ID: 1006565076

View in Genome Browser
Species Human (GRCh38)
Location 6:34949214-34949236
Sequence GATTTCACAAAGATTAAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 255}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006565076 Original CRISPR GATTTCACAAAGATTAAGAT GGG Intronic
900904044 1:5538183-5538205 GATTTCATAGAGAGTAAAATAGG + Intergenic
903040967 1:20530164-20530186 GATTTCAGAAACATTATAATGGG + Intergenic
905489888 1:38335080-38335102 GATTGCACAAGGATTAAGGAAGG - Intergenic
906386848 1:45377310-45377332 GATATCACAAAGAAGAAAATAGG + Intronic
909629562 1:77757705-77757727 GAATTCAGATAGATTAAGATTGG - Intronic
910741743 1:90526818-90526840 TATTTCACAGAGCATAAGATAGG + Intergenic
911037067 1:93562178-93562200 GCTTTCCCAAAGATGAAGCTGGG + Exonic
912912862 1:113780147-113780169 GATTTTAAAAAGATCATGATAGG - Intronic
916380438 1:164204535-164204557 GATTTTACAAACAGTAATATCGG - Intergenic
916657702 1:166891976-166891998 GAGTTCATAAAGATGAAGCTAGG - Intergenic
918090034 1:181282583-181282605 AATTTTAAAAAGAATAAGATTGG - Intergenic
918525749 1:185463076-185463098 GACTTCCCACAGATTAAGAAAGG + Intergenic
918789832 1:188812448-188812470 GATTCCTCAAAGATTTAGAACGG + Intergenic
919035035 1:192295606-192295628 GTTTTCACAAAGACCAAAATTGG - Intergenic
919095417 1:193028430-193028452 GATTTTAAAAAAATTAACATGGG - Intronic
919405169 1:197171379-197171401 GATTTCATAAATATTAGAATGGG - Intronic
919548514 1:198954301-198954323 GATTTTACAAATATTTAGTTTGG + Intergenic
921673542 1:217952217-217952239 AGTATCACAAAGATTAGGATTGG + Intergenic
922632539 1:227131051-227131073 TATTTAAAAAAGAGTAAGATAGG - Intronic
924549811 1:245064877-245064899 AATTTCACAAAGATTTACGTTGG + Intronic
1062855244 10:776883-776905 GATTTCTCAGAGAGTCAGATGGG - Intergenic
1064303713 10:14146355-14146377 GAGTTCAGAAACATTAAAATAGG + Intronic
1066335641 10:34474940-34474962 AATTTCAGAAATGTTAAGATAGG + Intronic
1066517455 10:36178851-36178873 GCTTTTAGAAAGCTTAAGATGGG - Intergenic
1066596328 10:37054217-37054239 GATTCCACAAAGTGTAGGATCGG - Intergenic
1069317933 10:67130960-67130982 GATGGCACAAAGATAAATATAGG + Intronic
1071317856 10:84420629-84420651 GGTTTGATAAAGATTTAGATGGG + Intronic
1071757932 10:88566148-88566170 AATTTGACAAACATTAACATTGG - Intronic
1073603506 10:104870265-104870287 TCTTTCCTAAAGATTAAGATTGG - Intronic
1076583295 10:131529439-131529461 GATTTGAGAAAGATTCAGAGGGG - Intergenic
1077572110 11:3348131-3348153 GATTTCAAAAAAATTAAAAATGG + Intronic
1078033134 11:7773804-7773826 CAATTCACAAAGATGGAGATTGG - Intergenic
1080913520 11:36630095-36630117 GATTTCACCAGGATTACTATAGG + Intronic
1083527644 11:63384688-63384710 GATTTCTCAAAGATCTAGAACGG - Intronic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1086357737 11:86022367-86022389 GATTTCACAAAAGTGAAGAGAGG - Exonic
