ID: 1006568511

View in Genome Browser
Species Human (GRCh38)
Location 6:34980644-34980666
Sequence GAAGCCTCCTGGATAAATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006568507_1006568511 7 Left 1006568507 6:34980614-34980636 CCTCTTAAGCTTTCTTTCCCAAA 0: 1
1: 0
2: 0
3: 27
4: 381
Right 1006568511 6:34980644-34980666 GAAGCCTCCTGGATAAATTTAGG 0: 1
1: 0
2: 0
3: 12
4: 139
1006568506_1006568511 8 Left 1006568506 6:34980613-34980635 CCCTCTTAAGCTTTCTTTCCCAA 0: 1
1: 0
2: 4
3: 27
4: 373
Right 1006568511 6:34980644-34980666 GAAGCCTCCTGGATAAATTTAGG 0: 1
1: 0
2: 0
3: 12
4: 139
1006568504_1006568511 10 Left 1006568504 6:34980611-34980633 CCCCCTCTTAAGCTTTCTTTCCC 0: 1
1: 0
2: 1
3: 28
4: 386
Right 1006568511 6:34980644-34980666 GAAGCCTCCTGGATAAATTTAGG 0: 1
1: 0
2: 0
3: 12
4: 139
1006568505_1006568511 9 Left 1006568505 6:34980612-34980634 CCCCTCTTAAGCTTTCTTTCCCA 0: 1
1: 0
2: 4
3: 33
4: 412
Right 1006568511 6:34980644-34980666 GAAGCCTCCTGGATAAATTTAGG 0: 1
1: 0
2: 0
3: 12
4: 139
1006568508_1006568511 -10 Left 1006568508 6:34980631-34980653 CCCAAAAGTAGCAGAAGCCTCCT 0: 1
1: 0
2: 0
3: 16
4: 146
Right 1006568511 6:34980644-34980666 GAAGCCTCCTGGATAAATTTAGG 0: 1
1: 0
2: 0
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006568511 Original CRISPR GAAGCCTCCTGGATAAATTT AGG Intronic
900278091 1:1846096-1846118 GAAGTCTGCTGGCCAAATTTAGG + Intronic
900487886 1:2932106-2932128 GAAGCCCCCAGGATAAAGCTCGG + Intergenic
904928218 1:34065090-34065112 GAAGCCTCCTTGATATGGTTTGG - Intronic
905279066 1:36837315-36837337 AAAGCCCCCTGGAGAAATTGAGG - Intronic
908200187 1:61787385-61787407 GAAGCCTCCAGCATAAAACTGGG - Intronic
910129271 1:83884206-83884228 CAAGCCTCCAGGGGAAATTTTGG + Intronic
911195821 1:94994388-94994410 GAAGCCTCAGGGAATAATTTAGG + Intronic
911337140 1:96594760-96594782 GAATCCTGCTGAATCAATTTAGG - Intergenic
920519048 1:206609778-206609800 GAAGCCAGCTGTATAAAATTTGG + Intronic
921978734 1:221231151-221231173 TCAACCTCCTGGATAAATGTAGG + Intergenic
922216450 1:223523906-223523928 GGAGCCTCCTGGATGCACTTGGG - Intergenic
924448144 1:244153159-244153181 GAAACCTCTTGGCTAAATTCAGG - Intergenic
1073462858 10:103676597-103676619 GAAGCTTCCTGGTTAAAGATAGG + Intronic
1075284264 10:121169507-121169529 TAAGCCTTCTGGAAAACTTTGGG + Intergenic
1079791780 11:24748056-24748078 GAAGCCTCCTGGTTAGAACTGGG - Intronic
1080039871 11:27748188-27748210 TAAGCCTCCTGGGTAATCTTAGG + Intergenic
1082930334 11:58596643-58596665 TAAGCATCTTGGATAAATTCAGG - Intronic
1083072789 11:60003679-60003701 GAAGCCTCCTGGCCAGAATTCGG + Intergenic
1085338197 11:75713578-75713600 GAAGGCTACTGGAGAAATGTGGG - Intergenic
1086895772 11:92310813-92310835 GTAGTTTCATGGATAAATTTAGG + Intergenic
1090543972 11:127741003-127741025 GAATACACATGGATAAATTTAGG - Intergenic
1091994462 12:4982326-4982348 TAAGCCTCCTGGGAAAAATTGGG + Intergenic
1093982874 12:25494043-25494065 GGAGCCTCCTGGATAGGTTGGGG - Intronic
1094386912 12:29904531-29904553 GAAGACTCCTTTATTAATTTTGG - Intergenic
