCATTTGAGGG - Intergenic
988861582 5:35286326-35286348 AAAAAGCTAAAGCAGTTTGAAGG + Intergenic
990866012 5:60380690-60380712 GGGAAGCTAGTGCACCTTGAAGG + Intronic
990902985 5:60773187-60773209 ATGAAGCTAGAGTATTATGAAGG + Intronic
991212016 5:64116764-64116786 AGGACACTAGAGGAATTTGAAGG + Intergenic
991978135 5:72203272-72203294 AGGAAGCAAGAAGAGTTTGAAGG - Intronic
993491113 5:88550998-88551020 AGGAAACAAGAACACTTTAATGG - Intergenic
995224014 5:109683644-109683666 AGGAGGCTAGAGCTTTTTGTAGG - Intergenic
996483872 5:124007579-124007601 AGTAAGCTAGAGCAATTGTAGGG + Intergenic
996801924 5:127413753-127413775 AGGAAGCTAGAGCACTTTGGAGG - Intronic
997411511 5:133694608-133694630 AGGAACCCAGAGCACTAGGAGGG - Intergenic
999401914 5:151271442-151271464 AAGAAGTTATAGCATTTTGATGG + Intergenic
999672937 5:153973624-153973646 TGGAAGCTGGAGGAATTTGAAGG - Intergenic
1000213502 5:159132110-159132132 AGAAAGCTCAAGCAATTTGAAGG + Intergenic
1000572215 5:162929118-162929140 AGGATGAGAGAACACTTTGAAGG + Intergenic
1002860540 6:1075774-1075796 AGCAAGGAAGAGCACTTTGCAGG + Intergenic
1003587254 6:7403145-7403167 ACGAAGCTAGATCATTTGGAAGG + Intronic
1003607063 6:7571967-7571989 AGGCAGATAGAGCACTGCGAGGG + Exonic
1004999807 6:21229541-21229563 AGGTTGCTAGAGCGCTTGGAAGG + Intronic
1005401611 6:25439790-25439812 ATGTAGCTAGCGCACTCTGAGGG + Intronic
1005604403 6:27461682-27461704 AGTAAGCTAGAGCAATTGTAGGG - Intronic
1006013069 6:31058386-31058408 ATGAAACTAGAGCATTCTGAAGG + Intergenic
1006565009 6:34948605-34948627 AGGAAGCTAGAGCACTTTGAGGG - Intronic
1012271271 6:97215150-97215172 AGGAATCTTGAGCTCTTTGGTGG - Intronic
1012339004 6:98095247-98095269 ACAAAGCTAGGGCACTTTTAGGG + Intergenic
1016372953 6:143393313-143393335 AGGAAGGAAGACCACTTAGAGGG + Intergenic
1018553683 6:165028105-165028127 ACAAAGCAAGAGCATTTTGATGG + Intergenic
1019668813 7:2267215-2267237 AGGAGGCAAAATCACTTTGAAGG + Intronic
1020672514 7:11135007-11135029 AGGAAGTTAGAGACCTTAGAAGG - Intronic
1021121362 7:16799296-16799318 AGAAAGCTTGAGCACCGTGAGGG + Intronic
1021876432 7:25054050-25054072 AGGCAGGTAGAGCAGTTAGAAGG + Intergenic
1023207088 7:37763134-37763156 AGGAAGGAAGAGCAGTGTGATGG + Intronic
1024244768 7:47460778-47460800 AGGAAGATTGGGCAATTTGATGG + Intronic
1025951063 7:66145862-66145884 AGGAAGCAAGAGCAGGGTGAAGG - Intronic
1026498134 7:70920963-70920985 AAGCTACTAGAGCACTTTGAGGG + Intergenic
1028042255 7:86068139-86068161 AGGAATCTAGAGAACTTACAGGG - Intergenic
1029000520 7:97149913-97149935 AAGCAGCAAGAGGACTTTGAGGG - Intronic
1030757865 7:113311330-113311352 TGGAAGCTATCGCACTTTTACGG + Intergenic