1086362956 11:86078104-86078126 GATTTAATAAAGTTTAGGATGGG + Intergenic
1087193392 11:95280306-95280328 GATTGCACAAAATTCAAGATGGG + Intergenic
1088090509 11:106033483-106033505 GATATTCCAAAGATTAAGATGGG + Intergenic
1088412675 11:109552561-109552583 GATTTCACTCTGAGTAAGATGGG + Intergenic
1089047039 11:115510336-115510358 TATTTCACAAAGATTATCAAAGG + Intergenic
1091087373 11:132735279-132735301 GATCTCAGAAAGATTTAGGTTGG + Intronic
1092064364 12:5577733-5577755 AATTTCACAAAGAGAAAGAAAGG - Intronic
1092226104 12:6749260-6749282 GATTTGAAAAAGATAAAGAGGGG + Intronic
1092775468 12:11941566-11941588 GATGTCACAAATATTTAAATGGG - Intergenic
1093367993 12:18327721-18327743 AATTTCAGAAATATTAAGAATGG + Intronic
1094117534 12:26933608-26933630 GATTACACAAAGAAAAAGAGAGG + Intronic
1094400743 12:30058540-30058562 GATTTCATATTGATTAAGAAGGG - Intergenic
1094727235 12:33132765-33132787 GATTTCAGAAAGGTCAAGAGTGG + Intergenic
1095100748 12:38180666-38180688 CAATTCACACAGATTAAGAATGG + Intergenic
1095577131 12:43753338-43753360 GATTTCACAAATGTAAAAATGGG - Intronic
1098219285 12:68251786-68251808 GATTTCCCAAAGATGAAGAGAGG - Intronic
1099716526 12:86300732-86300754 GATTTCATAAAAATTTAGAGTGG - Intronic
1099868879 12:88321064-88321086 GATTTCTCAAAGTTAAAGAGTGG + Intergenic
1100109158 12:91216670-91216692 CATTTCAAAAAGATAAAAATGGG - Intergenic
1100325276 12:93534341-93534363 GATTTCAGAAAGGTTAAAATTGG - Intergenic
1101059462 12:100955753-100955775 GATTTCAGGAAGGTTAAGAGAGG + Intronic
1101422986 12:104564612-104564634 GATTTAACAAGGCTTAATATTGG - Intronic
1107282535 13:38753424-38753446 CATTTCACTAAGATTCAGAAAGG - Intronic
1108860763 13:54855997-54856019 GATTTCATAAAATTTAAGTTTGG - Intergenic
1108906715 13:55484545-55484567 GTTATCTCAAAGAATAAGATAGG + Intergenic
1109554185 13:63949565-63949587 TTTTTCAAAAAGATTAAGGTAGG + Intergenic
1110462988 13:75766906-75766928 GAGTTGGCAAAGATTAAGACAGG - Intronic
1110990439 13:82037020-82037042 GATTTCTCAACTATTAAAATGGG - Intergenic
1111357530 13:87128227-87128249 GATTACACAAAGACAATGATGGG + Intergenic
1111395164 13:87657689-87657711 GATTTCAAAAAGATTAATTTTGG - Intergenic
1111757503 13:92417308-92417330 CACTTCACATAGATTAAGGTGGG + Intronic
1112571695 13:100599150-100599172 AATTTCACAATCATTAAGAGTGG - Intergenic
1112903434 13:104388113-104388135 GTTTTCACAAAGATTAAATTAGG - Intergenic
1114445806 14:22787069-22787091 GATTTCACAAAATTAAAGAAGGG - Intronic
1114862857 14:26547435-26547457 GATTTGAAAAAGAATCAGATGGG - Intronic
1115111857 14:29833201-29833223 GATTTCCCAAAGAATAACCTGGG - Intronic
1115406041 14:33017847-33017869 GATTTCACTAGGATTAATAATGG + Intronic
1116269993 14:42751367-42751389 AATTTCACAAATCTTAATATCGG - Intergenic
1117180730 14:53189004-53189026 GATTTCAACCAGAATAAGATAGG + Intergenic
1117399726 14:55347649-55347671 GATTTTAGCAAGATTAAAATAGG - Intronic