1095115116 12:38343922-38343944 GAAGCCTCCTGGCCAGAATTCGG + Intergenic
1095180351 12:39140958-39140980 AAATCCTCCTTGATGAATTTTGG - Intergenic
1099032683 12:77547104-77547126 GTGGCCTCCTGGATAGCTTTAGG - Intergenic
1100690310 12:97032397-97032419 GATGCCTCCTGGTTAAATTCGGG + Intergenic
1100929179 12:99586011-99586033 GAAGCCAGCTGCAGAAATTTGGG - Intronic
1101635346 12:106535768-106535790 GAAGCCTCCTGGCTAGAACTTGG - Intronic
1102255193 12:111410931-111410953 GAGGCCTCCTGGTTGAATCTAGG - Intronic
1106270639 13:28150206-28150228 GAAGCCTCCTTGATACATGATGG + Intronic
1109082170 13:57918541-57918563 GTAGCTTCATGGATAAATTTTGG - Intergenic
1110661267 13:78061266-78061288 GAAGCCTCCTGGCCAGAATTTGG - Intergenic
1110671666 13:78187753-78187775 GAACCCTCTTGGATTATTTTAGG + Intergenic
1111541135 13:89668680-89668702 AAAGCCACTTGGATAAATGTGGG - Intergenic
1112043764 13:95574845-95574867 GAAACTTTCTGGAGAAATTTAGG - Intronic
1114819530 14:26001036-26001058 GAAACTTACAGGATAAATTTTGG - Intergenic
1116719017 14:48469187-48469209 GAGGACCCTTGGATAAATTTAGG + Intergenic
1117193121 14:53313130-53313152 CAACCCTCCTGGATTAATTGAGG - Intergenic
1117510849 14:56449133-56449155 GAAGCCTCCTGGGTAGAACTTGG - Intergenic
1119977217 14:79038509-79038531 GAAACCTGCTGAAAAAATTTTGG - Intronic
1121834459 14:97079424-97079446 GAAGCCACCTGGATTAGTTAGGG + Intergenic
1121893260 14:97618922-97618944 GAATCATCCTTCATAAATTTTGG - Intergenic
1123585111 15:21753059-21753081 GAGGCCGCCTGGATTATTTTTGG + Intergenic
1123621758 15:22195666-22195688 GAGGCCGCCTGGATTATTTTTGG + Intergenic
1126584289 15:50267448-50267470 GAAGCCTCCTGCATTAGTCTAGG - Intergenic
1127031078 15:54863574-54863596 GAAGCCTCCTGGCTAGAACTTGG + Intergenic
1134817788 16:17220425-17220447 GAGGCAGTCTGGATAAATTTGGG + Intronic
1138988058 16:62355728-62355750 GAATTCTCCTGGATAACTTTAGG + Intergenic
1141032089 16:80597695-80597717 GAAGCCTCCTGGCCAAATCTGGG + Intergenic
1141185121 16:81781365-81781387 GGGGCCTCCTGGATAAATAATGG - Intronic
1141801513 16:86312554-86312576 GAAGCCTCCTGTATTAGTGTAGG - Intergenic
1144616350 17:16778132-16778154 CAACCCTCCTGGATTAAATTAGG + Intronic
1145226690 17:21135293-21135315 AATGCCTCCTGTATAATTTTTGG + Intronic
1149029698 17:52068782-52068804 GAAGCCTTCTGAATAAACTTGGG - Intronic
1152241969 17:79165613-79165635 GGAGCCCCCTGGAGAAATTCTGG + Intronic
1155774350 18:29739672-29739694 AATGCCACCTGGAAAAATTTAGG - Intergenic
1156105342 18:33652918-33652940 GAAGCTTCATGGAGAAATTGGGG + Intronic
1158002547 18:52636325-52636347 GAAGCCTCCTGGACAGAACTTGG + Intronic
1158348205 18:56537373-56537395 GAATCCTCCTGGTTAAGATTTGG + Intergenic
1160117617 18:76096611-76096633 GAAGCTCCCTGGACAAATCTGGG + Intergenic
1164541793 19:29126985-29127007 GAAGCCTCCTGGAGCACATTTGG - Intergenic
1165789767 19:38484322-38484344 GAAGCCTCCTGGGTGAGTCTGGG - Intronic
1166009164 19:39928288-39928310 GAAGCCTCCTGGGTCAATCCTGG + Exonic
1167811890 19:51840495-51840517 GAAGCCACCTGGGTACATTTGGG + Intergenic