1030879120 7:114854323-114854345 AGGAAGCAAGAACAGTTTGCAGG - Intergenic
1032010848 7:128346847-128346869 AGTGAGCAAGAGCACTGTGATGG + Intergenic
1032022131 7:128413370-128413392 AGTGAGCAAGAGCACTGTGATGG + Intergenic
1032978661 7:137255250-137255272 TGGAAGCAAAAGAACTTTGAAGG + Intronic
1035998688 8:4577694-4577716 AGGGTGCAAGGGCACTTTGAAGG - Intronic
1036537413 8:9663835-9663857 AGGAAGGTGGAGCACTGGGAGGG - Intronic
1038076181 8:24077263-24077285 AGTAAGCTAGAGCAATGTTAGGG + Intergenic
1039005236 8:33028889-33028911 AGGAAGCAAGAGAACATAGATGG + Intergenic
1040276516 8:46016696-46016718 AGGAAGCTGAAGGACTTTTACGG - Intergenic
1043157680 8:76805184-76805206 AGTAAGCTACAGCACATAGAAGG - Intronic
1043878150 8:85509867-85509889 AGGAAGTCAGAGGACTGTGAGGG - Intergenic
1046477910 8:114772965-114772987 AGAAAGCTAGAGCAATTGTATGG - Intergenic
1047546728 8:125825258-125825280 AGGGGGCTAGAGCCATTTGAAGG + Intergenic
1047643451 8:126845295-126845317 AGGAAGCTAGGCCAGTTTCAGGG + Intergenic
1048946333 8:139451490-139451512 AGGAAGCTAGTAAACTATGATGG - Intergenic
1049390309 8:142364518-142364540 AGGAAGCAAGAGCTCTGTGCTGG - Intronic
1049725397 8:144143358-144143380 AGGAAGCTGGAGCAGCTGGATGG + Intergenic
1053505432 9:38639006-38639028 AGGAAGGGAGAGGACTATGATGG - Intergenic
1053648791 9:40142110-40142132 AGGAAGATAAAGCATTTTCAGGG - Intergenic
1053756953 9:41321732-41321754 AGGAAGATAAAGCATTTTCAGGG + Intergenic
1053838762 9:42170141-42170163 AGGAGGCTAGAGCACTTATCTGG + Intergenic
1054329772 9:63740051-63740073 AGGAAGATAAAGCATTTTCAGGG - Intergenic
1054535791 9:66234060-66234082 AGGAAGATAAAGCATTTTCAGGG + Intergenic
1056847605 9:90054407-90054429 AGGAAGAAAGTGCACTTTGGAGG + Intergenic
1058950924 9:109903168-109903190 AGGGAGGAAGAGCACTTTGCAGG + Intronic
1060545000 9:124454366-124454388 GGGAAGGAAGAGCACCTTGATGG - Intronic
1062321987 9:135994546-135994568 ATGAAGTTAGAGCCCTTGGAGGG + Intergenic
1202796553 9_KI270719v1_random:125411-125433 AGGAAGATAAAGCATTTTCAGGG - Intergenic
1186601415 X:11041699-11041721 AGGAAGCTTTAGCACTGGGATGG - Intergenic
1188950324 X:36364480-36364502 AGGGAGATAGAGAACTTTAAAGG + Intronic
1189190584 X:39099233-39099255 AGAAAGCTATACCACTTTTAGGG + Intergenic
1189473272 X:41330772-41330794 AGGAAGCCAGGGCACTGTCAAGG + Intergenic
1194188471 X:90805700-90805722 GGGAATCTAGACCTCTTTGAAGG + Intergenic
1195021647 X:100834196-100834218 AGGAAGGTGGAGCAGTTAGAGGG - Intronic
1197610680 X:128634858-128634880 AGAAAGGTATAGCACTCTGAGGG + Intergenic
1198403648 X:136291246-136291268 ATGAAACTAGAGAACTCTGATGG + Intergenic
1199636530 X:149818452-149818474 AGCAAGCTGGAGGACATTGAGGG + Intergenic