ID: 1006567595

View in Genome Browser
Species Human (GRCh38)
Location 6:34973726-34973748
Sequence AGCTGAACAAAATCTCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006567595_1006567600 21 Left 1006567595 6:34973726-34973748 CCTGTGGGAGATTTTGTTCAGCT 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1006567600 6:34973770-34973792 AGCAATTTGACCTTAGGTAGTGG 0: 1
1: 0
2: 0
3: 4
4: 104
1006567595_1006567599 15 Left 1006567595 6:34973726-34973748 CCTGTGGGAGATTTTGTTCAGCT 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1006567599 6:34973764-34973786 TAGAGAAGCAATTTGACCTTAGG 0: 1
1: 0
2: 3
3: 84
4: 278
1006567595_1006567598 -8 Left 1006567595 6:34973726-34973748 CCTGTGGGAGATTTTGTTCAGCT 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1006567598 6:34973741-34973763 GTTCAGCTGTTGGGTCTTAATGG 0: 1
1: 0
2: 0
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006567595 Original CRISPR AGCTGAACAAAATCTCCCAC AGG (reversed) Intronic
900313860 1:2047670-2047692 GGCTGAACAAAGTCTGACACTGG + Intergenic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
905502380 1:38450086-38450108 AGCTCCACAAAACCTCCCAGTGG + Intergenic
906370067 1:45246369-45246391 AGCCAAACAATATCACCCACTGG - Intronic
909064038 1:70911187-70911209 ATCTGAACAAAGTATCACACTGG + Intronic
909206026 1:72758948-72758970 AGCTGAAGAAAATTTGCCTCAGG - Intergenic
910165582 1:84324416-84324438 ACCTGAAAAGAAACTCCCACGGG + Intronic
910810879 1:91234970-91234992 AGCTGATCAAAATTTCACATGGG - Intergenic
911984842 1:104609586-104609608 AGATGAACAAAATAGACCACTGG + Intergenic
913346373 1:117814993-117815015 AGCTGCACAAATTCTACCCCTGG + Intergenic
914219172 1:145662699-145662721 AGGTGAGCAAACTCTGCCACTGG - Intronic
914471755 1:147985570-147985592 AGGTGAGCAAACTCTGCCACTGG - Intronic
917489397 1:175485044-175485066 AGCTGAATAAAATCTCTTAATGG - Intronic
918963015 1:191305133-191305155 AGGGGAAAAAAATCTCCCAGAGG + Intergenic
920325892 1:205163548-205163570 AGCTCACCAACATCTCCCACAGG + Intronic
921401808 1:214732177-214732199 AGCTGAACAAAAGCTTAAACTGG + Intergenic
922468149 1:225859067-225859089 AGCTGAGCAACATGACCCACTGG + Intronic
923783895 1:237049557-237049579 AGCATAACAAAATCTCACCCTGG + Intronic
924073338 1:240306379-240306401 AGCTGAACATAGTATCCAACAGG + Intronic
1063388906 10:5635821-5635843 AGCTGAGCAAGAGATCCCACTGG + Intergenic
1064064285 10:12167782-12167804 AGCTGAAGAACATCTCACAGTGG - Exonic
1064687144 10:17874555-17874577 GGCTGAATAAAAGCTCCCAAAGG - Intronic
1066009525 10:31181535-31181557 AGCTGAAGAAAATCTCTCTCAGG - Intergenic
1066107373 10:32167624-32167646 AGCTGACCAAAAACACACACGGG + Intergenic
1068156835 10:53210273-53210295 AGATGAACAAAATTTGCCAGTGG - Intergenic
