ID: 1006566137

View in Genome Browser
Species Human (GRCh38)
Location 6:34959253-34959275
Sequence GAGATTGTTGCCATTCTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006566137 Original CRISPR GAGATTGTTGCCATTCTTAA TGG Intronic