ID: 1006574131

View in Genome Browser
Species Human (GRCh38)
Location 6:35031530-35031552
Sequence CAAAATGGGGAGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1815
Summary {0: 1, 1: 3, 2: 18, 3: 175, 4: 1618}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006574131_1006574139 -8 Left 1006574131 6:35031530-35031552 CCTTCCTCCTCCTCCCCATTTTG 0: 1
1: 3
2: 18
3: 175
4: 1618
Right 1006574139 6:35031545-35031567 CCATTTTGTGCCAGTCGCCAGGG No data
1006574131_1006574137 -9 Left 1006574131 6:35031530-35031552 CCTTCCTCCTCCTCCCCATTTTG 0: 1
1: 3
2: 18
3: 175
4: 1618
Right 1006574137 6:35031544-35031566 CCCATTTTGTGCCAGTCGCCAGG 0: 1
1: 0
2: 0
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006574131 Original CRISPR CAAAATGGGGAGGAGGAGGA AGG (reversed) Intronic
900029296 1:359295-359317 AGGAGTGGGGAGGAGGAGGAGGG - Intergenic
900049898 1:588067-588089 AGGAGTGGGGAGGAGGAGGAGGG - Intergenic
900086073 1:897981-898003 CACACTGATGAGGAGGAGGAAGG - Intergenic
900753019 1:4411569-4411591 CAAAAGGAAGAGGAGGAGGAAGG - Intergenic
900799770 1:4729973-4729995 CACAATGGGGAGTAGAAGGAAGG - Intronic
900950854 1:5857677-5857699 CAACAGGGGCAGGAGGAGGGAGG + Intergenic
901017263 1:6239041-6239063 CAAAATGGGGCTGATGAAGAGGG - Intergenic
901236445 1:7669961-7669983 CAGAAAGTGGAGGAGGAGGGTGG - Intronic
901344803 1:8530493-8530515 CAAAATGGGGAGGCGGGGCGGGG + Intronic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901865025 1:12100645-12100667 CAAGATTTGGAGGAGGAAGACGG - Intronic
902037718 1:13469712-13469734 GACATTGGGGAGGAGGGGGAGGG + Intergenic
902049028 1:13547272-13547294 GAAGAGGGGGAGGAGGAAGATGG - Intergenic
902058255 1:13620129-13620151 AAAAAATGGGAGGAGGAGCAAGG - Intergenic
902165799 1:14570384-14570406 AGGAATTGGGAGGAGGAGGAGGG - Intergenic
902178421 1:14669155-14669177 CAAGTTGGGGTGGAGGTGGATGG - Intronic
902231265 1:15029189-15029211 CATCATGGTGAGGAGGAGGGTGG + Intronic
902267008 1:15274690-15274712 AATAATGAGGAGGAGCAGGAGGG + Intronic
902596287 1:17511751-17511773 CAAAAGTGGGATGAGGATGAGGG + Intergenic
902980885 1:20122105-20122127 GATGATGAGGAGGAGGAGGACGG - Intergenic
903165154 1:21515046-21515068 CAAGCTGGAGTGGAGGAGGAGGG - Intronic
903389922 1:22956389-22956411 GAGAAAGAGGAGGAGGAGGAAGG + Intronic
903529689 1:24020717-24020739 CAAGTTGGGGAGGAGGGAGAGGG - Intergenic
903548632 1:24142625-24142647 CTGACAGGGGAGGAGGAGGAAGG - Intronic
903947458 1:26972656-26972678 CAGAAATGGGAGGAGGAGGATGG + Intergenic
903958953 1:27044597-27044619 GAAGATGGAGATGAGGAGGATGG + Intergenic
904061461 1:27714302-27714324 CAAGATGGGAAGGAGGATGTCGG + Intergenic
904253378 1:29239687-29239709 AAAAGGGGGGAGGGGGAGGAAGG - Intronic
904365956 1:30010934-30010956 AGACATGGGGAGGAGGCGGACGG - Intergenic
904405393 1:30285084-30285106 TAAAATGGAGAGGATGATGAAGG - Intergenic
904409391 1:30315921-30315943 CAGAAGGGGGAGGAGAAGGGAGG - Intergenic
905300959 1:36985926-36985948 CACAGTGAGGAGGAGGGGGAGGG - Intronic
905353058 1:37360693-37360715 CCAGGTGTGGAGGAGGAGGAGGG - Intergenic
905354602 1:37372640-37372662 GCAAAAGGGGAGGAGGTGGAGGG - Intergenic
905461941 1:38127831-38127853 CAGAATGGCAAGGAGGAGGAGGG - Intergenic
905693472 1:39958913-39958935 CAGAAGGGTGAGGAGAAGGAAGG + Intronic
905731048 1:40299787-40299809 GGCAGTGGGGAGGAGGAGGAGGG + Intergenic
905867967 1:41386585-41386607 AAGAAAGGGGAGGAGGAGAAAGG - Intergenic
906223477 1:44102077-44102099 CAAAATGGGAACAAAGAGGAAGG + Intergenic
906414934 1:45614105-45614127 GAAAATGAGGAGGAGGAGATTGG + Exonic
906566213 1:46803044-46803066 CAGAATGGAGAGGATGAGGCTGG + Intronic
906636839 1:47415911-47415933 CAAAATGGGGAGGAGCAAAATGG + Intergenic
906843969 1:49169977-49169999 CAGAAGGGGGAAGAGCAGGAGGG + Intronic
906930890 1:50168215-50168237 CAAACTGGGGAAGAGAAGGCAGG + Intronic
906994621 1:50778662-50778684 CAAACTGAAGAGAAGGAGGAAGG + Intronic
907016017 1:51013849-51013871 CAAGAAGATGAGGAGGAGGAAGG + Intergenic
907088918 1:51706474-51706496 CAAAAATGACAGGAGGAGGAAGG - Intronic
907167383 1:52425856-52425878 CAAAATAGGGAGGGGGTGGGGGG + Intronic
907278553 1:53330017-53330039 CACAGAGTGGAGGAGGAGGAGGG - Intergenic
907313603 1:53553851-53553873 CAGAACGGGCAGGTGGAGGATGG + Intronic
907318053 1:53585213-53585235 AAAAATGGGGAGGTGGGGGAAGG + Intronic
907461537 1:54608429-54608451 AAACATGGGGAGGAGGCTGAGGG + Intronic
907488078 1:54790841-54790863 AAGAAGGAGGAGGAGGAGGACGG - Intronic
907700271 1:56779645-56779667 CAAAATGATGGGGAGAAGGATGG - Intronic
907758853 1:57337968-57337990 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
907966649 1:59337340-59337362 CAAAAGGGAGAGAGGGAGGAAGG + Intronic
907972861 1:59401865-59401887 GATTATGGAGAGGAGGAGGAAGG + Intronic
908061495 1:60354956-60354978 CAAAATGGGGTGGAGGGGGAGGG + Intergenic
908302591 1:62776965-62776987 CAAAATTGGGAGGCCGAGGTGGG - Intergenic
908318839 1:62961628-62961650 CAGAATGGGGAGGAGGGGGGTGG - Intergenic
908331076 1:63071863-63071885 TAAAAAGGGGATGAGGATGACGG + Intergenic
908355356 1:63322187-63322209 CAAAGTGGGGGGGAGAAGGGCGG + Intergenic
908441661 1:64161367-64161389 CAAGTTGGGAAGGAGGAGGGAGG + Intronic
908700223 1:66890705-66890727 GAGGAGGGGGAGGAGGAGGAGGG + Intronic
908855394 1:68421141-68421163 CAAATGGGGGAGGAGGAGATTGG - Intergenic
909154688 1:72058494-72058516 GAAAATGGTGAAGAGGAAGAAGG + Intronic
909334487 1:74455762-74455784 CAGAATGAGGAGGCAGAGGAAGG - Intronic
909686550 1:78355217-78355239 CAAAAAAAGGAGGAGGAGAAAGG - Intronic
910180916 1:84481565-84481587 GAGAATGGGGAGTGGGAGGACGG + Intronic
910344255 1:86217486-86217508 GAAGATGGGGAGGTGGATGAGGG + Intergenic
910406467 1:86896248-86896270 CAAAGAGGGGGGGAGGGGGAGGG + Intronic
910574658 1:88747092-88747114 TGAACTGGGGAGGGGGAGGATGG + Intronic
910581161 1:88826579-88826601 CAGAAGGGTGAGGAGGTGGAAGG - Intronic
910597919 1:88999166-88999188 CAAAATTGGGAGAAGGGAGACGG - Intergenic
911085031 1:93969173-93969195 CAAGATGTGGAGGTGGAAGAAGG + Intergenic
911320726 1:96410569-96410591 GAAATGGAGGAGGAGGAGGAGGG - Intergenic
911364008 1:96914894-96914916 CAAACTGTGGAAGAGGATGAGGG + Intergenic
911991270 1:104699679-104699701 CAAAAGGTGGAGGAGGTGGAAGG - Intergenic
912512944 1:110200890-110200912 CAAGAGGAGGAGGAGGAGGCAGG - Exonic
912703491 1:111895383-111895405 CCAAATGGGGAGGTGGGGGAAGG + Intronic
912933351 1:113983033-113983055 GAGAAGGGAGAGGAGGAGGAAGG + Intergenic
913083589 1:115413107-115413129 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
913245905 1:116869735-116869757 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
913413516 1:118578923-118578945 CATAATGTGGAGGAGGTAGAGGG + Intergenic
913939863 1:125091643-125091665 AAAAAGGAGGAGGAGGGGGAAGG + Intergenic
913955355 1:143285387-143285409 CAAAATGGGGAAGATGAGTGGGG + Intergenic
913979212 1:143493449-143493471 AAAAAGGAGGAGGAGGGGGAAGG - Intergenic
913982076 1:143530057-143530079 CAAAATGGGGAAGATGAGTGGGG - Intergenic
914043603 1:144072783-144072805 AAAAAGGAGGAGGAGGGGGAAGG - Intergenic
914058053 1:144183179-144183201 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
914073615 1:144319099-144319121 AAAAAGGAGGAGGAGGGGGAAGG - Intergenic
914105540 1:144647261-144647283 AAAAAGGAGGAGGAGGGGGAAGG + Intergenic
914134484 1:144887708-144887730 AAAAAGGAGGAGGAGGGGGAAGG + Exonic
914739056 1:150447965-150447987 CAAAACTGGGAGAAGGAGAAAGG - Intronic
914741966 1:150472755-150472777 CAGGAGGGGGAGGAGGAGGTGGG - Exonic
914763380 1:150617159-150617181 CAATTTGAGGAGGTGGAGGAAGG - Intronic
914813369 1:151045908-151045930 GAAAATGGGGGGAAGGAGAAAGG - Intronic
914857275 1:151361980-151362002 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
914932697 1:151949242-151949264 AAAAAAGAGGAGGAGGAGGAAGG - Intergenic
914960087 1:152197411-152197433 GAGAAGGGGAAGGAGGAGGAGGG - Intergenic
915120902 1:153629067-153629089 CAAAAATGGGAGGAGGAGAAAGG - Intronic
915168375 1:153961421-153961443 CACAATGGGGAGGGGGATGGAGG - Intronic
915557837 1:156670124-156670146 GAAAAGGAGGAGGGGGAGGAGGG - Exonic
915593888 1:156885603-156885625 CAGGATAGAGAGGAGGAGGAAGG - Intergenic
915866980 1:159512363-159512385 AAAAATAGGGAGGAGGAAGAGGG - Intergenic
915915403 1:159937635-159937657 AAGGACGGGGAGGAGGAGGATGG - Intronic
915917269 1:159948080-159948102 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
916075631 1:161198541-161198563 CACAATGGGGAGCAGGAGGCAGG + Exonic
916239044 1:162621208-162621230 CAACAGGGAGAGGAGGAAGAAGG + Intergenic
916657077 1:166885796-166885818 CAAGAGGAGAAGGAGGAGGAGGG - Intergenic
916929053 1:169555536-169555558 TAAAAGGGGGAAAAGGAGGAGGG + Intronic
917131122 1:171742747-171742769 CCAAATTGGGCGGAGGGGGAGGG - Intergenic
917169621 1:172156614-172156636 AAAAAACAGGAGGAGGAGGAGGG - Intronic
917369480 1:174275146-174275168 AAGAATGGAGAAGAGGAGGAAGG + Intronic
917383815 1:174446084-174446106 CAGGATGAGGAGGAGGAGTAGGG + Intronic
917433843 1:174999540-174999562 AAAAATGGGGAGGAGCAGCCTGG - Intronic
917517778 1:175722212-175722234 CGATAGGGGAAGGAGGAGGAGGG - Intronic
917524216 1:175773035-175773057 GAAGAGGAGGAGGAGGAGGAGGG + Intergenic
917569146 1:176246310-176246332 AAAATTGGGGAAGAGGAAGATGG + Intergenic
917691715 1:177476727-177476749 GTAAATGGGGAAAAGGAGGAGGG + Intergenic
917920781 1:179747937-179747959 GGAAAGGGGGAGGAGGGGGAGGG + Intronic
918069511 1:181124592-181124614 CAGAAGGAGGAGGAGGAGGGAGG - Intergenic
918078702 1:181189959-181189981 CAAAAGGGAGAGAAGGTGGAAGG - Intergenic
918148943 1:181781610-181781632 CAGGCTGGGGAGGTGGAGGAGGG + Intronic
918372281 1:183872831-183872853 AAAAATGGGGAAAAGGAGGAGGG + Intronic
918383598 1:183983346-183983368 GACATTGGGGAGGAGGAGCAGGG - Intronic
918536657 1:185582408-185582430 AAAAATGGGGAGTATGAGTAAGG - Intergenic
918663070 1:187113763-187113785 GGAAATGGGGAGGAGGGCGAGGG - Intergenic
918670104 1:187204207-187204229 CTGAATTGGGAGGAGGAGAATGG - Intergenic
919085780 1:192918757-192918779 GATGTTGGGGAGGAGGAGGAAGG + Intergenic
919176734 1:194028458-194028480 AAAAAGGAGGAGGAGGAGGAGGG - Intergenic
919441658 1:197641293-197641315 AAAAATGAGGAGGAGGAGCTGGG + Intronic
919449334 1:197751867-197751889 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
919449350 1:197751936-197751958 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
919479481 1:198069862-198069884 CAAAATGGGGGAGAGAGGGAGGG - Intergenic
919493159 1:198230279-198230301 CAAGGTCGGGAGGAGGATGAAGG - Intronic
919811032 1:201408965-201408987 TAACAAGTGGAGGAGGAGGAGGG - Exonic
919876742 1:201874867-201874889 GAAGAGGAGGAGGAGGAGGATGG + Exonic
920559877 1:206931481-206931503 AAAAAGGGTGAGGAGGAAGAAGG - Exonic
920910933 1:210215683-210215705 TAGAGTAGGGAGGAGGAGGAGGG + Intergenic
921396866 1:214677825-214677847 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
921543100 1:216442693-216442715 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
921730778 1:218575717-218575739 CAAAATGAGGAGGCAGAGGTGGG - Intergenic
921889434 1:220339079-220339101 CAAACCAGGAAGGAGGAGGATGG - Intergenic
922095845 1:222442150-222442172 CAAAGTGGGGAGGCAGAGGGTGG - Intergenic
922213258 1:223501191-223501213 GAAAAGGAGGAGGGGGAGGAGGG - Intergenic
922224418 1:223632929-223632951 CCAGATGGGAAGAAGGAGGAAGG - Intronic
922315015 1:224434525-224434547 GAGGAGGGGGAGGAGGAGGAGGG + Intronic
922501723 1:226101925-226101947 CAAGATGTGGAGGTGGAAGATGG + Intergenic
922879022 1:228965243-228965265 CAGGCTGAGGAGGAGGAGGATGG - Intergenic
923010304 1:230083163-230083185 CAGAGTGGGGAGCAGGATGATGG + Intronic
923051375 1:230393257-230393279 GAAAAGGGGGAGGAGGAGGGAGG + Intronic
923063563 1:230498310-230498332 AAAAATGGGGAGGATGATGATGG - Intergenic
923103065 1:230832658-230832680 CAAAATGAGGGGGTGGAGGGAGG + Intergenic
923290760 1:232543403-232543425 GAAAAGGTGGAGGAGGTGGAAGG - Intronic
923359759 1:233199369-233199391 ATAAATGGGAAGGAGAAGGAGGG + Intronic
923544403 1:234913837-234913859 CAGAATGGGCAGGAGGAGATCGG - Intergenic
923766913 1:236901052-236901074 GAGAATCTGGAGGAGGAGGAGGG + Exonic
923834131 1:237591133-237591155 GAGGAGGGGGAGGAGGAGGAGGG - Intronic
923834138 1:237591148-237591170 GAGAAGGGGGAAGAGGAGGAGGG - Intronic
923834144 1:237591163-237591185 GAGAAGGGGGAGGAGGAGAAGGG - Intronic