1070480499 10:76878091-76878113 TGATGAACAAAATGTGCCACTGG + Intronic
1072762997 10:98073218-98073240 ATCTGAATAACATCCCCCACTGG + Intergenic
1073362971 10:102915248-102915270 AGATGAAGAAAACCACCCACAGG - Intergenic
1074632635 10:115275158-115275180 AGCTGAAAGAAAACTCACACCGG - Intronic
1075220901 10:120583734-120583756 AGCTGAACAACATCTACAAGAGG - Intronic
1075569336 10:123528138-123528160 AGAAGAACTAAATCTCCCTCAGG + Intergenic
1076756352 10:132574398-132574420 ATCTCAACAAAACCTCACACAGG - Intronic
1076756361 10:132574471-132574493 ATCTCAACAAAACCTCACACAGG - Intronic
1077573196 11:3356419-3356441 AGCTCAAAAAAGTCTCCCAAAGG - Intronic
1080029000 11:27641313-27641335 AGCTGGAAACAATTTCCCACAGG - Intergenic
1081861365 11:46334928-46334950 AGCTGGACAATATCTCTCCCTGG + Intronic
1084652187 11:70495778-70495800 AGCCCAACAAAACATCCCACGGG + Intronic
1089341679 11:117762392-117762414 AGCTGAATAAATTCTGCCCCTGG + Intronic
1092404269 12:8206831-8206853 AGAATAACTAAATCTCCCACAGG + Intergenic
1093895110 12:24565711-24565733 AGCTGATCAAAAACTTCCAGTGG + Intergenic
1095299506 12:40566480-40566502 TTCTGAACAAAATTTCCCAAGGG + Intronic
1096270884 12:50165869-50165891 ACTTGATCAAAATCACCCACAGG + Intronic
1096622749 12:52874546-52874568 AGCGGGACAAATTCTCCCACAGG - Intergenic
1097489708 12:60250778-60250800 ATTTGAACAAAATGTACCACAGG + Intergenic
1100456895 12:94760380-94760402 TGCTGAAAAAAATATCCCTCTGG + Intergenic
1100646464 12:96537237-96537259 AGCTGAACAGAACCTCACACTGG - Intronic
1100874517 12:98947939-98947961 AGCTGAAGAATATCTCACACCGG - Intronic
1102421561 12:112807379-112807401 TGCACAACAAAATCTCCCTCTGG - Intronic
1103315023 12:120046242-120046264 AGCTTAAGAAAATCTGGCACAGG - Intronic
1104964704 12:132503621-132503643 AGCTGAACAGAAACTGGCACAGG - Intronic
1106996593 13:35491207-35491229 AAATTAACAAAATCTTCCACTGG - Intronic
1111008913 13:82286634-82286656 AGGAGAATAAAATCTCCCAGGGG - Intergenic
1111189294 13:84788077-84788099 AGCTGAACCAAAACCCCCAAAGG - Intergenic
1111823610 13:93242951-93242973 AGCAGAACAAAGTCTCGCAATGG + Intronic
1111895552 13:94137341-94137363 AGCTGGACAAAATTTCACCCTGG - Intronic
1112243096 13:97701819-97701841 TCCTCAACAAAATATCCCACAGG + Intergenic
1113079068 13:106497713-106497735 AACTGAAAAAAATCACACACCGG - Intronic
1113514692 13:110885152-110885174 AGCTTTAAAAAATCTTCCACAGG + Intronic
1113786600 13:113005206-113005228 TGCTGAGCAAAATCAGCCACAGG + Intronic
1114237268 14:20834150-20834172 AGCCGACCAAAACCTCCTACTGG - Intergenic
1114509020 14:23241413-23241435 AACAAAACAAAAACTCCCACAGG - Intronic
1116328712 14:43568381-43568403 AGATGAACTAAATCTCCTAAAGG - Intergenic
1119344364 14:73910346-73910368 AGTTGAACAGATTCTTCCACTGG - Intronic
1120175655 14:81290589-81290611 AGCTGACCAGCATCACCCACAGG + Intronic