1118535982 14:66765046-66765068 GATTTCTAAAAGATTAACAGTGG - Intronic
1118661088 14:68013261-68013283 CATTTCAAAAAGAGAAAGATAGG + Intronic
1119328302 14:73775305-73775327 CAGTTCTCAAAGATTAAGAGGGG + Intronic
1119854342 14:77888051-77888073 GATTACCCCAAGATGAAGATGGG - Intronic
1120122942 14:80704205-80704227 GATTTTACTAAGATTAAATTGGG + Intronic
1123477605 15:20601233-20601255 GATTCCTCAAAGATTTAGAATGG - Intergenic
1123640410 15:22399149-22399171 GATTCCTCAAAGATTTAGAATGG + Intergenic
1125069719 15:35539093-35539115 GATTCCACAAATATCAATATGGG + Intronic
1126606785 15:50486068-50486090 AAATTCACATAGATTTAGATTGG - Intronic
1126804576 15:52333584-52333606 GATTCCATGAAAATTAAGATGGG + Intronic
1127053678 15:55110891-55110913 GATTTCAGAAATGTTAAAATAGG - Intergenic
1128266422 15:66270759-66270781 GATTTAAAAAATAATAAGATCGG + Intergenic
1128790355 15:70428820-70428842 AAATTCACAATGATGAAGATAGG + Intergenic
1130344145 15:83026322-83026344 GATTTCACAAAGGTTTAGGGGGG + Intronic
1133824543 16:9266379-9266401 GTATTCTCACAGATTAAGATTGG - Intergenic
1136057114 16:27698702-27698724 TATTTCACAAAGCCTAAGCTGGG + Intronic
1137914849 16:52418493-52418515 TATTTCACAGAGAAAAAGATAGG + Intergenic
1137935026 16:52626617-52626639 CTTTTCACAAAGATTCAGAGAGG - Intergenic
1138430321 16:56964325-56964347 TATATGATAAAGATTAAGATAGG - Intronic
1138949233 16:61890704-61890726 GATTTCACAAGGGATAATATTGG - Intronic
1139899193 16:70313638-70313660 GATTTCAGAATAATTAGGATAGG - Intronic
1140845503 16:78883219-78883241 AAGTTCACAAAGCTTAAGAGGGG - Intronic
1141273731 16:82565507-82565529 GATATCAAAAAGAATAAAATTGG + Intergenic
1141306659 16:82870915-82870937 GATATCAGAAAGATAAATATTGG - Intronic
1143888209 17:10082357-10082379 GATTTGACAAGTATTAACATTGG - Intronic
1143925628 17:10366763-10366785 AATTTCATAAAGGCTAAGATGGG - Intronic
1145789352 17:27615999-27616021 GCTTCCAGAAAGAGTAAGATAGG - Intronic
1148526886 17:48347215-48347237 CATTTCACAAACATGAAAATAGG + Intronic
1149363649 17:55919260-55919282 GGTTTCACAAACATTAAGAATGG + Intergenic
1156636688 18:39039388-39039410 TATATCACTAAGATTAAAATTGG - Intergenic
1157380303 18:47208630-47208652 GATTTCACACAGATTACACTGGG + Intergenic
1158289006 18:55917762-55917784 GAGATCACAAAGATTGGGATGGG + Intergenic
1159041982 18:63332983-63333005 GATTCCAAAAAGAAGAAGATGGG + Intronic
1159978559 18:74747499-74747521 GATTTCACAAACTTTAAGTTTGG + Intronic
926955928 2:18299789-18299811 GAATTCACAAAGATTAAATGAGG + Intronic
929611251 2:43272269-43272291 GGTTTTACCCAGATTAAGATGGG + Intronic
930505417 2:52277304-52277326 AATTTCAAAAGGATTAAAATGGG - Intergenic
930835301 2:55786565-55786587 AATTACTCAAAGATTAAGAAAGG + Intergenic
930966254 2:57331639-57331661 GTTTTCATAAATTTTAAGATAGG - Intergenic
932055426 2:68438469-68438491 GATTTCACAAGGAATGAGACAGG + Intergenic