923834150 1:237591178-237591200 GAGAAGGGGGAGGAGGAGAAGGG - Intronic
923834156 1:237591193-237591215 GAGAAGGGGGAGGAGGAGAAGGG - Intronic
923834162 1:237591208-237591230 GAGAAGGGGGAGGAGGAGAAGGG - Intronic
923834168 1:237591223-237591245 CACAAAGAGGAGGAGGAGAAGGG - Intronic
923920670 1:238561080-238561102 GAAGAAGTGGAGGAGGAGGAGGG - Intergenic
924156073 1:241177870-241177892 AAAAGTGGGGAGGAAAAGGAGGG + Intronic
924327327 1:242908990-242909012 GAAAAGGAGGAGGAGGAGGAAGG - Intergenic
924493035 1:244558735-244558757 CAGAGTGGGCAGGAGGAGAAGGG - Intronic
924608680 1:245556345-245556367 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1063058077 10:2524011-2524033 CAAAGCGAGGAGGGGGAGGAGGG - Intergenic
1063159443 10:3408707-3408729 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063159481 10:3408849-3408871 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1063201988 10:3792958-3792980 GAACAAGAGGAGGAGGAGGAGGG + Intergenic
1063201989 10:3792961-3792983 CAAGAGGAGGAGGAGGAGGGAGG + Intergenic
1063225759 10:4013414-4013436 CAAAGTGGGGAGGAGAAGGAAGG - Intergenic
1063257099 10:4340467-4340489 AAAAGGAGGGAGGAGGAGGAAGG - Intergenic
1063288481 10:4715332-4715354 AAAAATGTGTAGGAGGTGGATGG - Intergenic
1063438121 10:6050787-6050809 CAGGACGAGGAGGAGGAGGATGG + Intronic
1063443164 10:6089446-6089468 CATGAGGAGGAGGAGGAGGAAGG - Exonic
1063602991 10:7498810-7498832 CCAAAAGAGGAGGAGGAGGGAGG + Intergenic
1063897974 10:10702169-10702191 CAAAAAGAGGAGGAACAGGAAGG + Intergenic
1064089367 10:12370537-12370559 CAAGATGTGGAGGTGGAAGACGG + Intronic
1064111605 10:12544103-12544125 AAATATGGGGAAAAGGAGGAAGG + Intronic
1064496121 10:15912100-15912122 ACAAAGGAGGAGGAGGAGGAAGG + Intergenic
1064670906 10:17713068-17713090 CAAATGGAGGAGGAGGAGAATGG - Intronic
1064686504 10:17867258-17867280 GAAGAAGAGGAGGAGGAGGAAGG - Intronic
1064823413 10:19366054-19366076 CATACTGGGGAGTAGGGGGAAGG + Intronic
1065050534 10:21787337-21787359 AAAAAGGAGGAGGAGGAGGAAGG + Intronic
1065150816 10:22821339-22821361 CAAAATGAGGAGGAGCTTGAAGG + Intergenic
1065296875 10:24284378-24284400 CAAAAGGGGGAAGAGTGGGAGGG - Intronic
1065423020 10:25568107-25568129 CAAAGTGGGTTGGAGAAGGAAGG + Intronic
1065495353 10:26321842-26321864 GGAATTGGAGAGGAGGAGGATGG + Intergenic
1065623830 10:27610681-27610703 GAAGAAGAGGAGGAGGAGGAAGG - Intergenic
1065667871 10:28082456-28082478 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1065684530 10:28270528-28270550 AAAAAGGGGGGGGGGGAGGAGGG + Intronic
1065966995 10:30778761-30778783 CAAGAGGAGGAGGAAGAGGAAGG + Intergenic
1066081398 10:31934226-31934248 GATAAAGGGGAGGAGGAGGAAGG - Intergenic
1066779371 10:38927339-38927361 CAAAATGGGGAAGACGAGTGGGG - Intergenic
1066780271 10:38938142-38938164 AAAAAGGAGGAGGAGGGGGAGGG - Intergenic
1066951849 10:42126280-42126302 CAAAATGGGGAAGATGAGTGGGG + Intergenic
1066956019 10:42173428-42173450 AAAAAGGAGGAGGAGGGGGAGGG - Intergenic
1067203132 10:44192239-44192261 AAAAATGAAGAGGAGAAGGATGG + Intergenic
1067275888 10:44833891-44833913 GAAGATGGGAAGGAGGTGGAGGG - Intergenic
1068007687 10:51409606-51409628 CAACACGGGGAGGCTGAGGAGGG + Intronic
1068244276 10:54343370-54343392 CAAAAGGGAAAGGGGGAGGAAGG - Intronic
1068398946 10:56503389-56503411 GAAAATGGAGGGTAGGAGGAGGG + Intergenic
1068435759 10:56989085-56989107 GAGGAGGGGGAGGAGGAGGAAGG + Intergenic
1068753986 10:60630179-60630201 CAAATTGGTAATGAGGAGGAGGG - Intronic
1069079337 10:64071050-64071072 CAAAAGGAGGGAGAGGAGGAGGG - Intergenic
1069612112 10:69780961-69780983 GAAGAGGAGGAGGAGGAGGAAGG - Intergenic
1069692091 10:70360391-70360413 GAGGAGGGGGAGGAGGAGGAGGG - Intronic
1069718486 10:70535452-70535474 AAAAGTGGGGAAGAGGAAGAGGG - Intronic
1069780839 10:70954401-70954423 GAAGATGAGGAGGAGGAGGCCGG - Intergenic
1069820125 10:71222515-71222537 CCAAATCGGGGGGTGGAGGAGGG - Intronic
1069921927 10:71820673-71820695 CATTTTGGGGAGGAGGATGAAGG + Intronic
1070279409 10:75037849-75037871 CAGGACGGTGAGGAGGAGGATGG - Exonic
1070295481 10:75157566-75157588 CAAAATGGAGAGGAGGATGGAGG + Intronic
1070326128 10:75390430-75390452 GAAGAGGGGGAGGGGGAGGAGGG - Intergenic
1070354586 10:75627303-75627325 CAAAGTGGGAAGCAGGTGGAAGG + Intronic
1070711863 10:78688986-78689008 GGAATGGGGGAGGAGGAGGAAGG - Intergenic
1070894897 10:79975356-79975378 CACACTGATGAGGAGGAGGAAGG - Intronic
1071065191 10:81624269-81624291 CAGAAGGGTGAGGAGGTGGAAGG + Intergenic
1071199885 10:83209427-83209449 CATAATGAGGGGGTGGAGGAGGG - Intergenic
1071347920 10:84710972-84710994 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1071476653 10:86031405-86031427 CAAAAGGGGGGGCAGGAGGAGGG + Intronic
1071483377 10:86081018-86081040 GACAAGGGAGAGGAGGAGGATGG + Intronic
1071751139 10:88477464-88477486 GACAATGGGGAAGAGGATGATGG + Intronic
1071824164 10:89307889-89307911 TAGACTGGGAAGGAGGAGGAAGG - Exonic
1071965409 10:90846829-90846851 CTAAAGGGGGAAGGGGAGGACGG + Intronic
1072009370 10:91290241-91290263 CAGAGTGGGAAGCAGGAGGAGGG + Intergenic
1072066038 10:91872667-91872689 AAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1072195760 10:93116081-93116103 GAGGAGGGGGAGGAGGAGGAGGG + Intergenic
1072249814 10:93572621-93572643 CTGAGTGGGGAGGAGGAGGTGGG + Intronic
1072252336 10:93591398-93591420 CAAAATGTTGATGGGGAGGAGGG - Intronic
1072427145 10:95339155-95339177 CGACTTGGGGAGGAGGAGAAAGG + Exonic
1072519521 10:96218775-96218797 CAGAAAGAGGAGGGGGAGGATGG - Intronic
1072540139 10:96392144-96392166 CTAGATGGGGAGGAGGGAGAAGG + Intronic
1072578589 10:96720940-96720962 CAGGAAGGGGAAGAGGAGGAGGG + Intergenic
1072895720 10:99365021-99365043 TACGATGGGGAGGACGAGGAAGG - Intronic
1073282203 10:102362845-102362867 CAAAGTGGGGAGGAGGAAAAAGG - Intronic
1073325787 10:102643543-102643565 GAAAGTGGGGAGGAGGGGGCCGG + Intergenic
1073336514 10:102714289-102714311 CAGGAGGAGGAGGAGGAGGAGGG - Exonic
1073371663 10:102995202-102995224 AAAAAGGAGGAGGAAGAGGAAGG - Intronic
1073597832 10:104817715-104817737 AAAAAAGGGGAAGAGGAGGAGGG - Intronic
1074064040 10:109996492-109996514 CAAAAATGGGGGAAGGAGGAAGG + Intronic
1074253418 10:111776770-111776792 CAAAGTGGGGAGGATGTGGCAGG - Intergenic
1074290969 10:112137768-112137790 CAAACTGGGGAAGAGTGGGAGGG - Intergenic
1074512432 10:114127954-114127976 CAAAGCAGAGAGGAGGAGGAAGG + Intronic
1074548135 10:114417842-114417864 CAAAATACGTAGGAGGAGGGAGG + Intergenic
1074691141 10:116005100-116005122 GAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1075301719 10:121330659-121330681 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1075397905 10:122141162-122141184 AAATTGGGGGAGGAGGAGGAGGG + Intronic
1075540395 10:123307807-123307829 AAAAAGGAGGAGGAGGAGGAGGG + Intergenic
1075685653 10:124363669-124363691 GAAAATGGGAGGGAGGAGGGAGG + Intergenic
1075721818 10:124591978-124592000 CAAGGTGGGGAGAAGGAGGCAGG - Intronic
1076100565 10:127774384-127774406 CAAAATAAGCAGGAAGAGGAAGG - Intergenic
1076286133 10:129298236-129298258 GAGGAGGGGGAGGAGGAGGAGGG + Intergenic
1076319005 10:129564609-129564631 GAAGCAGGGGAGGAGGAGGAGGG - Intronic
1076736450 10:132461286-132461308 GAAGAAGGGGAGGAGGAGGATGG - Intergenic
1077411688 11:2406698-2406720 CAAGATGGAGAAGCGGAGGAGGG - Exonic
1077466377 11:2735550-2735572 GAAAATGGTGAGGAGGGAGAGGG - Intronic
1077619565 11:3708295-3708317 AAAAATGGGGAGGGGGAGAGTGG + Intronic
1077998904 11:7477024-7477046 GAAGAGGAGGAGGAGGAGGAAGG + Intergenic
1078140942 11:8692602-8692624 GGAGATGGGGAGGAGGAAGAGGG + Intronic
1078246075 11:9574042-9574064 GAAGAAGAGGAGGAGGAGGAGGG + Exonic
1078502600 11:11896387-11896409 AGGAATTGGGAGGAGGAGGACGG + Intronic
1078604793 11:12765633-12765655 CAAGTTGGAGAGGAGGAGGGCGG - Intronic
1078746282 11:14118665-14118687 GATAATGGGGAGAAGTAGGATGG - Intronic
1078783596 11:14464119-14464141 CAGAATGGGTTGGAGGATGATGG - Intronic
1078986781 11:16605464-16605486 CAAAAACGGGGGGAGGGGGAAGG + Intronic
1079022829 11:16923615-16923637 GAAAATTGGGAGGAGGGGGAGGG + Intronic
1079079984 11:17407353-17407375 CAGGATGAGGAAGAGGAGGAAGG - Exonic
1079230179 11:18643017-18643039 GAAAAGGAGGAAGAGGAGGAGGG + Intergenic
1079250034 11:18780519-18780541 CACAAAGAGGAGGAGCAGGAAGG - Intronic
1079302273 11:19288464-19288486 CCAGATGGGGAGTGGGAGGAGGG + Intergenic
1079445578 11:20553722-20553744 CTCAAGGAGGAGGAGGAGGAAGG - Intergenic
1079623940 11:22592851-22592873 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1079691156 11:23418975-23418997 GATGATGAGGAGGAGGAGGATGG + Intergenic
1079810956 11:24999387-24999409 GAAGATGGGGAGGAGGAGGAAGG + Intronic
1079816219 11:25062163-25062185 AAAGAAGGAGAGGAGGAGGAAGG + Intronic
1080330285 11:31129690-31129712 CAAACTGGGGAGGGGGATGAGGG - Intronic
1080460317 11:32449202-32449224 AAAAAAGAGAAGGAGGAGGAGGG - Intergenic
1080680752 11:34473590-34473612 AAAAATGAGGAGGAGGAGAAAGG - Intergenic
1080878909 11:36301198-36301220 CAGAAGAGGGAGGAGGAAGAAGG + Intronic
1081001566 11:37679899-37679921 AAAAACTGTGAGGAGGAGGAAGG + Intergenic
1081060424 11:38468104-38468126 CAAAACTGGGAGGCTGAGGAGGG + Intergenic
1081621079 11:44619464-44619486 AAAATTGGGGAGGAGGGGGCCGG + Exonic
1081761829 11:45582038-45582060 GACAAAGTGGAGGAGGAGGATGG + Intergenic
1081976762 11:47240197-47240219 CACTATGAGGAGGAAGAGGATGG + Exonic
1082820470 11:57541384-57541406 CAAAAAGGGCAGGAGCATGAAGG + Intergenic
1083167613 11:60900803-60900825 CAAAGTGGGGAGGGGCAGCAGGG - Intronic
1083209343 11:61173269-61173291 CCAAATGGGCATGGGGAGGAGGG - Intergenic
1083571965 11:63765842-63765864 GAAGAAGAGGAGGAGGAGGAGGG - Exonic
1083573431 11:63772133-63772155 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1083697949 11:64455225-64455247 GAATATGTGGGGGAGGAGGATGG + Intergenic
1083732857 11:64662303-64662325 GAAGAGGAGGAGGAGGAGGAAGG + Intronic
1084028881 11:66469123-66469145 CAGATGGGGGAGGAGGAAGAGGG - Intronic
1084190421 11:67496139-67496161 GATAAAGGGGAGAAGGAGGAGGG - Intronic
1084499390 11:69525786-69525808 TAAAATGGGGTGGAGGAGAAGGG - Intergenic
1084524375 11:69686692-69686714 CCTAATGGGGTGGAGGAGGCAGG - Intergenic
1084665664 11:70574896-70574918 CAAAATGAAGAGGATGGGGAAGG - Intronic
1084739299 11:71128679-71128701 AGAGATGGGGAGGAGTAGGAGGG - Intronic
1084804872 11:71571796-71571818 CAAAATTGGCAGGAGGGGCAGGG - Intergenic
1084805582 11:71576726-71576748 CAAAATTGGCAGGAGGGGCAGGG + Intergenic
1085026464 11:73239415-73239437 CAGCATGGAGAGGAGGAAGAGGG + Intergenic
1085041291 11:73327971-73327993 TAAAATGGGGATGATGATGATGG + Intronic
1085256609 11:75177116-75177138 CACCATAGGGAGGAGGAGGAGGG + Intronic
1085300161 11:75453170-75453192 CAGACTGGGGAGGAGGAGGAAGG + Intronic
1085511132 11:77088691-77088713 CAAAGAGTGGGGGAGGAGGACGG + Intronic
1085738115 11:79056969-79056991 CAAGATGGTGGGGAGGAGCAGGG + Intronic
1085803687 11:79614837-79614859 CAAAATGGTGAGGAGAAGCAAGG - Intergenic
1085808012 11:79654210-79654232 GACAGTGGGAAGGAGGAGGAAGG + Intergenic
1085843446 11:80039865-80039887 CAAAATTTGGAGAAGGAGAAAGG + Intergenic
1086035413 11:82409017-82409039 CTAAATGGTGAGGAGGAGGATGG + Intergenic
1086167150 11:83791854-83791876 CACAAGCTGGAGGAGGAGGAAGG - Intronic
1086427368 11:86699199-86699221 TAAAATGAGTAGGAGGAGGGGGG - Intergenic
1086447526 11:86884112-86884134 AAAACTGGGGAGGAAGGGGATGG - Intronic
1086877802 11:92118393-92118415 CAGAATGGGGAAGAGTGGGAGGG + Intergenic
1086990795 11:93302144-93302166 CAAAAAACGGAGGAGGAGGAGGG + Intergenic
1087260204 11:96002598-96002620 GATGATGGGGATGAGGAGGATGG + Intronic
1087496451 11:98896022-98896044 GAAAATTTGGAGGAGGAGGAAGG + Intergenic
1087594749 11:100238505-100238527 GAGAAGGGGGAAGAGGAGGAGGG + Intronic
1087665265 11:101038171-101038193 AGAAAGGGAGAGGAGGAGGAGGG - Exonic
1088047632 11:105472847-105472869 GAAGAAGGGGAGGAGGAGGAGGG + Intergenic
1088079549 11:105894641-105894663 AAAAAGGAGGAGGAGGAGGAGGG + Intronic
1088560617 11:111112104-111112126 AAAAGGGGGGAGAAGGAGGAAGG + Intergenic
1088993994 11:114980047-114980069 CAAGATGTGGAGGTGGAAGACGG + Intergenic
1089044512 11:115488372-115488394 CATTATTGGGAGGGGGAGGAGGG - Intronic
1089146257 11:116331526-116331548 CAAAATAGGCAGGAAGAGGGAGG + Intergenic
1089384045 11:118056447-118056469 CAAAATGGGGACATGCAGGAAGG + Intergenic