926203918 2:10821435-10821457 GAGGCCTCCTGGGTAAATCGGGG - Intronic
927179368 2:20433737-20433759 GCAGCCTCCTGTTTAACTTTTGG - Intergenic
927274405 2:21250144-21250166 GAGGACTCATGGATTAATTTGGG - Intergenic
927751160 2:25672532-25672554 GAAGCCTATGGGAGAAATTTGGG - Intronic
929595877 2:43175446-43175468 GAAAACTTCTGGATAAATTAAGG + Intergenic
929839629 2:45444427-45444449 GAAACCTCCTGTATACACTTGGG + Intronic
931997598 2:67854055-67854077 GAAGCCTCCAGGGTAACTTTAGG + Intergenic
937491866 2:122377950-122377972 GAAGCCTCCTGGGCTTATTTAGG + Intergenic
938038152 2:128053539-128053561 GAAGCCTCCTGGCCAGAATTGGG - Intergenic
938999833 2:136721522-136721544 GTAGCTTCATGGAGAAATTTAGG + Intergenic
939429207 2:142081358-142081380 GAAGCATCCTGGTAAAATGTGGG - Intronic
943024825 2:182615204-182615226 AAAGCCTCCTGAATAAAAGTAGG + Intergenic
1169517532 20:6333534-6333556 GAAGCCTCCTGGCTAGAACTTGG - Intergenic
1170417365 20:16158751-16158773 GGAGCCTCCAGCCTAAATTTAGG + Intergenic
1174705275 20:52648789-52648811 GAAGCCACATGGATAAAATAGGG - Intergenic
1177082425 21:16656779-16656801 GAGGAGTCCTGGATAAATGTAGG - Intergenic
1178139229 21:29663379-29663401 GGAGCCTCCTGTATAAATGCTGG + Intronic
1180878877 22:19189672-19189694 CAACCCTCATGGATAACTTTGGG - Intronic
1184837500 22:47032566-47032588 GAAGCCTCCTGTGTAAAATGTGG + Intronic
950146523 3:10653954-10653976 GAGGCCTTCTTGATAATTTTAGG + Intronic
951983721 3:28594564-28594586 GAAGCCCCATGGAGAGATTTAGG - Intergenic
953353352 3:42232791-42232813 AAAGCCTCATAGAAAAATTTTGG - Intergenic
954915869 3:54148351-54148373 GGAGCCACTTGGTTAAATTTTGG + Intronic
959557786 3:107742147-107742169 GATGCCTTCTTGAGAAATTTGGG + Intronic
959837214 3:110933568-110933590 AAAGCCTCCTGGATTGAATTTGG - Intergenic
959975022 3:112448965-112448987 GAAGCCACCAGGAAAAATTAGGG - Intergenic
968039668 3:195578658-195578680 AAAGCCCCCTGGAGAATTTTGGG + Intronic
969638722 4:8384123-8384145 GAAGCCTCATGGATTAATTCTGG - Intronic
971435531 4:26618784-26618806 GGAACCTGCTGGATAAATGTAGG + Intronic
974428792 4:61770210-61770232 AAAGCCTCCTCTATAAATGTAGG - Intronic
975607628 4:76171378-76171400 GAACCCTCCTTAATAAACTTTGG + Intronic
977620000 4:99125362-99125384 GAAGCCTCCTGGGAGAATGTGGG + Intronic
978299150 4:107246389-107246411 TAATCCACCTAGATAAATTTAGG + Intronic
979077600 4:116293731-116293753 GAAGCCAACTGTATAAATTTGGG - Intergenic
979117143 4:116840025-116840047 GAAGCCTCCTGGGGGAATTGTGG - Intergenic
979118762 4:116865565-116865587 GAAGTTTCCTGGAAAATTTTTGG + Intergenic
981146540 4:141332169-141332191 GAAGCCTCCTTAAAAAATTTCGG - Intergenic
981475371 4:145181379-145181401 GAAGCATGCTGGATAAATTCTGG - Intergenic
981577154 4:146217242-146217264 GAAGCTTCCTGGACTAAATTTGG + Intergenic
981904202 4:149902205-149902227 GAAGGCTCATGGAAAAATATAGG + Intergenic
982680219 4:158419389-158419411 GAAGCCTCCTGGCCAGAATTTGG - Intronic
989785232 5:45319267-45319289 GAAGCATCCAGGAAAACTTTTGG - Intronic
997205173 5:132043913-132043935 GAAGCAGCCTGGCCAAATTTTGG + Intergenic