934812293 2:97290781-97290803 GATTTACCAAAAAATAAGATAGG + Intergenic
934825401 2:97417142-97417164 GATTTACCAAAAAATAAGATAGG - Intergenic
935613512 2:105051634-105051656 GACTTAACTAACATTAAGATGGG - Intronic
939083662 2:137691036-137691058 AATTTAACAAAGTCTAAGATTGG + Intergenic
939657075 2:144839296-144839318 CATCCCTCAAAGATTAAGATGGG - Intergenic
939762244 2:146197565-146197587 CATTTTACAAAGATTAAAGTAGG + Intergenic
942330995 2:174823989-174824011 GATTTCACAAAAATTTAGTAAGG + Intronic
942484432 2:176424306-176424328 GAGTTCAAAAAGATTCAGAATGG + Intergenic
942914629 2:181289867-181289889 TATTTCACAAAGATAAAAATTGG + Intergenic
943176933 2:184488471-184488493 GATTTCTGCAAGATTAGGATAGG - Intergenic
945366505 2:208961038-208961060 GATTTCAAAAAGACAAAGAAGGG + Intergenic
948300294 2:236901252-236901274 GTTTGCACAAAGTTTAAAATAGG + Intergenic
1170521945 20:17195689-17195711 TATTTCTGAAAGATTAGGATGGG - Intergenic
1171020036 20:21576632-21576654 GATTTCACAGATAATAAAATGGG - Intergenic
1171778136 20:29390230-29390252 CAATTCACACAGATTAAGAATGG - Intergenic
1171897910 20:30827544-30827566 CAATTCACACAGATTAAGAATGG + Intergenic
1174494030 20:50926473-50926495 TATTTCACTAAGATTTAAATAGG + Intronic
1174859798 20:54080396-54080418 TATTTCACAATGAGTAATATAGG - Intergenic
1177874868 21:26619678-26619700 GATTTCAAAAAGATCAAGCCTGG - Intergenic
1182026193 22:27121114-27121136 AACTTCAGAAGGATTAAGATGGG + Intergenic
1183560183 22:38566397-38566419 GATTTCTGAAAGATGAAGGTAGG - Intronic
949286312 3:2409668-2409690 AATTTTAAAAAGATTAAAATGGG - Intronic
949333747 3:2950896-2950918 GATATGACAATGATCAAGATAGG - Intronic
950189084 3:10964115-10964137 GAATTCACAGAAAGTAAGATGGG + Intergenic
951496794 3:23337716-23337738 GAATTCAAAAAGGTTAATATAGG + Intronic
951540910 3:23781034-23781056 CATTTCACAAAGATTAAGTAAGG - Intergenic
951665146 3:25114554-25114576 GATTTTACAAATACTAAAATGGG - Intergenic
952273988 3:31859565-31859587 CATTTCACCAAGATGGAGATTGG - Intronic
953247989 3:41213861-41213883 GATTACAGAAAGAGTAAGCTAGG - Intronic
953312893 3:41896969-41896991 TATTTCTGAAAGATCAAGATTGG - Exonic
953479186 3:43234861-43234883 GATTTCACAAATATGAAAGTGGG - Intergenic
955018639 3:55096896-55096918 CACTTAACAAAGTTTAAGATAGG - Intergenic
955784659 3:62524455-62524477 TGTATCACAAAGAATAAGATAGG + Intronic
956697045 3:71927245-71927267 CATGTCATAAAGATTCAGATTGG - Intergenic
957091941 3:75739446-75739468 GATTTGACAAAAATAAATATGGG + Intronic
957613631 3:82500720-82500742 GGTTTCACCAAGTTTATGATAGG - Intergenic
957902981 3:86521092-86521114 CATCTCACAAAGATTGAGATAGG - Intergenic
958628757 3:96660925-96660947 AATTTAACCAAGATTAATATTGG + Intergenic
959455752 3:106558975-106558997 GAGTTTACAGAGATTAAAATAGG + Intergenic
959571562 3:107890125-107890147 TATTTTACTAAGATTTAGATTGG + Intergenic