1089540727 11:119187815-119187837 CAAACTGTAGAGGGGGAGGATGG - Intronic
1089746918 11:120623989-120624011 CGGAAAGGGGAGGAGGAAGAGGG - Intronic
1089767016 11:120775320-120775342 GATGACGGGGAGGAGGAGGAAGG + Intronic
1089817242 11:121187368-121187390 CAAAATAGGTAGGAGCTGGAGGG - Intronic
1090018008 11:123102851-123102873 AAAATTGGGCAGGAGGAGGCTGG - Intronic
1090208527 11:124899027-124899049 CAGGATGGGAAGGGGGAGGAAGG - Intergenic
1090366504 11:126211306-126211328 GAGAATGGGGAGAAGGCGGAGGG - Intronic
1090745631 11:129702690-129702712 CAAGATGAAGAGGAGGGGGACGG + Intergenic
1090972709 11:131656667-131656689 AGAGCTGGGGAGGAGGAGGAAGG + Intronic
1091009968 11:131991863-131991885 GAAATTTGGGAGGAGGAGAAAGG + Intronic
1091070530 11:132558449-132558471 CAGGATGGGGAGGACGAGTAGGG - Intronic
1091337122 11:134780619-134780641 AAGAGTGAGGAGGAGGAGGAGGG - Intergenic
1091443989 12:533081-533103 CACTGTGGGGAGGAGGAGGATGG - Intronic
1091480350 12:822655-822677 TAAAATGGGAAGGAGGAGTGAGG - Intronic
1091568144 12:1662600-1662622 GGAAGTGGGGAGGAGGAGGCGGG - Intergenic
1091660735 12:2381339-2381361 CATAATCGGGAAGAGGAAGATGG - Intronic
1091676352 12:2493454-2493476 GACCATGGGGAGGAGGAGAAAGG - Intronic
1091880613 12:3974481-3974503 AGAAAGGGGGAGGAGAAGGAAGG - Intergenic
1091882044 12:3987513-3987535 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1092146863 12:6220784-6220806 GAAACTGGGGAGGAGGATGAGGG - Intronic
1093111792 12:15161471-15161493 GTAAATGGGAAGAAGGAGGAAGG - Intronic
1093235436 12:16604350-16604372 CAAAAAGGGGAGGGGGGTGAAGG - Intronic
1093457072 12:19374985-19375007 GAGAAGGAGGAGGAGGAGGAAGG + Intronic
1093469325 12:19483610-19483632 TACAATCGGGAGGAGGAAGATGG - Intronic
1093622769 12:21312072-21312094 GAAGAAGAGGAGGAGGAGGAAGG + Intronic
1093754953 12:22842136-22842158 GAAAAAGAGAAGGAGGAGGAGGG - Intergenic
1093754958 12:22842158-22842180 GAAAAAGAGAAGGAGGAGGAGGG - Intergenic
1093754963 12:22842180-22842202 GAAAAAGAGAAGGAGGAGGAGGG - Intergenic
1095185931 12:39200497-39200519 CACACTGATGAGGAGGAGGAAGG - Intergenic
1095854170 12:46842380-46842402 CATAGTGTGGAGGAGGAGGAGGG + Intergenic
1096017952 12:48295672-48295694 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1096065315 12:48735024-48735046 GAAGAGGAGGAGGAGGAGGAAGG + Intergenic
1096137853 12:49217636-49217658 CAAAATGTGAGGCAGGAGGATGG - Intronic
1096308259 12:50498111-50498133 CACACTGATGAGGAGGAGGAAGG - Intergenic
1096748569 12:53744457-53744479 GAAAGTGGGGAAGATGAGGAAGG + Intergenic
1096758748 12:53822222-53822244 AAGAAGAGGGAGGAGGAGGAGGG - Intergenic
1097258094 12:57695904-57695926 TAAGAGGAGGAGGAGGAGGAGGG - Intronic
1097279271 12:57834525-57834547 GACAATGGGGCAGAGGAGGAAGG + Intronic
1097938381 12:65278487-65278509 GAGAAGGAGGAGGAGGAGGACGG + Intergenic
1098005671 12:65994535-65994557 TAACCTGAGGAGGAGGAGGAGGG - Intergenic
1098110604 12:67117874-67117896 CCAAATGGGGAGAAAGAAGAGGG + Intergenic
1098224402 12:68307185-68307207 CAAAAGGGGGAGAAGAGGGAGGG + Intronic
1098275067 12:68804805-68804827 CACAGTGGGAAGGAGGAGAAGGG + Intergenic
1098504853 12:71237609-71237631 AAAAAAGAGGAGGAGGAGGGTGG - Intronic
1098544985 12:71702064-71702086 CAAAAGGGGCAGGAGGAAGAAGG - Exonic
1098815336 12:75153929-75153951 GAAAAGGTGGAGGAGGTGGAAGG + Intronic
1098948169 12:76610607-76610629 GACAAAGAGGAGGAGGAGGAGGG + Intergenic
1099211816 12:79800302-79800324 CACACTGAGGAGGAAGAGGAGGG - Intronic
1099279629 12:80627391-80627413 GAAGAGGAGGAGGAGGAGGAAGG + Intronic
1099871707 12:88357961-88357983 CAAAAGGAGGAAGAGGAGGAGGG - Intergenic
1099877271 12:88423556-88423578 AAGAATGGGGAGGGGGAGGTGGG + Intergenic
1099922943 12:88981639-88981661 CAAAAAGTGGATGATGAGGATGG - Intergenic
1100098926 12:91078449-91078471 GAAAAGGAGGAGGAGGAGAAGGG + Intergenic
1100260166 12:92925761-92925783 AAAAAGGAGGAGCAGGAGGAGGG + Intronic
1100727204 12:97421193-97421215 CAAAAGGATGAGGAGAAGGAAGG + Intergenic
1101147772 12:101857443-101857465 CAAGAGCAGGAGGAGGAGGAAGG - Intergenic
1101193770 12:102361759-102361781 GAAGAGGAGGAGGAGGAGGACGG + Intergenic
1101515158 12:105428147-105428169 CAAACTGGGGAGAAGGAAAAAGG - Intergenic
1101595122 12:106157830-106157852 CAAGATGTGGAGGTGGAAGATGG - Intergenic
1101843081 12:108341874-108341896 GAAAAAGGAGAGGAGGAGGAGGG + Intergenic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1102403998 12:112656566-112656588 CAAAAGGGGGAAGAGTGGGAAGG - Intronic
1102437583 12:112937411-112937433 TAAGATGGGGAGGAGGAGATAGG + Intergenic
1102538807 12:113603092-113603114 GAAAATGAGGAAGAGGAGGAAGG - Intergenic
1102554987 12:113720884-113720906 CAGAGTTGGGGGGAGGAGGAAGG + Intergenic
1102658253 12:114501905-114501927 GAGAAGGGGGAGGTGGAGGAGGG + Intergenic
1102749148 12:115277179-115277201 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1102781208 12:115566383-115566405 GAGAGTGGAGAGGAGGAGGAGGG + Intergenic
1102899329 12:116624143-116624165 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1102900839 12:116635490-116635512 AAAAATGGGGACGGGGAGGCAGG - Intergenic
1103080909 12:118023392-118023414 GGGAAGGGGGAGGAGGAGGAGGG + Intronic
1103086015 12:118061845-118061867 GAAAATGGGGAGGGGGTGGAAGG + Intronic
1103185618 12:118954649-118954671 CCAAACGGAGAGGATGAGGAGGG + Intergenic
1103235367 12:119368150-119368172 GAAAAGAAGGAGGAGGAGGAAGG + Intronic
1103748161 12:123140354-123140376 CAGGTTGGGGAGGAGGAGGCTGG - Intronic
1104295493 12:127508147-127508169 TAAAATGGGTAGGAGGATGGAGG + Intergenic
1104316218 12:127704367-127704389 GAAGAAGAGGAGGAGGAGGAAGG + Intergenic
1104613339 12:130248108-130248130 AAAAAGAAGGAGGAGGAGGAGGG + Intergenic
1104942767 12:132402657-132402679 CAAGTTGGGGAGGTGGAGGCAGG - Intergenic
1104954337 12:132457137-132457159 TCGAATGGGGAGGAGGAGGCAGG + Intergenic
1105233442 13:18522759-18522781 CAAAATGGGGAAGATGAGTGGGG - Intergenic
1105261401 13:18782348-18782370 TAAAGTGGGGAGGAGTAGGCTGG - Intergenic
1105724133 13:23143857-23143879 GAAATTGGGGAGGTGGAGGTGGG - Intergenic
1105935919 13:25099034-25099056 TTATATTGGGAGGAGGAGGAGGG - Exonic
1106015066 13:25861544-25861566 AAAAATGGGGATGGGGTGGAAGG + Intronic
1106243033 13:27925277-27925299 AAAGAAGAGGAGGAGGAGGAAGG - Exonic
1106353946 13:28961174-28961196 GAAAATGAGGAGAAAGAGGATGG + Intronic
1106628015 13:31441109-31441131 AGAAGTGGGGAGGATGAGGACGG + Intergenic
1106763979 13:32895412-32895434 GAAGAGGAGGAGGAGGAGGAAGG - Intergenic
1106784897 13:33096901-33096923 TAGACTGAGGAGGAGGAGGAGGG + Intergenic
1107618018 13:42192558-42192580 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1107653862 13:42572485-42572507 GAAGAAGAGGAGGAGGAGGAGGG + Intronic
1108105871 13:47008459-47008481 CAGAGGGAGGAGGAGGAGGAGGG + Intergenic
1108392068 13:49956288-49956310 AGAAAGGAGGAGGAGGAGGAAGG - Intergenic
1108585447 13:51866392-51866414 CAAAATGGGGAGGAGAGGCTCGG + Intergenic
1108586533 13:51874848-51874870 CAAATTGTGGAGGAGGAGGGAGG - Intergenic
1108850999 13:54728800-54728822 CAGAATGTGGAGGAAGAGCAAGG - Intergenic
1109621702 13:64916807-64916829 GAAAAGAGTGAGGAGGAGGAAGG - Intergenic
1109733684 13:66452449-66452471 ATAAATGGGGATGAGGAAGAGGG - Intronic
1109873123 13:68363656-68363678 AAAAATCCAGAGGAGGAGGAAGG + Intergenic
1110619399 13:77578325-77578347 CAAGAAAGGGAGGAGGGGGAAGG + Intronic
1110686688 13:78383788-78383810 GAGAATGGGGAGGAAGAGAAAGG - Intergenic
1110789000 13:79566868-79566890 GAAAATGGTGAGAGGGAGGAGGG - Intergenic
1110803300 13:79725720-79725742 CAGGATGGGGGGCAGGAGGATGG - Intergenic
1110889810 13:80684776-80684798 CAAAAAGTAGAGGGGGAGGAAGG - Intergenic
1111362787 13:87197081-87197103 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1111446091 13:88347752-88347774 GAAAAAGGGAGGGAGGAGGAAGG + Intergenic
1111535151 13:89594207-89594229 CAAGATGTGGAGGTGGAAGATGG + Intergenic
1111701042 13:91689718-91689740 CAAGATGTGGAGGCGGAAGACGG - Intronic
1111859972 13:93690715-93690737 AAAAATGGGGTGGAGGTGGTGGG - Intronic
1112311086 13:98318051-98318073 AAAAAGGAGGAGGAGAAGGAAGG - Intronic
1112470024 13:99679716-99679738 CAAAATGGGAAGGAGAGGGTGGG + Intronic
1112537380 13:100273393-100273415 CAAAAAAGGGTGGAGAAGGAAGG - Intronic
1112672191 13:101653177-101653199 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
1113030521 13:105989342-105989364 CAAGACGTGGAGGTGGAGGATGG - Intergenic
1113084500 13:106554441-106554463 CAAAATTGAGAGGAAGGGGAAGG + Intronic
1113149096 13:107242235-107242257 GAAACGGGAGAGGAGGAGGAAGG - Intronic
1113258609 13:108534806-108534828 GAAGAAGAGGAGGAGGAGGAAGG - Intergenic
1113258650 13:108535097-108535119 AAAAAGGAGGAGGAGAAGGAGGG - Intergenic
1113308272 13:109102205-109102227 TAAAAAGGGAAGGAGGAAGAAGG + Intronic
1113670902 13:112175475-112175497 CAGAATCTGGAGGAGGAGGAAGG + Intergenic
1113909741 13:113836386-113836408 GAGGAGGGGGAGGAGGAGGAGGG + Intronic
1114185754 14:20400936-20400958 ATAAATGGGGAAGAGAAGGAGGG + Intronic
1114231326 14:20785644-20785666 AAAAAGGAGGAGGAAGAGGAGGG + Intergenic
1114241796 14:20874793-20874815 CAAAAGGAGGAAAAGGAGGAGGG + Intergenic
1114248388 14:20935359-20935381 CAAAAGGAGGAAGAGGAGGAGGG + Intergenic
1114253948 14:20985824-20985846 AAAGAGGAGGAGGAGGAGGAGGG + Intergenic
1114316465 14:21514355-21514377 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1114619451 14:24086519-24086541 CAAAATGGGAATGAGGATCATGG + Intronic
1114646604 14:24259622-24259644 CAGAAAGGGCAGGAGGAGGGTGG + Intronic
1114667846 14:24391019-24391041 CAAAAAGTGGAGGAGGAGGATGG + Intergenic
1115040690 14:28922392-28922414 GAAAAGGAGAAGGAGGAGGAAGG + Intergenic
1115186424 14:30693338-30693360 AGAAATGGGGTGGAAGAGGACGG + Intronic
1115686985 14:35806340-35806362 TAAAATGGGGGGGAGGGGGTAGG + Intronic
1115813321 14:37134113-37134135 CAAAATGGAGAGAGGGAGGTGGG + Intronic
1116085010 14:40224409-40224431 CAAAAAGGGGTGAAGGAGGAAGG + Intergenic
1116416992 14:44689868-44689890 AAGGAGGGGGAGGAGGAGGAGGG + Intergenic
1116520124 14:45836196-45836218 GAAGATGTGGAGGAGGTGGAAGG + Intergenic
1116552377 14:46257845-46257867 CAGATTTGGGAGGAGGAGAAAGG + Intergenic
1117088917 14:52229894-52229916 CAGAAAGGGAAGGAGAAGGAAGG + Intergenic
1117115947 14:52512358-52512380 CAAATTAGGAAGGAGAAGGAAGG + Intronic
1117247148 14:53897442-53897464 CAAAATGAGGAGGAGAAGGGAGG + Intergenic
1117292201 14:54344759-54344781 CAGAGTGGGGAGGAGGAGCATGG - Intergenic
1117386732 14:55221925-55221947 CAAAAGGAGGAGGAGGAAGATGG - Intergenic
1117951660 14:61089331-61089353 CCACAGGAGGAGGAGGAGGAGGG - Intergenic
1118173546 14:63413538-63413560 TAAAATGGGGCGGAGGGTGAGGG + Intronic
1118425750 14:65659674-65659696 CAGAAAGGGGAAGAGGAAGAGGG - Intronic
1118459539 14:65975987-65976009 GAGAACGGGGAGGAGGAGAAGGG + Intronic
1118604372 14:67492080-67492102 CTAGATGGGGAGGAGGAAGGGGG - Intronic
1118701229 14:68435175-68435197 CTAGATGGGGAAGAGGAGGATGG - Intronic
1118773734 14:68960175-68960197 GAAGAGGTGGAGGAGGAGGAAGG + Intronic
1118979124 14:70701783-70701805 GAGGAAGGGGAGGAGGAGGAAGG + Intergenic
1118979130 14:70701798-70701820 GAGGAAGGGGAGGAGGAGGAAGG + Intergenic
1118980665 14:70713701-70713723 CTAAGTGGGGAGGAGGAAGTTGG - Intergenic
1118980981 14:70716806-70716828 CAAGATGGGTTGTAGGAGGAAGG + Intergenic
1119004392 14:70910109-70910131 GAGGAGGGGGAGGAGGAGGAGGG - Intronic
1119071278 14:71587302-71587324 TAAAATGGGGGGCAGGGGGAGGG - Intronic
1119205134 14:72788415-72788437 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
1119344619 14:73913032-73913054 AAAAATGGGGTGTAGGAGGAGGG - Intronic
1119524428 14:75310928-75310950 CAAGGAGGGGAGGAGGAGCAGGG + Intergenic
1119654756 14:76409318-76409340 CTAAATGGGAAGGAGTTGGAGGG + Intronic
1119766494 14:77192835-77192857 GAAGAAGAGGAGGAGGAGGAAGG + Intronic
1119769594 14:77212108-77212130 TAAGCTGAGGAGGAGGAGGATGG + Intronic
1119920435 14:78441273-78441295 GAAAATAGGGAGGAGAAAGAAGG - Intronic
1120265133 14:82239058-82239080 CAATAGGGGGAGAAGCAGGAAGG + Intergenic
1120551517 14:85878335-85878357 ATAACTGGGGAGGATGAGGAGGG + Intergenic
1120880800 14:89413941-89413963 GAGAAGGGGGAGGAGGAGGAGGG + Intronic
1121053393 14:90834078-90834100 CAAAAGGGAGATGTGGAGGATGG - Intergenic