997825900 5:137106657-137106679 GAAGCCTCCTGGAATCATCTGGG - Intronic
999398943 5:151249727-151249749 GCATCCTCCTGGAAAAATTCTGG + Intronic
1003450809 6:6230084-6230106 GAAGCCTCCTGGCCAAAACTTGG + Intronic
1005258347 6:24029253-24029275 TAAGCCTCATGGTTCAATTTGGG - Intergenic
1005261709 6:24068180-24068202 GAGGCCACCTGGATAATTTAGGG - Intergenic
1005882040 6:30069344-30069366 GTAGCCACATGGATACATTTAGG - Exonic
1006568511 6:34980644-34980666 GAAGCCTCCTGGATAAATTTAGG + Intronic
1006776961 6:36601246-36601268 TAAGCCACCTGGAAAAGTTTAGG - Intronic
1010565990 6:77414640-77414662 CAACCCTCATGGATGAATTTCGG - Intergenic
1010813978 6:80333207-80333229 CAAGGCTCCTGGTTAATTTTAGG - Intronic
1011133212 6:84073074-84073096 GAAGCCTCCTGGCCAGAATTCGG - Intronic
1011947404 6:92923425-92923447 GATGCCTCCTGGAAAATATTAGG - Intergenic
1017900684 6:158716291-158716313 CAAGCCTTCTTGAGAAATTTGGG - Intronic
1019616247 7:1963933-1963955 GATGCCTCCTGGAGAGGTTTTGG + Intronic
1023503501 7:40875845-40875867 GAAGCCTCCTGGAAAGCTTCTGG + Intergenic
1027518754 7:79176537-79176559 GTGGCCTCTTGGATATATTTTGG + Intronic
1027541048 7:79466160-79466182 GAACCCTGCTGGCCAAATTTTGG - Intergenic
1031654759 7:124340922-124340944 CAACCCTCATGGATAATTTTTGG - Intergenic
1034963436 7:155376201-155376223 GATGCCTCCTGCCTACATTTGGG - Intergenic
1035270519 7:157717167-157717189 AAAGCCTCGTGGATCGATTTTGG - Intronic
1036966887 8:13308870-13308892 GAAGGGACCTGGATAGATTTGGG + Intronic
1037447601 8:18982335-18982357 CAACCCTCATGGATAACTTTAGG - Intronic
1051510309 9:17870295-17870317 GAAGCCTCCTGGACAAAGGCAGG - Intergenic
1051571327 9:18562580-18562602 GAAGTCTCCTGGATAATATCTGG + Intronic
1052610018 9:30759476-30759498 GCAGCCTCTTGGAGAACTTTTGG + Intergenic
1053573816 9:39337228-39337250 AATGCCTCCTGCATAAATCTAGG - Intergenic
1053624994 9:39860309-39860331 AATGCCTCCTGCATAAATCTAGG - Intergenic
1053879876 9:42582919-42582941 AATGCCTCCTGCATAAATCTAGG + Intergenic
1054116844 9:61171836-61171858 AATGCCTCCTGCATAAATCTAGG - Intergenic
1054218903 9:62390389-62390411 AATGCCTCCTGCATAAATCTAGG + Intergenic
1054231814 9:62518780-62518802 AATGCCTCCTGCATAAATCTAGG - Intergenic
1054590909 9:67010727-67010749 AATGCCTCCTGCATAAATCTAGG + Intergenic
1058161825 9:101578578-101578600 GAAGCCTTCTGACTATATTTTGG + Intronic
1187278532 X:17837726-17837748 GAAGCCTGCTGGGTTAAGTTGGG + Exonic
1187572650 X:20520720-20520742 AAAGCCTCCTGATTATATTTAGG - Intergenic
1189784044 X:44543261-44543283 GGAGCCTCCTGACTAAAGTTTGG - Intergenic
1191914832 X:66190116-66190138 GAAACTTGCTGGATAACTTTGGG + Intronic
1193200599 X:78685855-78685877 GAATCTTCATGGACAAATTTGGG - Intergenic
1193245873 X:79228694-79228716 GATTCTTCCTGGTTAAATTTTGG + Intergenic
1193275230 X:79578773-79578795 GAAGCTTCCTAAACAAATTTTGG + Intergenic
1196973707 X:121136835-121136857 GTAGCCTCCAGGGTAAATTGAGG - Intergenic
1200741761 Y:6861679-6861701 GATGACTCCTGGGTAAATTAAGG - Intergenic
1201973739 Y:19823902-19823924 GAAGCCTACTTGATAACTTTGGG - Intergenic