1121448046 14:93990602-93990624 AGCTTCCCAAAATCTCCCATGGG - Intergenic
1121982717 14:98468682-98468704 ACCTGAACTTAATCTTCCACAGG - Intergenic
1122037368 14:98958448-98958470 AAATGAACCAAATCTCCCACAGG - Intergenic
1122099769 14:99398408-99398430 AGGTCTGCAAAATCTCCCACAGG + Exonic
1134256724 16:12618587-12618609 AACTGAACAAGATCTGCCCCAGG + Intergenic
1134657983 16:15961947-15961969 AGCAGAATAAATTTTCCCACAGG + Intronic
1135228069 16:20678892-20678914 GGCTGAACAAAATCTCAGAGGGG - Intronic
1143629173 17:8127526-8127548 TGCTGATGAAAATCCCCCACTGG - Intergenic
1151849260 17:76680620-76680642 AGCTTAACAAAGTGACCCACAGG + Intronic
1155578635 18:27277812-27277834 AGCTGAGCTAAATCTGACACTGG + Intergenic
1156502684 18:37569570-37569592 ACCTGAACCTAATCCCCCACAGG - Intergenic
1156616946 18:38798425-38798447 AGCTTAGCAAAATCTCCCTGTGG - Intergenic
1157216430 18:45787303-45787325 AGATGAAGAAAATCTCCCTCAGG + Intergenic
1157413246 18:47481493-47481515 AGCTAAGCACAATCTGCCACGGG - Intergenic
1157536645 18:48463752-48463774 CGCTAAAGAAAATCTCCCTCTGG - Intergenic
1159308555 18:66677777-66677799 AGCTGAAAAACCTTTCCCACTGG - Intergenic
1159804385 18:72938442-72938464 TGCTTTACAAACTCTCCCACAGG - Intergenic
935264233 2:101381100-101381122 AGCTTCACAGCATCTCCCACAGG - Intronic
935433006 2:102998149-102998171 AGCTCAACAAATTCCCCCAAAGG - Intergenic
937577489 2:123441829-123441851 AGCTGGACAAAACCTGCCAAAGG + Intergenic
939381352 2:141440667-141440689 AGTGGAACTAAATCTCCAACTGG + Intronic
941104767 2:161340567-161340589 AGCTTAACAAAGTGACCCACAGG + Intronic
941899602 2:170665257-170665279 CTCTGAACAAAATCCCCCCCTGG - Intergenic
945929744 2:215842905-215842927 ACCTGCTCAAAATCTTCCACTGG + Intergenic
1170299155 20:14863099-14863121 AGCAGAAGCAAATCACCCACGGG + Intronic
1181470079 22:23133055-23133077 AGCTGAACATAATCTTACCCAGG + Intronic
1181789732 22:25255684-25255706 AGTTGAGTAAAATTTCCCACTGG - Intergenic
1181824552 22:25504519-25504541 AGTTGAGTAAAATTTCCCACTGG - Intergenic
1182172744 22:28249421-28249443 GGTAGAACAAAATCTCCCACAGG + Intronic
1185252474 22:49811766-49811788 AGCTGACAAAATTCCCCCACGGG + Intronic
1185266954 22:49909247-49909269 TCCTGAACAAAAGCTCCAACTGG - Exonic
949395252 3:3607839-3607861 AGCTGGATAAAATCAGCCACTGG + Intergenic
951492084 3:23282213-23282235 AGCAAAACAAAATTTCCCAGAGG - Intronic
953213023 3:40893092-40893114 AGATGAACAAGGTCTCCCAAAGG - Intergenic
958706223 3:97659427-97659449 AGATGATGAAAATGTCCCACAGG + Intronic
959092303 3:101916840-101916862 AGCTGAGGAAAATTGCCCACTGG + Intergenic
960687839 3:120312004-120312026 AGCTGGCCAGAGTCTCCCACAGG - Intergenic
964143828 3:153434354-153434376 AGCTGAACAACTTTTCTCACGGG - Intergenic
965900287 3:173631960-173631982 AGCTGTAAAAAATCTGCTACAGG - Intronic