1121078219 14:91086863-91086885 CAAACTTGGGAGGATGAGGCAGG - Intronic
1121173490 14:91873254-91873276 AAAGATGAGGAGGAGGAGGATGG + Intronic
1121461127 14:94079474-94079496 GAAGAAGAGGAGGAGGAGGAGGG - Exonic
1121667846 14:95686298-95686320 GAGGAGGGGGAGGAGGAGGAAGG - Intergenic
1121735707 14:96216675-96216697 AAGAAGGAGGAGGAGGAGGAAGG + Intronic
1122027509 14:98888384-98888406 AAGAAAGGAGAGGAGGAGGAGGG - Intergenic
1122074723 14:99228753-99228775 CAGAAGGGGAAGGAGGAGCAGGG - Intronic
1122082438 14:99274772-99274794 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1122229332 14:100297726-100297748 CAATTTGGGGAGGAGGCTGAAGG - Intronic
1122372748 14:101237629-101237651 AAAAATGTGGAGGCAGAGGAGGG - Intergenic
1122782644 14:104150146-104150168 GGGAAGGGGGAGGAGGAGGAGGG - Intronic
1123395321 15:19928978-19929000 CAAAATGGGGAAGATGAGTGGGG - Intergenic
1123789041 15:23701255-23701277 CACACTGATGAGGAGGAGGAAGG - Intergenic
1124131102 15:26986469-26986491 CAAAGTGGTGAGGAAGAGGTGGG - Intronic
1124413862 15:29458532-29458554 CAAAATTGGGAGGAGGGGCAGGG - Intronic
1124416338 15:29475652-29475674 AGAAATGAGGAGGAGGAGGAAGG + Intronic
1124724888 15:32148008-32148030 CAAAAAGGAAGGGAGGAGGAAGG - Intronic
1124816787 15:33001709-33001731 GAAGAGGAGGAGGAGGAGGAGGG - Intronic
1125456516 15:39865545-39865567 CAGAAGGGTGAGGAGGTGGAAGG + Intronic
1125933948 15:43618618-43618640 AGAACTGGGGATGAGGAGGAGGG - Intronic
1125947045 15:43718080-43718102 AGAACTGGGGATGAGGAGGAGGG - Intergenic
1126399483 15:48254933-48254955 GAAAAAGCGGAGGAGGGGGAAGG + Intronic
1126411110 15:48374101-48374123 AGAAATGGGGAGGAGGAGGGAGG - Intergenic
1126550808 15:49927315-49927337 CAGAAGAGGGAGGAGGAGAAAGG + Intronic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1127108802 15:55645906-55645928 CAGAAAGGGAAGGAGGAGAAAGG + Intronic
1127165658 15:56243398-56243420 GAAGAGGAGGAGGAGGAGGAAGG + Intergenic
1127282122 15:57501593-57501615 AGAAGTGGGGAGCAGGAGGAGGG + Intronic
1128090495 15:64915765-64915787 GAAAATGGGGTGCAGGATGAGGG - Intronic
1128304153 15:66587025-66587047 GAGAATGGGGAGGGGGAGAAGGG - Intronic
1128328641 15:66741484-66741506 TAAAATGAGGAGGAGGTGGGTGG + Intronic
1128513348 15:68326990-68327012 GAAAAGGGGGAGGAAGAGGGTGG + Intronic
1128547023 15:68575206-68575228 AACAATGGGGAAGAGGAGGGTGG + Intergenic
1128868649 15:71135848-71135870 CCAACAGGGGAGGAGGAGAAGGG - Intronic
1128940885 15:71786790-71786812 GGAAGAGGGGAGGAGGAGGAGGG + Intergenic
1129153004 15:73700892-73700914 AAAAAAGAGGAGGAGGAGGAGGG - Intronic
1129233178 15:74208091-74208113 GACACTGGTGAGGAGGAGGAGGG + Intronic
1129658825 15:77541906-77541928 AAAGAAGGGAAGGAGGAGGAAGG - Intergenic
1129697363 15:77748253-77748275 CAAGGTGGGGAGGAGGAGGACGG - Intronic
1130226115 15:82059223-82059245 AAAAAGGAGGGGGAGGAGGAGGG - Intergenic
1130252456 15:82308780-82308802 CAACATGAAGAGGATGAGGATGG - Intergenic
1130349710 15:83080241-83080263 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1130648979 15:85751524-85751546 CAAACTGGGGTGGAGGGGGTAGG - Intergenic
1130958590 15:88644807-88644829 GAAATTGGGGACAAGGAGGAAGG - Intronic
1130963187 15:88678598-88678620 AAAAAAAGGAAGGAGGAGGAAGG - Intergenic
1131073908 15:89483032-89483054 CAGAATGGGGATGAGGTGGTGGG - Intronic
1131870305 15:96756928-96756950 GAAAAGGAGGAGGAGGAGGAGGG + Intergenic
1131901123 15:97088728-97088750 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1131972309 15:97904688-97904710 GAAAGAGAGGAGGAGGAGGAGGG + Intergenic
1132053776 15:98633961-98633983 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1132078612 15:98845435-98845457 GAAGGAGGGGAGGAGGAGGAGGG - Intronic
1132078648 15:98845531-98845553 GAGGAGGGGGAGGAGGAGGAAGG - Intronic
1132314630 15:100880565-100880587 CAGAACGAGGAGGAGTAGGAAGG + Intronic
1132977095 16:2716332-2716354 CAGAAAGGAGAGGAGGAGGAAGG - Intronic
1133392761 16:5422795-5422817 AAGAAAGAGGAGGAGGAGGAGGG + Intergenic
1133548088 16:6827643-6827665 CAAAAGGGTGAGGAGGGGGAAGG - Intronic
1133580510 16:7140194-7140216 CAAATTGGGAGGGAGAAGGAGGG - Intronic
1133840172 16:9400909-9400931 CAAGACGGGGATGAAGAGGAAGG + Intergenic
1133953979 16:10423752-10423774 CACACTGATGAGGAGGAGGAAGG - Intronic
1134449301 16:14353966-14353988 AAGAAAGGGGAGGAGGGGGAGGG + Intergenic
1134449311 16:14353990-14354012 AAGAAAGGGGAGGAGGGGGAGGG + Intergenic
1134558443 16:15186690-15186712 CAAAAGGGGGAAGTGAAGGAGGG + Intergenic
1134748052 16:16602967-16602989 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1134918974 16:18098292-18098314 CAAAAGGGGGAAGTGAAGGAGGG + Intergenic
1134978353 16:18588374-18588396 CAAAAGGGAGTGGTGGAGGACGG - Intergenic
1135066596 16:19315061-19315083 GAGGAGGGGGAGGAGGAGGAGGG + Intronic
1135476860 16:22784311-22784333 GAAAATGGGGTGGGGGATGAGGG + Intergenic
1135574184 16:23572576-23572598 CAATAAGGGGAGCAGGTGGAGGG - Exonic
1135724044 16:24840921-24840943 AGAAAAGAGGAGGAGGAGGAGGG + Intergenic
1135727543 16:24868814-24868836 GAAAAAGAGGAGGAGGAGGAAGG - Intronic
1136162790 16:28431662-28431684 CAATTTATGGAGGAGGAGGAAGG - Intergenic
1136200176 16:28683326-28683348 CAATTTATGGAGGAGGAGGAAGG + Intergenic
1136216524 16:28797519-28797541 CAATTTATGGAGGAGGAGGAAGG + Intergenic
1136542715 16:30937304-30937326 CAGCAAGGGGAGGGGGAGGAGGG - Intronic
1136679080 16:31944520-31944542 CCAAATGGTGAGGAGGTGGAAGG + Intergenic
1136697645 16:32099882-32099904 CAAAATGGGGAAGATGAGTGGGG - Intergenic
1136701418 16:32147409-32147431 CAAAATGGGGAAGATGAGTGGGG - Intergenic
1136766247 16:32780055-32780077 CAAAATGGGGAAGATGAGTGGGG + Intergenic
1136769928 16:32827734-32827756 CAAAATGGGGAAGATGAGTGGGG + Intergenic
1136798144 16:33043164-33043186 CAAAATGGGGAAGATGAGTGGGG - Intergenic
1136799200 16:33055248-33055270 AAAAAGGAGGAGGAGGGGGAAGG - Intergenic
1136801851 16:33090323-33090345 CAAAATGGGGAAGATGAGTGGGG - Intergenic
1136936051 16:34465645-34465667 CAAAATGGGGAAGATGAGTGGGG + Intergenic
1136940094 16:34515489-34515511 CAAAATGGGGAAGATGAGTGGGG + Intergenic
1136945668 16:34648300-34648322 CAAAATGGGGAAGATGAGTGGGG - Intergenic
1136956000 16:34787327-34787349 CAAAATGGGGAAGAAGAGTGGGG - Intergenic
1136959725 16:34833077-34833099 CAAAATGGGGAAGATGAGTGGGG - Intergenic
1136963770 16:34882925-34882947 CAAAATGGGGAAGATGAGTGGGG - Intergenic
1136967901 16:34937451-34937473 CAAAATGGGGAAGATGAGTGGGG - Intergenic
1137088396 16:36158165-36158187 CAAAATGGGGAAGATGAGTGGGG - Intergenic
1137092910 16:36217402-36217424 CAAAATGGGGAAGATGAGTGGGG - Intergenic
1137220282 16:46442163-46442185 CAAAATGGGGAAGATGAGTGGGG + Intergenic
1137395280 16:48112731-48112753 CTAAATGGGGATGATGAGGGAGG - Intronic
1137756498 16:50906460-50906482 GAAAATGGGGAGGGGGGCGAGGG - Intergenic
1137827546 16:51512193-51512215 GAAAAGGGGGAAGGGGAGGAGGG + Intergenic
1137968355 16:52959102-52959124 AAAAAGGAGGAGGAGGGGGATGG - Intergenic
1138412654 16:56852213-56852235 CAACAGCGGGAGGCGGAGGATGG + Intergenic
1138499490 16:57430507-57430529 CAGAAGTGGGAGGAGGATGAGGG + Intronic
1138843415 16:60537129-60537151 CAAAATGAAGAGATGGAGGAAGG - Intergenic
1138894803 16:61190713-61190735 GAAGAGGAGGAGGAGGAGGAAGG - Intergenic
1138955113 16:61962155-61962177 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
1139196244 16:64921639-64921661 GAAGAAGGGGAGGAGGAGGAGGG - Intergenic
1139196274 16:64921810-64921832 GAAGAAGGGGAGGAGGAGGAGGG - Intergenic
1139378721 16:66516853-66516875 CAAGATGGGGAGGGGCAGGTGGG + Intronic
1139431321 16:66912425-66912447 CCCAATCTGGAGGAGGAGGAGGG + Exonic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139621615 16:68149181-68149203 TAAAATGGGGTGGGGGCGGAAGG + Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139972615 16:70785672-70785694 CTCAGTGAGGAGGAGGAGGAGGG + Intronic
1140106828 16:71968267-71968289 CTAAGTGGGAAGGAGGTGGAAGG - Intronic
1140223355 16:73059175-73059197 GAAAAGGGGGAGGTGGAGGGAGG + Intronic
1140357047 16:74315377-74315399 TAGAATAGGGAGGAGGGGGAAGG - Intergenic
1140407309 16:74719312-74719334 CAAAATGGGAAGGAGGCTGTAGG + Intronic
1140467146 16:75191596-75191618 CAAAATTAGGAGCAGGGGGAGGG + Intergenic
1140655191 16:77132470-77132492 GAGGAGGGGGAGGAGGAGGAAGG - Intergenic
1140704609 16:77615034-77615056 AGAAAGGAGGAGGAGGAGGAAGG + Intergenic
1140906017 16:79409702-79409724 AAACTTGGGGAGGAGGAAGAGGG + Intergenic
1141007121 16:80363056-80363078 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1141067524 16:80926250-80926272 CAAAAGGAGGAGGGGGAGAAGGG + Intergenic
1141164362 16:81650584-81650606 AATAATGGAGAGGAGGAAGATGG + Intronic
1141350276 16:83288373-83288395 CTACATGAGGTGGAGGAGGAGGG + Intronic
1141724045 16:85774551-85774573 AAGAATGGGGAAGGGGAGGATGG + Intronic
1141885698 16:86890753-86890775 GATGATGGGGAGGAGGAGAATGG - Intergenic
1142044011 16:87913699-87913721 CAGTGTGGGGTGGAGGAGGAGGG - Intronic
1142141707 16:88475533-88475555 AGAAAAAGGGAGGAGGAGGAGGG + Intronic
1203068633 16_KI270728v1_random:1042301-1042323 CAAAATGGGGAAGATGAGTGGGG + Intergenic
1203072350 16_KI270728v1_random:1089838-1089860 CAAAATGGGGAAGATGAGTGGGG + Intergenic
1142766108 17:2065199-2065221 CGCCATGTGGAGGAGGAGGAGGG + Intronic
1142885441 17:2909689-2909711 AACACGGGGGAGGAGGAGGAAGG - Intronic
1142950008 17:3471155-3471177 AAAAATGGAGAGAGGGAGGAAGG + Intronic
1142996319 17:3762467-3762489 GACAGTGGGGAGGACGAGGAAGG - Intronic
1143193781 17:5059804-5059826 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1143194405 17:5064546-5064568 TAAAATTTGGAGGAGGAGGCTGG - Intergenic
1143901767 17:10179802-10179824 CAAAATGGTGACCAGGAGGTTGG + Intronic
1143912760 17:10265557-10265579 CAGAATTGGGGGGAGGAGGGGGG - Intergenic
1143951391 17:10635478-10635500 CAGTATGAGGAGGAGCAGGAAGG - Exonic
1144100395 17:11937584-11937606 CAAAATGGCCAGCAGGAGAAAGG - Intronic
1144287126 17:13787636-13787658 CGCAATGGAGAGGAAGAGGATGG + Intergenic
1144472797 17:15559759-15559781 CTGACTGGGGAGGTGGAGGAAGG + Intronic
1144923682 17:18784946-18784968 CTGACTGGGGAGGTGGAGGAAGG - Intronic
1145316684 17:21739178-21739200 CCAGATGGGAAGGAGAAGGAAGG + Intergenic
1145390178 17:22449533-22449555 CAAAATATGGATGAGGAGAAGGG + Intergenic
1145691948 17:26751395-26751417 CAAAATGGGGAAGATGAGTGGGG - Intergenic
1145708679 17:26948008-26948030 CAAAATGGGGAAGACGAGTGGGG - Intergenic
1145774265 17:27516518-27516540 TGAAAGGGGGAGGAGGAGGAGGG - Intronic
1145777297 17:27538386-27538408 CAAAATGGGCAGGAGGTGTTGGG + Intronic
1146090681 17:29874293-29874315 AAAAATGGGGAGGGGGTGGGTGG + Intronic
1146234957 17:31150620-31150642 CAAAATGAGGAGAGGGAGGGTGG - Intronic
1146471732 17:33130289-33130311 GAAGATGAGGAGGGGGAGGAAGG - Intronic
1146572878 17:33968137-33968159 CAACATGGGGATGTGGAGGAAGG - Intronic
1146687522 17:34851139-34851161 CAACATGGGGAATAGGGGGAGGG + Intergenic
1146696138 17:34910228-34910250 CAAAATGTGGAGGCTGGGGAGGG + Intergenic
1146702968 17:34978240-34978262 CAAGATGTAGAGGTGGAGGATGG - Intronic
1146908629 17:36633629-36633651 GAAAAGGAGGAGGAGGAGGAAGG + Intergenic
1147035314 17:37675574-37675596 CAGTCTGGGGAGGAGGAGGCAGG - Intergenic
1147308374 17:39579070-39579092 CAGATGGGTGAGGAGGAGGAAGG - Intergenic
1147498785 17:40942392-40942414 GAGGAGGGGGAGGAGGAGGAGGG - Intergenic
1147742019 17:42675238-42675260 CAAGAGGGGGAGGTGGGGGAGGG + Intronic
1147945259 17:44077127-44077149 GGTACTGGGGAGGAGGAGGAAGG + Exonic
1148102956 17:45103870-45103892 CAAAATGGTGAGGAGCAGACGGG + Exonic
1148192608 17:45690134-45690156 CTGAAGGGGAAGGAGGAGGAAGG + Intergenic
1148193795 17:45698895-45698917 AAGAATGAGGAGGAAGAGGAAGG + Intergenic
1148223190 17:45879571-45879593 CAAGATGGGGAGGTAGAAGATGG - Intergenic
1148464290 17:47855745-47855767 CCAAAGGGGGAGGTGAAGGAGGG + Intronic
1148539708 17:48470609-48470631 AAAAAAGAGGAGGAGGAGCAAGG - Intergenic
1148546957 17:48526463-48526485 GAAAGCAGGGAGGAGGAGGAAGG - Intergenic
1148647011 17:49225024-49225046 CAGCAGGAGGAGGAGGAGGAGGG + Exonic
1148734166 17:49855462-49855484 CAAAGAGGTGATGAGGAGGAGGG + Intergenic
1148760322 17:49996612-49996634 CAAAATGGGGTGTGGGAGGCAGG - Intergenic
1148890111 17:50801065-50801087 GAAGAGGAGGAGGAGGAGGAGGG + Intergenic
1149038953 17:52164506-52164528 GAAAATGGGGAGGAATGGGAGGG + Intergenic