960100603 3:113738497-113738519 GAATTAACAGAGATTAAAATAGG - Intronic
960635020 3:119776332-119776354 GATTTAACAAACTTGAAGATAGG + Intergenic
960726506 3:120675611-120675633 GACAACACAAAGATTAAAATTGG - Intronic
961199195 3:125030693-125030715 CATTGCACAAAGATGAAGACAGG + Intronic
962184722 3:133246057-133246079 GATTTCATAAAACTTACGATTGG + Intronic
962810631 3:138956343-138956365 GATTTCTGAAAGTGTAAGATTGG + Intergenic
963093312 3:141507676-141507698 GATTTCATGAATATTAAGAAAGG - Intronic
963495964 3:146061443-146061465 GCTTTCACAAAGATTGAAACAGG + Intergenic
966448562 3:180031551-180031573 GATGTCCCAAACATTCAGATTGG + Intronic
967418629 3:189249185-189249207 GATTTGTCATAGATTGAGATAGG + Intronic
967534401 3:190585935-190585957 GATTTCACAAAGCATGAGAATGG - Intronic
968695980 4:2027068-2027090 GATTCCTCAAAGATTTAGAATGG - Intronic
970466154 4:16324805-16324827 TATTTTACAAAGAATAAGAAGGG - Intergenic
971227148 4:24765000-24765022 GATTTCAGAAAGATTTAAAATGG - Intergenic
972786326 4:42329875-42329897 GATTTTACAGAGAGAAAGATGGG - Intergenic
974211330 4:58780377-58780399 GATTTCACAACAATTAAATTAGG + Intergenic
975574508 4:75849485-75849507 GAGTTCACAAATATTAATAAGGG - Intergenic
976326006 4:83772338-83772360 GATTTCAAAAATATTAAAAAAGG + Intergenic
976379919 4:84387546-84387568 GATTTCAAAAAGATTATGGATGG + Intergenic
977505088 4:97892104-97892126 TATTGCACAAAGATTATAATAGG - Intronic
978682135 4:111394585-111394607 CATTTTACAAAGATAAGGATTGG + Intergenic
978783658 4:112583883-112583905 GTTTTAAAAGAGATTAAGATAGG - Intronic
979088758 4:116451030-116451052 GATTTAACAAAAAGTAAAATTGG - Intergenic
982154504 4:152504690-152504712 GATTTCATAAAGTTTATGGTTGG - Intronic
982413015 4:155100401-155100423 TATTTTACAAAGATGAAGTTTGG + Intergenic
983928269 4:173426036-173426058 GATTTCACAAATATAAATATAGG + Intergenic
986150332 5:5122951-5122973 GCTTTTGCAAAGATTAAGACTGG + Intergenic
987470949 5:18326643-18326665 GAGTTCACTAAGCATAAGATTGG + Intergenic
987724964 5:21686127-21686149 GATATCACAAAGATACAGATGGG - Intergenic
991581610 5:68161430-68161452 GATTCCACAAAGAACCAGATGGG + Intergenic
992762274 5:79961374-79961396 GATTTCACAAAGATCAGGGAAGG - Intergenic
993205266 5:84870741-84870763 CATTTCACAAAGACAAAGACAGG + Intergenic
993706031 5:91171941-91171963 AAATTCAAAAATATTAAGATGGG + Intergenic
994977914 5:106834427-106834449 GATTGCACAGAGATTTAGAAAGG + Intergenic
995948173 5:117675958-117675980 GTTTTCACAGAGAAGAAGATAGG - Intergenic
996300068 5:121971272-121971294 GATTGCAAAAAGGTCAAGATAGG + Intronic
997795470 5:136805452-136805474 GATTTCCCAAAGGGTAAGAAGGG + Intergenic
997887288 5:137641579-137641601 GAGTTCACACAGATTTTGATGGG - Intronic
1000300023 5:159948044-159948066 GGTTTCACAGAGATTAAACTTGG + Intronic
1005226381 6:23647978-23648000 TTGTTCACACAGATTAAGATTGG + Intergenic