969761785 4:9190865-9190887 AGAATAACTAAATCTCCCACAGG - Intergenic
974375190 4:61067193-61067215 AGATGAACAAAATGTGCCATTGG + Intergenic
980195174 4:129578708-129578730 AGCTGAACACACACCCCCACTGG - Intergenic
981401077 4:144314180-144314202 TCCTGAACAAACACTCCCACTGG - Intergenic
981401091 4:144314243-144314265 TCCTGAACAAACACTCCCACTGG - Intergenic
985661060 5:1156593-1156615 AGCTGCACAAATTCTGCAACTGG + Intergenic
986060076 5:4179736-4179758 CACTGAACAAACTCTCCCAGTGG + Intergenic
987082392 5:14437370-14437392 AGCTGAACAACATCACCCCGAGG - Intronic
988303325 5:29462666-29462688 AGCTGGACAAAATCGACTACTGG - Intergenic
992315384 5:75547414-75547436 ACCTAAACAATTTCTCCCACTGG - Intronic
993067825 5:83122331-83122353 AGATGAGCAAAATCTCCCCTGGG - Intronic
996134543 5:119823520-119823542 ACCTGAACTGAATCTCTCACAGG - Intergenic
1005477578 6:26222914-26222936 ACCTGAACACAATTTCCCATAGG - Intergenic
1006567595 6:34973726-34973748 AGCTGAACAAAATCTCCCACAGG - Intronic
1011675229 6:89726582-89726604 CACTGAACAAAATCTCCAACGGG + Intronic
1012703120 6:102488267-102488289 ACCTGCACAAATACTCCCACTGG + Intergenic
1012823379 6:104117256-104117278 ATCTGCACAAAATCTCTCACTGG + Intergenic
1013694968 6:112691265-112691287 AGCTGCATAAAATCTTTCACTGG - Intergenic
1018741946 6:166736250-166736272 AGCAGAACAAAATGACCCAGTGG - Intronic
1019024175 6:168943304-168943326 AGAGGAACAAAGTCACCCACGGG + Intergenic
1020450392 7:8315119-8315141 TGCTGAAGAAAACATCCCACAGG + Intergenic
1020976151 7:15009369-15009391 AGGTGTAAAAAATATCCCACAGG - Intergenic
1024437620 7:49377432-49377454 AGCTAAACAAAGCCTGCCACTGG - Intergenic
1035057124 7:156043184-156043206 AGATGAACAAAGTCTCGCTCTGG - Intergenic
1036271884 8:7312701-7312723 AGAATAACTAAATCTCCCACGGG - Intergenic
1036349462 8:7997644-7997666 AGAATAACTAAATCTCCCACGGG + Intergenic
1036844745 8:12158156-12158178 AGAATAACTAAATCTCCCACAGG + Intergenic
1036866115 8:12400488-12400510 AGAATAACTAAATCTCCCACAGG + Intergenic
1037394287 8:18425819-18425841 AGCTGACCACAACCTGCCACAGG - Intergenic
1038919821 8:32070203-32070225 AGCGGTACAAAATCTACCATGGG + Intronic
1039685142 8:39793466-39793488 AGCTTAAAAAATTCTCCCAATGG - Intronic
1040652205 8:49461990-49462012 ATCTGTACAAATTCACCCACAGG + Intergenic
1043327379 8:79069647-79069669 AGCTGAAGAGATTCTCCAACTGG + Intergenic
1047954473 8:129962932-129962954 AGCTGCACCCAATCTCCCTCAGG + Intronic
1048787490 8:138065851-138065873 ATCTGATCAAAATCTTCCACTGG + Intergenic
1055680744 9:78712524-78712546 AGGTGAATAAAATTTCCAACAGG - Intergenic
1057941078 9:99285141-99285163 AGCATATTAAAATCTCCCACAGG + Intergenic
1059833173 9:118121330-118121352 AGCTGAAAAAAATCTTCCTGAGG - Intergenic
1062432991 9:136534247-136534269 TGCTGAACAAACTCTTCCACAGG - Intronic