1149205752 17:54244604-54244626 CATAATGGGGAGGGGGTGTATGG + Intergenic
1149301635 17:55309546-55309568 TAAACTGGTGATGAGGAGGAGGG + Intronic
1149440672 17:56671268-56671290 CAAATTGGGAGGGAGGAGGGAGG + Intergenic
1149440971 17:56673571-56673593 CAATCTGGGGAGAAGAAGGAGGG + Intergenic
1149696968 17:58623714-58623736 CACAAATAGGAGGAGGAGGAAGG + Intronic
1149957755 17:61071951-61071973 AAAAATGGTGAGGCAGAGGAAGG + Intronic
1150176492 17:63062647-63062669 CAAAATGGGGAGGAGGGGGCTGG - Intronic
1150364834 17:64573156-64573178 GAGGAGGGGGAGGAGGAGGAGGG + Intronic
1150475836 17:65474001-65474023 GAAAAAGAGGAGGAAGAGGAAGG - Intergenic
1151074408 17:71254656-71254678 CAAAATGAGGAGGAACAGGATGG - Intergenic
1151115838 17:71733916-71733938 CTACACAGGGAGGAGGAGGAGGG - Intergenic
1151155480 17:72121158-72121180 CGAATTGGAGAGGAGGAGGAGGG - Exonic
1151158791 17:72147189-72147211 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1151195339 17:72427288-72427310 GAAAATGGGTAGGAGGAGAGAGG - Intergenic
1151232646 17:72695740-72695762 CACAGAGGAGAGGAGGAGGAAGG + Intronic
1151313088 17:73306090-73306112 CAAGATGGTGAGGTGGAGGTGGG + Intronic
1151441586 17:74132805-74132827 CAAGAAGAGAAGGAGGAGGAAGG + Intergenic
1151507190 17:74537130-74537152 CAAGAGGAGGAGGAAGAGGAAGG + Intergenic
1151535986 17:74738950-74738972 CATAGTGGGTAGAAGGAGGAGGG - Intronic
1151859296 17:76747795-76747817 CAAGTTGGGGAGGTGGATGAGGG + Intronic
1151860835 17:76760370-76760392 CACATTGAGAAGGAGGAGGAGGG + Intronic
1151888738 17:76939665-76939687 CAGAGTGGGGAGGAGGAAGGGGG - Intronic
1152000435 17:77641917-77641939 CAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1152002582 17:77655806-77655828 GACAATGGGGAGGAGAGGGATGG - Intergenic
1152043045 17:77917423-77917445 GAAGAGGAGGAGGAGGAGGAGGG + Intergenic
1152097222 17:78279138-78279160 CAAGATGGGGAGGAGGGGAAGGG - Intergenic
1152198993 17:78934307-78934329 CACACGGAGGAGGAGGAGGAAGG - Intergenic
1152214181 17:79023005-79023027 CAAAAAGGAGAGGAAGAAGAGGG - Intronic
1152239414 17:79153748-79153770 CAAAGGTGGGAGGAGGAGGTGGG - Intronic
1152336727 17:79703131-79703153 GAGAAGGGGGAGGGGGAGGAAGG - Intergenic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1152677892 17:81651027-81651049 CACAGTGGGCAGGAGGGGGAGGG + Exonic
1152950462 17:83227261-83227283 AGGAGTGGGGAGGAGGAGGAGGG + Intergenic
1203183467 17_KI270729v1_random:88933-88955 CAAAATGGGGAAGATGAGTGGGG - Intergenic
1153000753 18:453353-453375 GAAAATGAGAAGGATGAGGAAGG + Intronic
1153141522 18:1977914-1977936 GAAGAGGTGGAGGAGGAGGAAGG - Intergenic
1153612304 18:6898885-6898907 CAAAAGGGGGAAGAGGGTGAGGG + Intronic
1153762441 18:8344893-8344915 CAAACTGGGGAAGTGGAGGTAGG + Intronic
1154050395 18:10950715-10950737 CAGAAGAGGGAAGAGGAGGAAGG - Intronic
1154432316 18:14317686-14317708 CAAGTTGGGGAGGAGTAGGCTGG + Intergenic
1155060758 18:22226438-22226460 AAATATGGGAAGGAGGAGGCAGG + Intergenic
1155066510 18:22273703-22273725 GAGGAGGGGGAGGAGGAGGAGGG - Intergenic
1155066648 18:22274109-22274131 GAGGAAGGGGAGGAGGAGGAAGG - Intergenic
1155197222 18:23486443-23486465 CAAAATCAGGAGGAGAAGGCTGG + Intronic
1155218485 18:23663444-23663466 AATAACGCGGAGGAGGAGGAGGG - Intergenic
1155244479 18:23894364-23894386 CAACTTGGAAAGGAGGAGGAGGG - Intronic
1155252880 18:23968327-23968349 TAAAATGGAGAGGGAGAGGAAGG + Intergenic
1155342814 18:24830174-24830196 CAGGTTGGGGTGGAGGAGGAGGG - Intergenic
1155350036 18:24897342-24897364 AAAAAAGAGGAGGAGGAGAAGGG - Intergenic
1155886903 18:31218894-31218916 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1155948432 18:31882447-31882469 CCAAAAGGGGAGAAAGAGGAAGG + Intronic
1156202862 18:34854137-34854159 GACAATGGGGAGTAGGAGAATGG + Intronic
1156273117 18:35555564-35555586 CAAAATGTGGAGAAGGATGGAGG + Intergenic
1156517196 18:37690349-37690371 CAAGATGTGGAGGGGGAAGACGG + Intergenic
1157240215 18:46002330-46002352 CTAAAAGGTGAGGAGAAGGAAGG - Intronic
1157279206 18:46334558-46334580 AAAAATGGGGCTGGGGAGGAAGG - Intronic
1157385505 18:47256832-47256854 CTATATGGGGAGGAGGTGGGTGG - Intergenic
1157472053 18:47997143-47997165 AGAAAGGAGGAGGAGGAGGAGGG - Intergenic
1157482732 18:48065959-48065981 CTTATTGGGAAGGAGGAGGAGGG - Intronic
1157491735 18:48128222-48128244 CTAAATGGAGAGGAGGATGAAGG - Intronic
1157668587 18:49509529-49509551 GAACATGGTGAAGAGGAGGACGG - Intergenic
1157775350 18:50390682-50390704 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
1157914858 18:51654950-51654972 CACAATGGGGAGGCGGAGTGGGG - Intergenic
1158209537 18:55031879-55031901 CAGAAGGAGGAGGAGAAGGAAGG - Intergenic
1158423136 18:57313545-57313567 CAGAAGGAAGAGGAGGAGGAAGG + Intergenic
1158610491 18:58935443-58935465 GGAAATGGGGAGGAGGGAGAAGG - Intronic
1159079810 18:63724351-63724373 TAAGATGGGTAGGAGAAGGAGGG - Intronic
1159133962 18:64313948-64313970 CAAAATTGTGAAGTGGAGGAAGG - Intergenic
1159166146 18:64703273-64703295 CCAAATGGGGAGGGGGAAGGTGG - Intergenic
1159198706 18:65153785-65153807 AAGAAGGAGGAGGAGGAGGATGG - Intergenic
1159331048 18:66994379-66994401 CAAAATGGGGGTGGGGAGGAGGG - Intergenic
1159620851 18:70636753-70636775 CACACTGGGGAGGCTGAGGAGGG - Intronic
1159693956 18:71529697-71529719 CAAAAAATTGAGGAGGAGGAGGG + Intergenic
1159833125 18:73303061-73303083 CAGGATGAGGAGGAGGATGAGGG - Intergenic
1159926998 18:74278412-74278434 TAAAATGGGGATGAGGAAGAAGG - Intronic
1160448599 18:78946890-78946912 AAAAGGGAGGAGGAGGAGGATGG + Intergenic
1160699542 19:499137-499159 CAGAATGAGGAGGGGGAGAAAGG - Intronic
1160754604 19:750986-751008 CAAAGTCCAGAGGAGGAGGAGGG - Intergenic
1160819792 19:1052559-1052581 GAAGAAGGGGAGGAGTAGGAGGG + Intronic
1160819835 19:1052671-1052693 GAGAAGGGGGAGGAGTAGGAGGG + Intronic
1161059770 19:2209125-2209147 GACAGTGGGGAGGAGCAGGAAGG - Intronic
1161345954 19:3768814-3768836 CAGAGTGAGGAGGGGGAGGAGGG - Intergenic
1161370514 19:3908577-3908599 GAAGAGGAGGAGGAGGAGGACGG - Intronic
1161370622 19:3908902-3908924 GAGGATGGGGAGGAGGAGGATGG - Intronic
1161415623 19:4145135-4145157 GAAAAGGAGGAGGAGGAGGAGGG + Intergenic
1161556827 19:4947745-4947767 CAATATTGGGAGGCCGAGGAGGG - Intronic
1161574292 19:5047351-5047373 GATACTGGGGTGGAGGAGGATGG + Intronic
1161623200 19:5310055-5310077 CAGAGTGAGGAGGGGGAGGAGGG - Intronic
1161802432 19:6423920-6423942 CGAAATGGGGAAGACGAGCATGG - Intronic
1161837037 19:6654802-6654824 CAGGAGGAGGAGGAGGAGGATGG - Intergenic
1161865971 19:6832474-6832496 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
1161915788 19:7226874-7226896 CAAAATTGGCAGGAGGAGGAGGG - Intronic
1161937246 19:7379598-7379620 AAAAATGGGGCAGAAGAGGAGGG + Intronic
1162003988 19:7765436-7765458 CAGGAGAGGGAGGAGGAGGAGGG + Intronic
1162024161 19:7884405-7884427 GGAAAGAGGGAGGAGGAGGAGGG + Intergenic
1162053063 19:8046728-8046750 GAGGAGGGGGAGGAGGAGGATGG - Intronic
1162091684 19:8284371-8284393 AAAAAAGGCGAGGGGGAGGAGGG + Intronic
1162093921 19:8299218-8299240 AAAAAAGGCGAGGGGGAGGAGGG + Intronic
1162642503 19:12022703-12022725 CACACTGATGAGGAGGAGGAAGG + Intronic
1162735007 19:12741919-12741941 CAAAAGGGTGAGGAGCAAGATGG + Intronic
1162788605 19:13051654-13051676 CCAAGAAGGGAGGAGGAGGAGGG - Intronic
1163122021 19:15223833-15223855 GAAGACGGGCAGGAGGAGGAGGG - Intergenic
1163171190 19:15532350-15532372 AAGAAGGTGGAGGAGGAGGAGGG - Intronic
1163221169 19:15922252-15922274 GAATGTAGGGAGGAGGAGGATGG + Intronic
1163772028 19:19197067-19197089 CAACAAGGAGAGGAGTAGGAGGG + Intronic
1163772086 19:19197437-19197459 CCAAATGGGGACGAGGTGGGGGG - Intronic
1163827864 19:19533606-19533628 GAGAATGGGGAGGAGGAGGATGG - Intronic
1164234818 19:23322945-23322967 TAAAAAGGAGAGGAGGAGGAAGG - Intronic
1164292650 19:23881574-23881596 GAAGAAGGGGAGGAGGATGAAGG + Intergenic
1164504588 19:28848971-28848993 CAAAATGTGATGGAGGGGGAGGG - Intergenic
1164543883 19:29142970-29142992 CAAAATGGGGGAGAGAGGGAGGG + Intergenic
1164591984 19:29512329-29512351 GAGAAGGGGGATGAGGAGGAAGG + Intergenic
1164592120 19:29512836-29512858 GAGATGGGGGAGGAGGAGGAAGG + Intergenic
1164592302 19:29513522-29513544 GAAGAGGGGGATGAGGAGGAAGG + Intergenic
1164592636 19:29514596-29514618 GGAAAGGGGGATGAGGAGGAAGG + Intergenic
1164639888 19:29816844-29816866 AAAAATGGGGGGGAGGGGGGAGG - Intronic
1164912822 19:32026400-32026422 CCACATGGGTGGGAGGAGGAGGG - Intergenic
1165154709 19:33779976-33779998 AAAAATGGGGAGGATGATAACGG - Intergenic
1165395828 19:35563163-35563185 CAGAAAGGGGAGGAGGAGAGAGG - Intronic
1165651026 19:37490127-37490149 CAAAATAGGGAAGAGAAGAAGGG - Intergenic
1165690887 19:37862382-37862404 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1165714514 19:38035772-38035794 GATAATGAGGAGGAGGAGGATGG + Intronic
1165906203 19:39196361-39196383 CAGAGTGGGGAGGGGGAGGAGGG + Intergenic
1166008634 19:39925157-39925179 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
1166093525 19:40525528-40525550 CAAAACGAGGAGGAGGAGCCCGG + Intronic
1166294737 19:41883337-41883359 GGAAGTGGGGAGGAGGAGGGAGG + Intronic
1166568333 19:43778720-43778742 CCAGGTGGGGTGGAGGAGGAGGG - Intronic
1166780032 19:45337165-45337187 AAAAATGGGGGGCAGGGGGAAGG + Intronic
1167127200 19:47557980-47558002 CAAAATGGGCAGGGGGAGTGGGG + Intergenic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167191241 19:47991594-47991616 GAAGAGGGGGAGGAGGAGGAGGG - Intronic
1167191324 19:47991869-47991891 GAAGAGGGGAAGGAGGAGGAAGG - Intronic
1167250293 19:48395656-48395678 CCAAGCGGGGAGGAGGAGGAGGG - Intronic
1167269447 19:48499129-48499151 GAAGAAGAGGAGGAGGAGGAGGG - Exonic
1167354267 19:48993555-48993577 CAAAGTGGGGAGGAGGAGGAGGG + Exonic
1167465951 19:49651233-49651255 GAAGACGAGGAGGAGGAGGAAGG + Exonic
1167686549 19:50960127-50960149 GAGGATGGGGAGGGGGAGGAGGG + Intronic
1167695713 19:51014706-51014728 CCGACTGGGGAGGAAGAGGATGG + Exonic
1167716647 19:51146611-51146633 AAGAATGGGAGGGAGGAGGAAGG - Intronic
1167792626 19:51690936-51690958 CAAGGTGGGGAGGAAGGGGAAGG - Intergenic
1167859374 19:52270498-52270520 CAAAGTTGGGGAGAGGAGGAGGG + Intronic
1168307545 19:55443456-55443478 AAAGAAGGGGAGGAGGAGGAGGG + Intergenic
1168338141 19:55608152-55608174 AAAGATGGGGAGGAGGTGAAGGG + Intronic
1168357719 19:55712862-55712884 AAGGAGGGGGAGGAGGAGGAGGG + Intronic
1168510138 19:56967299-56967321 GAAAATGAGGAGGAGGGGAAGGG - Intergenic
1202681934 1_KI270712v1_random:14251-14273 CAAAATGGGGAAGATGAGTGGGG - Intergenic
925232048 2:2242046-2242068 GAAAAGGAGAAGGAGGAGGAAGG + Intronic
925422081 2:3720482-3720504 CAAGATGAGGAGGAGGTCGAAGG + Intronic
925496218 2:4452473-4452495 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
925611315 2:5705604-5705626 GAGAATGGGGTGGAGGAGCAGGG + Intergenic
925611442 2:5705990-5706012 GAAGAAGGGGTGGAGGAGGAGGG + Intergenic
925718788 2:6808785-6808807 GAGAAAGGGGAGGAGGAGGGAGG + Intergenic
925899556 2:8498871-8498893 CAAAATGAGGATGAGGATGGAGG + Intergenic
926754901 2:16226828-16226850 CACCAGGGGAAGGAGGAGGAGGG - Intergenic
927135020 2:20090757-20090779 CGAAGTGTGGAGGAGGAGGAGGG - Intergenic
927181582 2:20450389-20450411 GGGAATGGGGAGGAGGGGGAAGG - Intergenic
927461457 2:23302107-23302129 CAAAGTGGGGGGGGGGAGGGTGG - Intergenic
927471974 2:23384191-23384213 CAGACAGGGGTGGAGGAGGAGGG + Intergenic
927648580 2:24897219-24897241 GAGAAGGGGAAGGAGGAGGAGGG - Intronic
927695029 2:25234003-25234025 AAAAAAGGGAAGGGGGAGGAAGG + Exonic
927924845 2:27004405-27004427 GAAAATGAGGGGGAGGAGGAAGG - Intronic
928220424 2:29398688-29398710 GAAACTGGGAAGGAGGAGGGGGG - Intronic
928358051 2:30638764-30638786 GAGAATGGGGAGGAGGAGCAGGG - Intronic
928981866 2:37144495-37144517 CAAAATCTGGAGGTGGAAGATGG + Intronic
929759920 2:44798340-44798362 CCCCATGGGGAGGAGGAGGATGG - Intergenic
929859070 2:45660253-45660275 AGAAGTGAGGAGGAGGAGGAAGG + Intronic
929960690 2:46494076-46494098 CAGAGAGGGGAGGAGAAGGAGGG + Intronic
930075495 2:47402725-47402747 AAATACTGGGAGGAGGAGGAAGG + Intergenic
930364641 2:50424152-50424174 GAGGAAGGGGAGGAGGAGGAGGG + Intronic
930364654 2:50424182-50424204 GAAGAGGGGGAGGAGGAGGAGGG + Intronic
930615226 2:53586832-53586854 CACAGTGAGGAAGAGGAGGAAGG + Intronic
930715279 2:54588190-54588212 TAAAAGGAGGAGGAAGAGGAAGG - Intronic