1006565076 6:34949214-34949236 GATTTCACAAAGATTAAGATGGG + Intronic
1006853926 6:37119618-37119640 CATTTCACAAATACTTAGATAGG + Intergenic
1008147027 6:47904156-47904178 GATTTTGCATAGAATAAGATGGG + Intronic
1008290898 6:49714588-49714610 GATTTCATAAATATTTAGAAAGG - Intergenic
1009357701 6:62772010-62772032 GATGTCAGACAGAATAAGATAGG - Intergenic
1010002039 6:70957340-70957362 TATTTCACAAAGCTGAAGAGAGG - Intergenic
1010310591 6:74380240-74380262 GATCTCAAAATGATTAAGATTGG + Intergenic
1012198226 6:96371824-96371846 AAATTAACAAAAATTAAGATTGG - Intergenic
1012294288 6:97501149-97501171 AACTTCACAAAGATTAAAACTGG + Intergenic
1012326030 6:97918995-97919017 TATTTCACAAAAATTAAATTAGG - Intergenic
1012962774 6:105639933-105639955 TATTTCACAAAGTTTAAGTAAGG + Intergenic
1013808595 6:114019669-114019691 GATATCATAAAGATTGTGATTGG + Intergenic
1014118336 6:117691924-117691946 CTTTTTACCAAGATTAAGATGGG - Intronic
1014422100 6:121259327-121259349 GATCTCATAAAGATAATGATTGG + Intronic
1015070065 6:129081603-129081625 GATTTGAGAAAGATTATCATTGG + Intronic
1015784437 6:136906725-136906747 AATTTCAAAAAGAGAAAGATAGG - Intronic
1016327156 6:142915653-142915675 GATGCCACCAAGATTAAGAAAGG - Intronic
1017345702 6:153378103-153378125 GATTTCACAAAGGAAAACATAGG - Intergenic
1019969981 7:4532963-4532985 GATCACTCAATGATTAAGATGGG - Intergenic
1020566514 7:9803800-9803822 GATTTCAAAAATTTTAGGATTGG + Intergenic
1021150941 7:17149998-17150020 TATTTCACAAACATTCAGAATGG + Intergenic
1021391144 7:20094526-20094548 GATTTCTCAAAGATTCAGACTGG + Intergenic
1021482245 7:21130514-21130536 GATTTAAAAAATATTAAAATTGG - Intergenic
1021494182 7:21255517-21255539 GATTTCATATAAATAAAGATTGG - Intergenic
1021907160 7:25345934-25345956 AATTTCAGAAAAATTAAAATGGG - Intergenic
1027952504 7:84835616-84835638 AATTACACAACCATTAAGATTGG - Intergenic
1027986021 7:85290990-85291012 GATTTCAGAAAACTTGAGATCGG - Intergenic
1028963227 7:96773240-96773262 GATTTCAAAAAGAGTAACTTAGG + Intergenic
1030965307 7:115985714-115985736 CATATAAAAAAGATTAAGATTGG + Intronic
1031233182 7:119136614-119136636 GATTTGACACAGATAAAGAGGGG - Intergenic
1031305816 7:120125428-120125450 AATTTCAAAATTATTAAGATTGG + Intergenic
1032731924 7:134651592-134651614 GATCTCAAAAATATTAAGAGGGG + Intronic
1033924310 7:146438751-146438773 AATTTCTAAAAGATTAAGATAGG + Intronic
1034593830 7:152168662-152168684 GATTTCAGAAAGGTTCAGTTTGG + Intronic
1035566753 8:646421-646443 GCTCTCACAAAGACTAAAATTGG + Intronic
1037012484 8:13860736-13860758 GAAATCATAAAGATGAAGATAGG + Intergenic
1037149967 8:15625377-15625399 TATTTCCCAAAAATTAAAATAGG - Intronic
1037201174 8:16254423-16254445 TATTTTACAAATATGAAGATGGG - Intronic
1037653755 8:20865498-20865520 CATTTCACAAACATGAAGAGAGG - Intergenic
1038280185 8:26156967-26156989 GGTTTCACAAAGACTTACATAGG + Intergenic