930752235 2:54945156-54945178 GAAAGAGGGGAGGGGGAGGAGGG - Intronic
930878447 2:56245633-56245655 AAAAATGGGCAGGAAGAGAAAGG - Intronic
930909071 2:56608460-56608482 CATTATGGGCAGGAGGAAGAGGG - Intergenic
931205364 2:60140903-60140925 GAAGAGGGGGAAGAGGAGGAGGG - Intergenic
931513152 2:63022297-63022319 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
931584601 2:63811754-63811776 CAAAATGGGGAGGGAGAATAGGG - Intronic
931603857 2:64031805-64031827 AAAAATGGGGGGGAGGGGGGAGG + Intergenic
931902756 2:66807544-66807566 AAAGAAGAGGAGGAGGAGGAGGG + Intergenic
931992766 2:67807740-67807762 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
932024498 2:68119793-68119815 CTGAAAGGGGAGGAGGGGGAAGG - Intergenic
932369684 2:71176793-71176815 AAAGAAGGGGAGAAGGAGGAAGG - Intergenic
932402701 2:71492692-71492714 GAAAAGGGGGGGGGGGAGGAAGG - Intronic
932552975 2:72790941-72790963 CAGAATGGGGAAGGGGAGGATGG + Intronic
932559186 2:72852144-72852166 AAAAATTGGAAGGAAGAGGATGG - Intergenic
932614922 2:73225878-73225900 GAAGAGGAGGAGGAGGAGGAAGG + Exonic
932941731 2:76174737-76174759 CAAAATGAACAGGAGTAGGAAGG - Intergenic
932954999 2:76341334-76341356 AAAAAGGTGGAGGAGGTGGAAGG + Intergenic
933197385 2:79407605-79407627 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
933275180 2:80276678-80276700 GAAGAAGAGGAGGAGGAGGAGGG + Intronic
933454973 2:82508564-82508586 CAACATGGTGGGCAGGAGGAGGG - Intergenic
933563890 2:83925294-83925316 CATAATGGGCAGGCAGAGGAGGG + Intergenic
934249835 2:90340843-90340865 CAAAATGGGGAAGATGAGTGGGG + Intergenic
934259738 2:91462603-91462625 CAAAATGGGGAAGATGAGTGGGG - Intergenic
934303039 2:91794532-91794554 CAAAATGGGGAAGATGAGTGGGG - Intergenic
934330221 2:92058224-92058246 CAAAATGGGGAAGATGAGTGGGG + Intergenic
934468442 2:94288133-94288155 CAAAATGGGGAAGATGAGTGGGG + Intergenic
934535320 2:95128581-95128603 GAGGATGAGGAGGAGGAGGAGGG + Intronic
934653205 2:96104077-96104099 GAAGAGGAGGAGGAGGAGGAAGG - Intergenic
934757725 2:96836072-96836094 AAAAAAGGGGGGGAGGGGGAGGG - Intronic
935313335 2:101806862-101806884 CAAAAGGGAAAGGAGGAAGAAGG + Intronic
935346591 2:102113773-102113795 CATCATGGGGAGGAGATGGATGG - Intronic
935403400 2:102683696-102683718 GATAATAGGGAAGAGGAGGAAGG - Intronic
935851369 2:107223602-107223624 GAAAATGTGGGGGAAGAGGATGG - Intergenic
936027635 2:109045743-109045765 GAAAGAGGGGAGGAGGAAGAAGG + Intergenic
936106119 2:109626114-109626136 CAAAATAGGGACGAACAGGAAGG - Intergenic
936261872 2:110966662-110966684 AAAATAGGGGAGGAGGAAGAAGG - Intronic
936479133 2:112868789-112868811 AAAAATGGGGTGGAGGTTGATGG + Intergenic
937111847 2:119372700-119372722 CTTTGTGGGGAGGAGGAGGATGG + Intergenic
937112717 2:119378784-119378806 CAAGAGAGTGAGGAGGAGGAGGG - Intergenic
937152324 2:119694583-119694605 CAAAGGGGCCAGGAGGAGGATGG - Intergenic
937209214 2:120257263-120257285 AATAATGGGGAGGAGTAAGAGGG - Intronic
937268779 2:120633784-120633806 CAAAATGGTGATGAGGAGAGGGG + Intergenic
937304341 2:120861989-120862011 CCAGATGGGGAGGAGGAACACGG + Intronic
937573353 2:123390970-123390992 GAGAATGGGGAGGAGGAAGGAGG - Intergenic
937862783 2:126724000-126724022 CAAAAGTTGGAGGAGGAGAAAGG - Intergenic
937969403 2:127537687-127537709 GAAGAAGAGGAGGAGGAGGAGGG + Intronic
938053011 2:128192249-128192271 AAAAACTGGCAGGAGGAGGAGGG - Exonic
938324774 2:130391094-130391116 GAAAATGGGGATGAGAAGAAGGG - Intergenic
938518674 2:132042416-132042438 AAAAAGGAGGAGGAGGGGGAGGG + Intergenic
938639500 2:133265410-133265432 CCAAAAGGAGAGGAGGAGGAAGG + Intronic
938698753 2:133857962-133857984 AAAGGTGGGGAGGAGGGGGAGGG - Intergenic
938736594 2:134191669-134191691 GAGAAAGAGGAGGAGGAGGAGGG - Intronic
938853924 2:135290669-135290691 CACAATGGGGTGGGGGTGGAGGG - Intronic
939160098 2:138577271-138577293 CAGGAGGAGGAGGAGGAGGAGGG + Intergenic
939314109 2:140524790-140524812 CCAAAAGGGGAGAGGGAGGAAGG + Intronic
939397912 2:141655096-141655118 TAAACTGGGGAGGAGGAAGAGGG + Intronic
939554687 2:143660235-143660257 CAGAATGTGGAGGAGGAAGGAGG - Intronic
939945317 2:148402514-148402536 GAAGATGGGGAGAAGTAGGAGGG - Intronic
939966950 2:148619636-148619658 AAAAAGGAGGAGGAGGAGGGAGG - Intergenic
940089662 2:149901269-149901291 CCAGTTGGGGAGGAGAAGGAGGG + Intergenic
940192557 2:151057956-151057978 TAAAGTGGGAAGTAGGAGGATGG + Intergenic
940690772 2:156917822-156917844 AGAAATGGGGAGGGGGATGAAGG - Intergenic
941209644 2:162621430-162621452 CAACATGGGGAAGAGAAAGAGGG + Intronic
941494542 2:166183415-166183437 AAAAAGGAGGAGGAGGAGAATGG - Intergenic
941591149 2:167422126-167422148 GAGAAGGGGGAGGAGGAGGGAGG + Intergenic
941838452 2:170052645-170052667 CAAAATAGAGAGTAGGAGGGTGG + Intronic
942215790 2:173717972-173717994 AAACATGGGGAGGAAGGGGAAGG + Intergenic
942279273 2:174343981-174344003 CGAAATGGGGAGGCCGAGAAGGG - Intergenic
942388770 2:175470147-175470169 CAAAAAAGAGAGGAGGAGGAGGG - Intergenic
942418442 2:175782826-175782848 TAAAATGTGCAGGAGGAGGCCGG - Intergenic
942460050 2:176162453-176162475 CAAAAACGGGAAGAGCAGGAAGG - Intronic
942572042 2:177324509-177324531 CAAAATGAAGAGGAGGGGGTGGG - Intronic
942800729 2:179872586-179872608 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
944205448 2:197153283-197153305 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
944218568 2:197279655-197279677 CAAACTAGGAAGAAGGAGGAAGG - Intronic
944861561 2:203819979-203820001 CACAATGGGGTGGAGAAGGCGGG + Intergenic
944923327 2:204437789-204437811 TAAAATGGGGAGTGGGTGGAGGG + Intergenic
945140840 2:206684732-206684754 GAAAATGGGGAAGAAGAGGTGGG - Intronic
945451272 2:209999398-209999420 CAGACTGGGGAGGTTGAGGATGG - Intergenic
945636026 2:212352166-212352188 GAAAATGGAGGGTAGGAGGAGGG + Intronic
945642211 2:212444104-212444126 CAGGCTGGGGAAGAGGAGGAGGG - Intronic
945680019 2:212902825-212902847 AAAAAGGAGGAGGAGAAGGAAGG - Intergenic
945824826 2:214708813-214708835 CAAAATGGGGAAAAAGAGAAGGG - Intergenic
945853460 2:215038428-215038450 CAACATGGTGGGGAGGAGGAGGG + Intronic
946029982 2:216695820-216695842 GAGAATGGGGAGGAGGTGGAGGG + Intergenic
946089403 2:217207598-217207620 CAAAATGAGCACGAGGATGACGG - Intergenic
946247936 2:218397939-218397961 TAAGATGGGGTGGAGGAGGTGGG + Intergenic
946330107 2:219004204-219004226 GAAGAGGGGGAGGAGGAGAAGGG - Exonic
946429787 2:219619172-219619194 GAAGATGAGGATGAGGAGGAAGG + Intergenic
946694631 2:222342299-222342321 GAAAAGGAGGAGGAAGAGGAGGG - Intergenic
946724108 2:222644378-222644400 GAGAATGAAGAGGAGGAGGAAGG + Intronic
946846646 2:223864901-223864923 GAAGAAGTGGAGGAGGAGGAGGG - Intronic
946899107 2:224355316-224355338 GAACAAGAGGAGGAGGAGGAGGG - Intergenic
946945754 2:224820359-224820381 CAAAGTGTGGAGCAGGAGGAAGG + Intronic
947066954 2:226237807-226237829 AAAAAGGGGGAGCAGGAGGAAGG + Intergenic
947220718 2:227789479-227789501 GAAAGAGAGGAGGAGGAGGAAGG - Intergenic
947353030 2:229266253-229266275 AAAAATGGGGAGAAGGAGGGAGG - Intronic
947636945 2:231684981-231685003 CACAGCGAGGAGGAGGAGGATGG + Intergenic
947783025 2:232787248-232787270 CAAAATGGAGAAGATGAAGATGG + Exonic
947909143 2:233790346-233790368 AAAAAGGGGGAGGGAGAGGAAGG - Intronic
948011917 2:234655798-234655820 TAAAATCTGGAGTAGGAGGATGG - Intergenic
948258158 2:236583620-236583642 CAAAATGGGGAGGGGGAGGAGGG + Intergenic
948287153 2:236794882-236794904 AACAATGGAGAGGAGGATGAGGG - Intergenic
948320042 2:237061699-237061721 CAAGATGGGGAGATGGAGGAAGG + Intergenic
948341680 2:237257787-237257809 TAAAATGGGGATGTGGAGGGTGG - Intergenic
948406302 2:237722596-237722618 TAAGATGGGGAGGAAGTGGATGG + Intronic
948558554 2:238835228-238835250 GAAGAAGAGGAGGAGGAGGAGGG - Intergenic
948606778 2:239140929-239140951 CACAGTGAGGAGGATGAGGAGGG + Intronic
948617017 2:239205684-239205706 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
948720566 2:239897679-239897701 GAAGAAGAGGAGGAGGAGGAGGG - Intronic
948782268 2:240329221-240329243 GAGCATGGGGAGGAGGAGGCTGG + Intergenic
948831219 2:240599181-240599203 CGAGATGGTGAGGATGAGGATGG + Intronic
948939284 2:241188031-241188053 GAGAATGAGGACGAGGAGGAGGG + Intergenic
1168837341 20:886016-886038 GAAGATGGAGAGGAGGAAGATGG + Intronic
1168912251 20:1458206-1458228 GAAGATGAGGAGGAAGAGGAAGG - Exonic
1169325253 20:4670551-4670573 CAGGATGAGGAGGAGGAAGAGGG + Intergenic
1169474892 20:5922631-5922653 GAGGATGAGGAGGAGGAGGAGGG + Exonic
1169734812 20:8826000-8826022 CAAACTGGGAATGAGGGGGAGGG + Intronic
1169914243 20:10671755-10671777 CAAAATGGGTGGAAGGAAGATGG - Intronic
1169922459 20:10749823-10749845 CAAAATGGGAAGGAGTGGGGAGG - Intergenic
1169954354 20:11084682-11084704 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1170006457 20:11675132-11675154 CACTCTGAGGAGGAGGAGGAAGG - Intergenic
1170006516 20:11675713-11675735 CAAGATGGGAAGGAAGGGGAGGG + Intergenic
1170024268 20:11872005-11872027 AAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1170158570 20:13290257-13290279 CAATATGAGGAGGAGGAAGAGGG + Intronic
1170510173 20:17068270-17068292 TAAAATATGGAGGAGGAGGCAGG + Intergenic
1170544213 20:17420010-17420032 CAAAATGGAGGGAAGGAAGATGG + Intronic
1170545634 20:17433827-17433849 GAAGGGGGGGAGGAGGAGGAGGG - Intronic
1170546509 20:17439416-17439438 AAAAATGGGGTGGAAGAGGCCGG - Intronic
1170779626 20:19412611-19412633 CAAGAGGAGGAGGAGGAGGAGGG + Intronic
1170809721 20:19664484-19664506 CAAAATGAGGATGAGGAGGAAGG - Intronic
1170821726 20:19759914-19759936 ACAAATGGGGAGGTGGGGGAGGG - Intergenic
1170864583 20:20142122-20142144 AAAAAAGGAGGGGAGGAGGAGGG + Intronic
1170929056 20:20752240-20752262 CAGAATGGGGAGGAGGAAACAGG + Intergenic
1171237440 20:23539143-23539165 AAAAGTGGGAAGCAGGAGGAGGG - Intergenic
1171850833 20:30306845-30306867 ATGAATGGGGAGGAAGAGGATGG - Intergenic
1172010367 20:31842896-31842918 AACAATGGGGAGGAGGAGCAAGG - Intergenic
1172043035 20:32059460-32059482 AAGAAGGAGGAGGAGGAGGAAGG - Intronic
1172228772 20:33323158-33323180 AAGAAGGGGCAGGAGGAGGAAGG + Intergenic
1172437327 20:34938621-34938643 CAAAAAGAGGCGGAGGAGGAAGG + Intronic
1172682932 20:36730856-36730878 TAAAACTGGGAGGAGGAGGTTGG + Intronic
1172815820 20:37685137-37685159 GAAGAAGAGGAGGAGGAGGAAGG + Intergenic
1172937399 20:38630040-38630062 AAAAAGAAGGAGGAGGAGGAGGG - Intronic
1172963597 20:38816885-38816907 CTAATGGGGGAGGAGGAGGGTGG - Intronic
1172999252 20:39093650-39093672 CAAAATGTGGAGAAAGAAGAGGG + Intergenic
1173002078 20:39111731-39111753 GGAAAAGGGGAGGAGGAGGAGGG + Intergenic
1173056284 20:39616490-39616512 GAAAATGGGGGGCAGGAGGATGG - Intergenic
1173417108 20:42866445-42866467 AAAAATGGGGAGGAGGAAAAGGG - Intronic
1173564080 20:44026906-44026928 CAAGGTGGGGAGGAGGCGGCAGG - Intronic
1173781586 20:45761076-45761098 CAGCCTGGGGAGGAGGAGAAAGG - Intronic
1174458788 20:50668329-50668351 CATCAGGGGCAGGAGGAGGAAGG - Intronic
1174520385 20:51125347-51125369 GAAGATGGGGAGGAGGTGGAAGG - Intergenic
1174808256 20:53623534-53623556 CAGCACGAGGAGGAGGAGGAGGG - Intergenic
1175056275 20:56201496-56201518 CATCATGGGGAGAGGGAGGAAGG + Intergenic
1175120261 20:56711113-56711135 GAGAAGGGAGAGGAGGAGGAAGG - Intergenic
1175164424 20:57033238-57033260 CAAAATTGGGATGAGGAGGTGGG + Intergenic
1175226154 20:57445070-57445092 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1175260859 20:57673229-57673251 GAGAATGGGCAGCAGGAGGAGGG - Intronic
1175267422 20:57710735-57710757 CAAAAGGGGTATGAGCAGGAGGG + Intronic
1175341842 20:58236915-58236937 CTAAATGGGGATGGGGAGAAGGG + Intergenic
1175579895 20:60090272-60090294 CAAGAAGAGGAGGAGGATGAAGG - Intergenic
1175730970 20:61353695-61353717 GAAGCAGGGGAGGAGGAGGAGGG - Intronic
1176057133 20:63154817-63154839 GAAAGGGGGGAGGAGGAGGAAGG - Intergenic
1176362063 21:6006180-6006202 CAAAAGGAGGAGGAGGAGGGGGG + Intergenic
1176549359 21:8214667-8214689 GAGACGGGGGAGGAGGAGGACGG - Intergenic
1176557252 21:8258890-8258912 GAGACGGGGGAGGAGGAGGACGG - Intergenic
1176568290 21:8397704-8397726 GGAGACGGGGAGGAGGAGGACGG - Intergenic
1176576194 21:8441925-8441947 GAGACGGGGGAGGAGGAGGACGG - Intergenic
1176585443 21:8580218-8580240 CAAAATGGGGAAGATGAGTGGGG - Intergenic
1176847465 21:13887629-13887651 TAAAGTGGGGAGGAGTAGGCTGG - Intergenic
1177201783 21:17965439-17965461 GAAGAGGAGGAGGAGGAGGATGG - Intronic
1177570045 21:22875305-22875327 AGAAATAGGGAGGAGGAGCAGGG + Intergenic
1177618515 21:23556520-23556542 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1177758325 21:25373733-25373755 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1177913713 21:27061761-27061783 TAAAAGGGGGATGAAGAGGAAGG - Intergenic
1178213149 21:30560665-30560687 AAGAATGACGAGGAGGAGGAGGG + Intronic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1178505252 21:33157391-33157413 AGAAAGAGGGAGGAGGAGGAGGG - Intergenic
1178624911 21:34206707-34206729 CAAAAATGGGAGCATGAGGAAGG - Intergenic
1178692726 21:34763127-34763149 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1178699167 21:34818965-34818987 CAAGCTGGGGAGGAGGGGAAAGG + Intronic
1178719559 21:34996283-34996305 CTAAGAGGGGATGAGGAGGAGGG + Intronic
1179137247 21:38690605-38690627 CAAAATGGGGGAGCGTAGGAGGG + Intergenic
1179189651 21:39112823-39112845 GAAAAGGAGGAGAAGGAGGATGG + Intergenic
1179436612 21:41366675-41366697 CAATATGGGGCGGAGGAAGACGG - Intronic
1179549036 21:42131567-42131589 GAAGCTGGGGAGCAGGAGGAGGG + Intronic
1179761455 21:43532365-43532387 CAAAAGGAGGAGGAGGAGGGGGG - Intronic
1180228858 21:46414418-46414440 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
1180268251 22:10557117-10557139 CAAAATGGGGAAGATGAGTGGGG - Intergenic
1180280975 22:10695167-10695189 AAAAAGGTGGAGGAGGGGGAGGG - Intergenic
1180280985 22:10695202-10695224 AAAAAGGTGGAGGAGGGGGAGGG - Intergenic
1180534273 22:16383077-16383099 AAAAAGGAGGAGGAGGGGGAGGG - Intergenic
1181308209 22:21928871-21928893 CTAATGGGGGAGCAGGAGGAGGG - Intronic
1181819197 22:25462560-25462582 CAGAAGGGGGAGGAAGAGGGAGG - Intergenic
1181882850 22:25994957-25994979 CCAAATTGGAAGGAGGCGGAGGG + Intronic
1181883372 22:25999522-25999544 GAAGAGGGGGAGGAGGGGGAGGG - Intronic
1181887209 22:26030797-26030819 CCAAGTGAAGAGGAGGAGGAAGG - Exonic
1181931335 22:26403936-26403958 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1182057300 22:27369661-27369683 CAGAGTGAGGGGGAGGAGGAGGG + Intergenic
1182088958 22:27581010-27581032 CAATATGGGGTGGGGGAGGTGGG + Intergenic
1182420510 22:30246424-30246446 GAAGAAGAGGAGGAGGAGGAAGG + Intronic
1182561908 22:31166606-31166628 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1182567695 22:31212372-31212394 GGAAATGGGGAGGAGGAGGCGGG - Intronic
1182645023 22:31801388-31801410 CACACTGGGGAGCAGGAGAAGGG - Intronic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1182897869 22:33873756-33873778 GGAAAGGAGGAGGAGGAGGAAGG - Intronic
1182913706 22:34008802-34008824 TTCAAGGGGGAGGAGGAGGATGG - Intergenic
1183168640 22:36167130-36167152 AAGAGTGGGAAGGAGGAGGAGGG + Intergenic
1183214781 22:36472562-36472584 CAAAATTGAGAGGAAGGGGAAGG - Intronic
1183253561 22:36746494-36746516 CAAAAGGGAGGGGTGGAGGAGGG - Intergenic
1183274589 22:36885662-36885684 CAGAATGGGGAAGGAGAGGAGGG - Intergenic
1183328432 22:37206731-37206753 GAGGATGAGGAGGAGGAGGATGG - Exonic
1183357312 22:37366699-37366721 CCAAGGGAGGAGGAGGAGGACGG - Intergenic
1183551082 22:38485952-38485974 GAGGAGGGGGAGGAGGAGGAGGG + Exonic
1183598204 22:38824873-38824895 CTGGAGGGGGAGGAGGAGGAGGG - Intronic
1183606506 22:38869583-38869605 CCATGTGGGGAGGAAGAGGAAGG - Intronic
1184117194 22:42429050-42429072 CTCAAGTGGGAGGAGGAGGATGG + Intronic
1184330513 22:43824225-43824247 ATAAATGGGGTGGAGGAGAAAGG - Intergenic
1184412335 22:44332379-44332401 GGGAGTGGGGAGGAGGAGGAAGG - Intergenic
1184505640 22:44900099-44900121 TAAAATTGAGAGGAGAAGGAGGG - Intronic
1184572772 22:45337051-45337073 CAAACCTGGGAGGAGGAGGAGGG - Intronic
1184764078 22:46562428-46562450 CTTCATGGGGAGGTGGAGGAAGG + Intergenic
1184902787 22:47457914-47457936 GAAAAGCAGGAGGAGGAGGAAGG + Intergenic
1185089403 22:48757323-48757345 GAGGATGGGAAGGAGGAGGAGGG + Intronic
1185267604 22:49912452-49912474 CCAAATGGGGAGGAGTTGGGGGG - Intronic
1203237301 22_KI270732v1_random:17566-17588 CAAAATGGGGAAGATGAGTGGGG - Intergenic
1203254244 22_KI270733v1_random:130983-131005 GAGACGGGGGAGGAGGAGGACGG - Intergenic
1203262300 22_KI270733v1_random:176062-176084 GAGACGGGGGAGGAGGAGGACGG - Intergenic
1203315370 22_KI270737v1_random:2719-2741 AAAAAGGAGGAGGAGGGGGAGGG + Intergenic
949250100 3:1973200-1973222 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
949562375 3:5214503-5214525 CATAATCGGGAGGAAGGGGAAGG + Intronic
949758638 3:7443030-7443052 AAAGAGGAGGAGGAGGAGGATGG - Intronic
949828812 3:8191807-8191829 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
950001918 3:9663311-9663333 TAAATTGGGAAAGAGGAGGAAGG + Intronic
950013416 3:9739801-9739823 GAAGATGAGGAGGAGGATGAGGG + Exonic
950130054 3:10536466-10536488 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
950139099 3:10602885-10602907 CCAAAAGTGGAGGAGGAGGGAGG - Intronic
950219831 3:11186043-11186065 CAAGGTGGGCAGGAGGAGCAAGG - Intronic
950540125 3:13607428-13607450 TAGGAGGGGGAGGAGGAGGAGGG + Intronic
950555373 3:13692577-13692599 GAACATGGGGAGGAGGATGCAGG - Intergenic
950723778 3:14902655-14902677 CAAAATGAGGAGGGGCAGGGAGG - Intronic
950983164 3:17330965-17330987 GAGAATGGGGAGGAAAAGGAGGG - Intronic
951378638 3:21955377-21955399 AAAAATAGGGAGGAAGAAGATGG + Intronic
951705511 3:25540495-25540517 CTAAAAGGGGAGGAGGATGAGGG - Intronic
951765463 3:26193328-26193350 CCAAAAGGGAAGGAGGAAGATGG - Intergenic
952142796 3:30498589-30498611 CAAAGTTGGGAGGAAAAGGATGG - Intergenic
952962446 3:38601101-38601123 TAAGATGGGGAGGAGTAGGGTGG - Intronic
952971678 3:38654912-38654934 AAAAATGGGGAGGAAGAGTGAGG - Intergenic
953027261 3:39152468-39152490 CAAGATGTGGAGAAGGAAGAGGG + Intronic
953374306 3:42415829-42415851 GGAAAGGAGGAGGAGGAGGAAGG + Intergenic
953448470 3:42987301-42987323 CAAAGTGGAGAGGAAGGGGAAGG + Intronic
953664751 3:44917730-44917752 CAACATGGAGAGAAGAAGGAGGG + Intronic
953879567 3:46684609-46684631 CAGAATGGGGAGGACGTGGGAGG + Intronic
953997800 3:47534087-47534109 CTAACTGGGGAGGAGGAGCCAGG + Intergenic
954323812 3:49850559-49850581 TAATATGGGGAGGTGGAGGGAGG + Intronic
954707222 3:52487470-52487492 CCAGACGTGGAGGAGGAGGAGGG + Exonic
954876492 3:53806048-53806070 AAAATGAGGGAGGAGGAGGAGGG - Intronic
954887806 3:53891893-53891915 CAAAATGCTGACGAGGACGAAGG + Exonic
955044710 3:55348877-55348899 CACCATGGGGAGGGGGAGGCAGG - Intergenic
955087826 3:55720104-55720126 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955349279 3:58182149-58182171 AAAGAAGGGGAGGAGGAGGAAGG + Intergenic
955683064 3:61522566-61522588 CACACTGTGGAGGAGGGGGAAGG + Intergenic
955833638 3:63030420-63030442 CAAGAAGAGGAGGAAGAGGAAGG + Intergenic
955850996 3:63219785-63219807 TAGACTGAGGAGGAGGAGGAAGG + Intergenic
955885706 3:63596287-63596309 GAGAAGGGGGAGGAGGGGGAAGG - Intronic
955935321 3:64097476-64097498 CATTAAGGGGAGGAGGAGGATGG + Exonic
956181952 3:66525358-66525380 AAAGAAGGGGAGGAGGAGGAAGG - Intergenic
956198802 3:66683937-66683959 AAAAAGGAGGAGGAGGAGGGAGG - Intergenic
956198828 3:66684102-66684124 GAAGAAGAGGAGGAGGAGGAAGG - Intergenic
956212623 3:66817301-66817323 AAGAAGGAGGAGGAGGAGGAAGG + Intergenic
956283292 3:67582257-67582279 GAAAATGGAGGGTAGGAGGAGGG - Intronic
956989308 3:74745077-74745099 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
957084453 3:75667706-75667728 GAAAGTAGGGAGGGGGAGGAAGG + Intergenic
957377309 3:79375269-79375291 CAGAGTTGGGAAGAGGAGGAAGG + Intronic
957511041 3:81187545-81187567 CAAGAGAGGGAGGAGGTGGAAGG - Intergenic
957640771 3:82850346-82850368 GACAATGAGGAGAAGGAGGAGGG - Intergenic
957748306 3:84374715-84374737 AAAAAGGTGGAGGAGGAGAAAGG + Intergenic
958157765 3:89776246-89776268 AAGAAAGAGGAGGAGGAGGAGGG - Intergenic
958793393 3:98680017-98680039 AAGAAAGGGGAGGAGGAGAAGGG - Intergenic
958798936 3:98733816-98733838 GACAGTGGGGAGGAGCAGGAGGG + Intronic
958816641 3:98923909-98923931 GGAGAAGGGGAGGAGGAGGAAGG - Intergenic
959614490 3:108331843-108331865 TAGAATGGGGAGGGGGAGGCAGG - Intronic
959623244 3:108421699-108421721 AAGAAGGGGAAGGAGGAGGAAGG + Intronic
960361413 3:116716368-116716390 CAGTTTGGGGAGGTGGAGGAGGG + Intronic
960444509 3:117731210-117731232 GCAAATGTGGAGGTGGAGGAGGG + Intergenic
960444890 3:117735832-117735854 CAAAATGGGGAGGAGGTAGTAGG - Intergenic
960529920 3:118753007-118753029 GAAAATGAGGAGAAGGAGAAAGG + Intergenic
960530671 3:118760711-118760733 CTAACTGGGGAGAAGGAGCAGGG - Intergenic
960598959 3:119436067-119436089 CAAAAGGGGGAAGATGAAGATGG + Intronic
960617577 3:119609969-119609991 CAAAAGGGGGAGGAAAAGCAAGG - Intronic
960788357 3:121399150-121399172 CACACTGATGAGGAGGAGGAAGG - Intronic
960836439 3:121911459-121911481 TAAATGGAGGAGGAGGAGGAGGG - Intronic
960928756 3:122822958-122822980 CACAGTGGGGAGGTGGAGGGCGG - Intronic
960942832 3:122945820-122945842 AAAAATGGGGAGGTGGGGGTGGG + Intronic
961030581 3:123600054-123600076 TAGGAAGGGGAGGAGGAGGAAGG - Intergenic
961087786 3:124084055-124084077 CTAAATGGGGAGAAGGAGAAAGG + Intronic
961236945 3:125375261-125375283 GAAGAGGAGGAGGAGGAGGAGGG - Exonic
961311730 3:126006628-126006650 CAGATTGGGGTGGAGCAGGAAGG - Intronic
961348706 3:126284363-126284385 CAGAATGTGGAGGTGGAAGATGG - Intergenic
961405401 3:126675787-126675809 GAAAATAGGGAGGGGGAGAATGG + Intergenic
961442754 3:126962548-126962570 CACTATGGGGAGGAGGGAGAGGG - Intergenic
961834619 3:129646798-129646820 CAGATTGGGGAGGCAGAGGAAGG - Intergenic
962054411 3:131854796-131854818 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
962382441 3:134908749-134908771 GAGGAGGGGGAGGAGGAGGAAGG + Intronic
962545472 3:136429776-136429798 TACACTGGGGAGGAGGAAGAGGG - Intronic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
962989591 3:140566152-140566174 GAAGAGGAGGAGGAGGAGGAAGG + Exonic
963417784 3:145020552-145020574 TGAAAGGGGGTGGAGGAGGATGG - Intergenic
963600949 3:147378431-147378453 AAAGAGGAGGAGGAGGAGGATGG + Intergenic
963796476 3:149635603-149635625 CGGAAGAGGGAGGAGGAGGAAGG + Intronic
963987800 3:151617320-151617342 GAGGAGGGGGAGGAGGAGGAGGG - Intergenic
964011850 3:151901114-151901136 GAAATTGGAGAGCAGGAGGAAGG - Intergenic
964012905 3:151912354-151912376 TAAAGTGGTGAGGAGGATGAAGG + Intergenic
964067098 3:152593439-152593461 GAAAAGGGGGAGAAGGAAGAGGG + Intergenic
964440215 3:156700793-156700815 CAAAATGGTAAGGGGAAGGAGGG + Intronic
964445442 3:156752780-156752802 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
964568135 3:158080875-158080897 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
964667620 3:159191305-159191327 GAAGATGAGGAGGAGGAGGCTGG + Intronic
964736183 3:159920974-159920996 CAAAAATAGAAGGAGGAGGAAGG + Intergenic
964794248 3:160480523-160480545 AAAAGTGGGGAGGAGGCGGTGGG - Intronic
965172176 3:165279900-165279922 GAAGAAGAGGAGGAGGAGGAAGG - Intergenic
965238551 3:166160962-166160984 CAAAAAGGGGAGGTGGGGGGAGG + Intergenic
965598222 3:170428622-170428644 AAAAATGAGAAGGAGGAGAAGGG - Intronic
965680189 3:171242314-171242336 GAAAATGAGGAAGAGGAGGAAGG - Intronic
966026214 3:175286288-175286310 AAAAAGGAGGAGGAGGAGGCTGG + Intronic
966087355 3:176084736-176084758 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
966104454 3:176319530-176319552 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
966128214 3:176605424-176605446 GAAAATGGGGAGAAATAGGAAGG + Intergenic
966525772 3:180917586-180917608 CAAAACGTGGAGGGGAAGGAAGG + Intronic
966554353 3:181242598-181242620 CAAATGGAGGAAGAGGAGGAGGG - Intergenic
966616380 3:181917962-181917984 AAGAGAGGGGAGGAGGAGGAAGG + Intergenic
966908484 3:184544521-184544543 GAGGAGGGGGAGGAGGAGGAGGG - Intronic
966908531 3:184544637-184544659 TAGGAGGGGGAGGAGGAGGAGGG - Intronic
967115799 3:186336743-186336765 GAGAAGGGGAAGGAGGAGGAGGG + Intronic
967251116 3:187539842-187539864 GAGAAAGGGGAGGAGGAAGAGGG + Intergenic
967830347 3:193913198-193913220 CATAATGGGAAGGGGGTGGAGGG + Intergenic
967864937 3:194182310-194182332 GAGCAGGGGGAGGAGGAGGAAGG - Intergenic
968078175 3:195828304-195828326 CCAACTGAGGAGGAGGAGGAGGG + Intergenic
968446666 4:655568-655590 CAGCCTGGGGAGGAGGAAGAAGG + Intronic
968757092 4:2422463-2422485 CAAATCGAGGAGGAGGAAGAGGG - Intronic