1039453520 8:37694169-37694191 GATTTTACCAAGATTAAAATTGG + Intergenic
1039739399 8:40368126-40368148 GAATTCACAAAAATTAATAAAGG + Intergenic
1039956653 8:42212586-42212608 GTTTTCTCAAAGATGAAGAAAGG + Intergenic
1041871881 8:62644079-62644101 GGTTTCATAAAGAGTAAGCTGGG - Intronic
1042699777 8:71599633-71599655 CATTTCACAATGATGAAGATGGG - Intergenic
1042767000 8:72332938-72332960 GATTTTACAACAATTTAGATTGG - Intergenic
1043237976 8:77893008-77893030 GATATCACAAATATTAATATGGG + Intergenic
1044889686 8:96820501-96820523 GATCTCATAAAGATAGAGATTGG - Intronic
1045584273 8:103513857-103513879 GATTTTACATAGATCAATATTGG + Intronic
1046008260 8:108512890-108512912 TTTTTCACACAGAGTAAGATGGG - Intergenic
1046397248 8:113656576-113656598 GATGTCCCAGAGATTAATATTGG + Intergenic
1047061481 8:121231586-121231608 CATTTCTCAAAGATTCAGGTAGG - Intergenic
1047367610 8:124226531-124226553 GACTTCACAATGAAAAAGATTGG + Intergenic
1047408867 8:124607924-124607946 GATTTTACAAAGCTTGAGGTAGG + Intronic
1047512748 8:125528162-125528184 GCTTGCTCAAAGATTAAGAAGGG - Intergenic
1050087003 9:1976266-1976288 GAATTGATAAAGATTAACATTGG + Intergenic
1051282210 9:15453638-15453660 GCTTTGACAAAGATTTAAATTGG + Intronic
1053750470 9:41249353-41249375 CAATTCACACAGATTAAGAAAGG + Intergenic
1054255975 9:62813690-62813712 CAATTCACACAGATTAAGAAAGG + Intergenic
1054335334 9:63801918-63801940 CAATTCACACAGATTAAGAAAGG - Intergenic
1054983835 9:71238260-71238282 GATTTTTCAAAGATTAAGTCTGG + Intronic
1055372784 9:75618252-75618274 AATATCCCAAAGATAAAGATAGG + Intergenic
1057523841 9:95782792-95782814 GATGTCACACAAATTAAGAAGGG + Intergenic
1058267401 9:102919842-102919864 GATTTCATAAAAATTAAAAATGG - Intergenic
1058626010 9:106933350-106933372 GTTTTCACAGAGGTTAGGATGGG + Intronic
1060625795 9:125110149-125110171 CATTTGAAAAAGTTTAAGATTGG + Intronic
1186258557 X:7750293-7750315 GAGTTCACACAGATTGAGATCGG + Intergenic
1186573877 X:10744757-10744779 GATTTCCCTAAAATTAAGAGAGG - Intronic
1187437513 X:19286461-19286483 GATGTCACAAAGAATAACCTTGG - Intergenic
1188113421 X:26217413-26217435 AATTTCATAAATATTAAGGTGGG + Exonic
1188344647 X:29048905-29048927 GATTTCAGAGATATTAAAATGGG + Intronic
1188524031 X:31070820-31070842 GAATCCACAAACATTAACATTGG + Intergenic
1189911545 X:45815230-45815252 AATTTCCCAAAGATTAAAAAGGG + Intergenic
1193845196 X:86461006-86461028 TATTTCACAAAGTTAAAAATAGG - Intronic
1194538224 X:95134603-95134625 GATTTCAGAAAGATAGAGTTTGG + Intergenic
1196754227 X:119143798-119143820 GTTGTCACAAAGATTAAATTAGG - Intronic
1201066757 Y:10104231-10104253 CAATTCACACAGATTAAGAATGG + Intergenic
1201744782 Y:17359933-17359955 GATTCAACAAAGAGTAAGACTGG - Intergenic
1201761045 Y:17538757-17538779 CAATTCACACAGATTAAGAACGG - Intergenic
1201840507 Y:18367233-18367255 CAATTCACACAGATTAAGAACGG + Intergenic