968889153 4:3358857-3358879 GAGAAGGGGGAGGCGGAGGAGGG - Intronic
968889183 4:3358937-3358959 GAAGAAGGGGAGGGGGAGGAAGG - Intronic
968889297 4:3359193-3359215 GGAGAAGGGGAGGAGGAGGAGGG - Intronic
968889346 4:3359318-3359340 AAGAAGGGGGAGGAGGGGGAGGG - Intronic
968889379 4:3359392-3359414 GAGAAGGGGGAGGAGGGGGAGGG - Intronic
968903590 4:3442054-3442076 CAGCAGGAGGAGGAGGAGGAAGG - Exonic
969039122 4:4280935-4280957 CAGAATAGGTAGCAGGAGGAAGG - Intronic
969143878 4:5102937-5102959 CAAAAAGGAGAGGAGGGGGAGGG - Intronic
969454777 4:7294848-7294870 GAGAAGGGAGAGGAGGAGGAGGG - Intronic
969838267 4:9861008-9861030 CAAAATGAGGAGGAGAATGATGG - Intronic
970326833 4:14934513-14934535 CAGGCTGAGGAGGAGGAGGACGG + Intergenic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
971052809 4:22880184-22880206 CAAAATGGGTAGATGGAAGATGG - Intergenic
971766277 4:30835824-30835846 TTAAAATGGGAGGAGGAGGAGGG + Intronic
971769829 4:30882107-30882129 GAGAAACGGGAGGAGGAGGAGGG - Intronic
971769858 4:30882194-30882216 TAAAAGGAAGAGGAGGAGGAAGG - Intronic
971784647 4:31084760-31084782 GGAGATGGGGAGGAGGGGGAGGG + Intronic
972302286 4:37796168-37796190 CAAAATGGTGTGGAGGAAAAAGG - Intergenic
972633987 4:40866484-40866506 CAAAGTGAGGAGGAAGAGGGAGG - Intronic
972910415 4:43809499-43809521 CAAGTTGGTGAGGAGGTGGAGGG - Intergenic
973560951 4:52134673-52134695 CAAAGTTGGTAGGAGGAAGAAGG + Intergenic
973582661 4:52359488-52359510 GAAGGTGGGGAGGAGCAGGAAGG + Intergenic
973973610 4:56240312-56240334 CAGACTGGGGAGGGGGAGTAGGG + Intronic
974204687 4:58686081-58686103 CAAGATGTGGAGGTGGAAGATGG + Intergenic
974389624 4:61249429-61249451 CAGGAGGAGGAGGAGGAGGAGGG - Intronic
974760535 4:66267833-66267855 CAAAAAGAAGAGGAGGAGAATGG + Intergenic
975116796 4:70688879-70688901 CAGAGTGGAGACGAGGAGGATGG + Exonic
975255276 4:72227630-72227652 AAAAATGGGCAGCAGGGGGATGG + Intergenic
975388524 4:73788134-73788156 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
975668311 4:76755121-76755143 CAGTGTGGGGAGGAGGTGGAGGG - Exonic
975949175 4:79747348-79747370 CAAAATGGAAAGGAGGTGGAAGG - Intergenic
975991948 4:80266835-80266857 GAAGAAGAGGAGGAGGAGGAAGG - Exonic
976096414 4:81513072-81513094 GGAAAGGGGGAGGGGGAGGAGGG - Intronic
976168748 4:82282411-82282433 AAAAAAATGGAGGAGGAGGAAGG + Intergenic
976172064 4:82314569-82314591 GAAGAGGAGGAGGAGGAGGAAGG + Intergenic
976231338 4:82846509-82846531 GAAAAGGTGGAGGAGGTGGAAGG - Intronic
976269774 4:83219155-83219177 GAAAAGGAGGAGGAGGAGGAGGG - Intergenic
976439682 4:85058863-85058885 TGAAATGGGGAGGAGAGGGAGGG + Intergenic
976566308 4:86554060-86554082 CAGAAAGGGGAGGAGAAGGCAGG + Intronic
976977880 4:91186297-91186319 CACACTGATGAGGAGGAGGAAGG - Intronic
977666977 4:99653632-99653654 GAAAAGGAGGAGGGGGAGGAGGG - Exonic
977731095 4:100352919-100352941 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
978514134 4:109553337-109553359 GATAATGAGGAGGAGGAGGAAGG - Intergenic
978830706 4:113080870-113080892 CAGAATGGAGAGGAAGAGGATGG + Intronic
978839965 4:113200471-113200493 AAAAGTGGGGAGGGGGAGAAGGG - Intronic
978875699 4:113637992-113638014 CATATTTGGGAGAAGGAGGATGG - Intronic
978935609 4:114371416-114371438 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
979000912 4:115217806-115217828 TAAAATGAGTAGGAGGAAGAAGG + Intergenic
979364900 4:119809848-119809870 GAGGAGGGGGAGGAGGAGGAGGG - Intergenic
979565702 4:122152363-122152385 CCCAAGGGGGCGGAGGAGGAGGG - Exonic
979695312 4:123606570-123606592 GATCATGGGGAGTAGGAGGAGGG + Intergenic
980086244 4:128393209-128393231 CTAAGTGGGGAGGGGGAGGGAGG + Intergenic
980129314 4:128803603-128803625 CCAGGTGAGGAGGAGGAGGATGG - Intergenic
980721736 4:136706303-136706325 CAAAGTGGGGAGGTAGAAGATGG - Intergenic
980792345 4:137635599-137635621 AAAAAGGAGGAAGAGGAGGAGGG + Intergenic
981197744 4:141940893-141940915 CATACTGATGAGGAGGAGGAAGG - Intergenic
981254402 4:142644303-142644325 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
981695892 4:147558411-147558433 GAAAAGCAGGAGGAGGAGGAGGG + Intergenic
981786303 4:148483101-148483123 CAGACTGGGGTGGGGGAGGATGG - Intergenic
982234980 4:153243790-153243812 AAAAAGGAGGGGGAGGAGGAAGG - Intronic
982257736 4:153466622-153466644 GGAAAGGGGCAGGAGGAGGAAGG + Intronic
982350773 4:154412982-154413004 GAAAAGGAAGAGGAGGAGGAAGG + Intronic
982745948 4:159103867-159103889 GAAGAGGAGGAGGAGGAGGAAGG + Intergenic
982795328 4:159637424-159637446 GAAAATGGGGACCAGCAGGAAGG - Intergenic
983173394 4:164560293-164560315 CAAAAGGGCGAGGAGGGAGAGGG - Intergenic
983742184 4:171149656-171149678 CATACTGGCAAGGAGGAGGAAGG - Intergenic
983907742 4:173202449-173202471 CGAAATGGGGAGGAGGAGGAGGG + Intronic
984046659 4:174808691-174808713 CAAGATGTGGAGGTGGAAGATGG + Intronic
984202434 4:176742081-176742103 CAAAATGGGGGGAAAGAGGGAGG - Intronic
984585622 4:181560897-181560919 CAACAAGGGAGGGAGGAGGAAGG + Intergenic
984879072 4:184394709-184394731 AATAATGGGGTGGGGGAGGATGG - Intronic
984952406 4:185017248-185017270 AAATATCGGGGGGAGGAGGAGGG - Intergenic
985011638 4:185588606-185588628 AACAAGGAGGAGGAGGAGGAGGG - Intronic
985085884 4:186312025-186312047 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
985267513 4:188163815-188163837 CAAAATGGAGAAAAAGAGGAAGG - Intergenic
985355606 4:189116131-189116153 GAAAATGGTGAGAAGGAGGCAGG + Intergenic
985485474 5:146145-146167 CAGAATGGGGGAGAGGAGGGAGG - Intronic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985673969 5:1220841-1220863 CAGAATGGGGGGTTGGAGGAGGG - Intronic
985917718 5:2936966-2936988 GAAAAGGAGGAGGAAGAGGAGGG - Intergenic
986067067 5:4245154-4245176 CAGAATGAGGAGGAAGAGAAAGG - Intergenic
986396093 5:7332252-7332274 CAAAATTGGCAGCAGCAGGATGG + Intergenic
986429193 5:7664979-7665001 CAAAGTGAGGAGGAGGGGGCGGG - Intronic
986467151 5:8037285-8037307 CACACTGATGAGGAGGAGGAGGG - Intergenic
986480413 5:8181028-8181050 CCACCTGGTGAGGAGGAGGAAGG - Intergenic
986889474 5:12284008-12284030 AAAAATGGAGAGTAGGTGGAGGG - Intergenic
987095454 5:14545614-14545636 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
987126531 5:14818293-14818315 CAAGAGGGAGAGGAGGAGAAGGG - Intronic
987165677 5:15195478-15195500 CAGAAGGTGAAGGAGGAGGAAGG + Intergenic
987174053 5:15289091-15289113 GGAAATGGGGTGGGGGAGGAGGG - Intergenic
987241957 5:16009041-16009063 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
987464397 5:18254379-18254401 TAAAATGGGGAAGAAGGGGAGGG + Intergenic
987574046 5:19703388-19703410 CACAATGATGATGAGGAGGAAGG + Intronic
987734630 5:21824722-21824744 CAAACTTGAGAGGAGTAGGAAGG + Intronic
987772196 5:22319834-22319856 GAAAAGGGGAAGGAAGAGGAGGG + Intronic
988246449 5:28688741-28688763 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
988461311 5:31440489-31440511 CAAAATGTGGAGGAATAGTAGGG - Intronic
989553577 5:42764384-42764406 AAAACAGAGGAGGAGGAGGAGGG + Intronic
989627785 5:43448224-43448246 CAAAATGTGGAGGAGAAGGCAGG - Intronic
990014230 5:51039447-51039469 GAAAGTGGGGAGGGGGTGGAAGG - Intergenic
990102807 5:52213909-52213931 CACAATGTGGAGGTGGAAGATGG + Intergenic
990494974 5:56338184-56338206 CAAGAGGAGGAGGACGAGGAGGG - Intergenic
990526482 5:56633167-56633189 AAAAAGGAGGAGCAGGAGGAGGG + Intergenic
990537659 5:56738789-56738811 CCAAAAGGGGAGAGGGAGGAAGG - Intergenic
990779012 5:59337107-59337129 CAAAAAGAGGAGAAGGATGAAGG + Intronic
990844949 5:60127050-60127072 AAAGATGGGAAGGATGAGGAGGG + Intronic
990991763 5:61691199-61691221 AAAAAGGAAGAGGAGGAGGAGGG + Intronic
991074458 5:62519329-62519351 GGAAATGAGGAGGAGGAGCAGGG - Intronic
991092379 5:62705603-62705625 CAAAAAGGTGAGGAAGAGGGTGG + Intergenic
991481965 5:67090392-67090414 AAAAGTGGGGAGGGGGAGAAGGG - Intronic
991632447 5:68669880-68669902 CATAAAGGGGAAGAGGAGAAAGG - Intergenic
992090644 5:73312955-73312977 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
992199326 5:74368328-74368350 GAAAAGGAGGAGGAGGAGGCAGG + Intergenic
992214909 5:74516431-74516453 AAAGAGGAGGAGGAGGAGGATGG - Intergenic
992216539 5:74529937-74529959 CAAAATGGGGTGGTGGTGGCAGG - Intergenic
992645580 5:78808229-78808251 TAATATGGGGAGGAGGGGGTGGG - Intronic
992686934 5:79208293-79208315 GAGAAGGTGGAGGAGGAGGAAGG + Intronic
992761260 5:79952626-79952648 CACACATGGGAGGAGGAGGATGG - Intergenic
992870012 5:80996521-80996543 GAGGAGGGGGAGGAGGAGGAGGG - Intronic
992870019 5:80996536-80996558 GAGGAGGGGGAGGAGGAGGAGGG - Intronic
992870026 5:80996551-80996573 GAGGAGGGGGAGGAGGAGGAGGG - Intronic
992870033 5:80996566-80996588 GAGGAGGGGGAGGAGGAGGAGGG - Intronic
992987537 5:82248449-82248471 GACATTGGGGAAGAGGAGGAGGG + Intronic
993012235 5:82496163-82496185 TAAAAAGGGGAAGAGGGGGAAGG + Intergenic
993234685 5:85289300-85289322 AAAAGTGGGGAAGAGGAGGAAGG + Intergenic
993347505 5:86802888-86802910 TAAACTGAGGAAGAGGAGGAAGG - Intergenic
993389908 5:87306853-87306875 AAAAAAGGGGAGGTGGCGGAGGG - Intronic
993418343 5:87665454-87665476 GAAAAGGATGAGGAGGAGGAGGG + Intergenic
993503292 5:88684994-88685016 GAAGAGGAGGAGGAGGAGGAGGG + Intergenic
993505374 5:88702535-88702557 CAAAAGGAGGAGGAGCAGGTTGG - Intergenic
993558473 5:89372615-89372637 GAAGAGGAGGAGGAGGAGGAAGG - Intergenic
993660195 5:90623706-90623728 AAAAATGGGGGGCAGGGGGAAGG - Intronic
994275819 5:97836147-97836169 AAAGAAGAGGAGGAGGAGGAAGG - Intergenic
994728218 5:103461614-103461636 GAAAGGGGGGAGGAGGAGGAGGG - Intergenic
995016788 5:107318875-107318897 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
995754016 5:115483071-115483093 CAAGATGTGGAAGAGGAAGATGG + Intergenic
995784041 5:115809403-115809425 CAACATAGGGTGGAGGAGAAGGG - Intronic
996111470 5:119571259-119571281 AAAGAAGGGAAGGAGGAGGAAGG - Intronic
996116461 5:119625430-119625452 CAGAAAGAAGAGGAGGAGGAGGG - Intronic
996651910 5:125888461-125888483 GAAGATGAGGAGGAGGAGAAGGG + Intergenic
996784595 5:127224688-127224710 CTGAATGGGTTGGAGGAGGAAGG + Intergenic
997093682 5:130886386-130886408 CAGAAAAGGGAGGGGGAGGAGGG - Intergenic
997297226 5:132776155-132776177 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
997619530 5:135276564-135276586 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
997718195 5:136057661-136057683 GAAAAGGAGGAGGAAGAGGAAGG + Intronic
997875658 5:137544572-137544594 CAACATGGAGTGGGGGAGGAAGG - Intronic
998211046 5:140198670-140198692 AAAAAAGAGGGGGAGGAGGAAGG - Intronic
998240614 5:140440375-140440397 CAAAAAGGGAAGGAGGATGGGGG - Intronic
998290301 5:140908283-140908305 CAAGCTGGGGAAGAGAAGGAAGG + Intronic
998611515 5:143694310-143694332 AAAAAGGAGGAGGAGGAGGGAGG - Intergenic
998712070 5:144837519-144837541 AGAAATGGTGAGGATGAGGATGG + Intergenic
998933953 5:147214598-147214620 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
999161044 5:149499300-149499322 AAAAAAGGGGAGGGGGAGGGGGG + Intronic
999215201 5:149927926-149927948 CAAAGTGTGGAGGTGGAAGATGG - Intronic
999257726 5:150219030-150219052 AAGAATGGGGAAGGGGAGGAAGG - Intronic
999409734 5:151340225-151340247 GAGGAAGGGGAGGAGGAGGAGGG + Intronic
999768490 5:154757235-154757257 CAAAACGCGGAGGAGGGAGAGGG - Intronic
1000485412 5:161836164-161836186 GAAGAAGGGGAGGAGGAGGAAGG + Intergenic
1000703099 5:164477492-164477514 GAAAAGGAGGAGGAAGAGGAGGG + Intergenic
1000922380 5:167153501-167153523 GAAGAGGGGGAGGAGGTGGAAGG + Intergenic
1001132917 5:169079578-169079600 AGAGAAGGGGAGGAGGAGGAGGG + Intronic
1001135236 5:169097359-169097381 ATAAATGGGGAGGAGGAAAAGGG + Intronic
1001260528 5:170224748-170224770 GAAAATGGGTAGGATGAGAAAGG - Intergenic
1001576553 5:172768510-172768532 CAAAATGGGGCAGAAGAGAAAGG - Exonic
1001737789 5:174021023-174021045 AAAAAGGAGGAGGAGGAGAAGGG + Intergenic
1001740066 5:174045784-174045806 CAATTTGAAGAGGAGGAGGACGG - Exonic
1001878862 5:175224862-175224884 GAAATTTGGGAGGTGGAGGAGGG + Intergenic
1002102370 5:176863816-176863838 GAGGAGGGGGAGGAGGAGGAGGG - Intronic
1002189103 5:177469669-177469691 AAAGCTAGGGAGGAGGAGGAAGG - Intronic
1002539432 5:179896311-179896333 CTAAATGGGGAGAAGGAAAAGGG + Intronic
1002681325 5:180967558-180967580 GAGAATGGGGAAGAGGAGGAGGG - Intergenic
1002744694 5:181461076-181461098 AGGAGTGGGGAGGAGGAGGAGGG + Intergenic
1002844888 6:937364-937386 GACAAGGAGGAGGAGGAGGATGG - Intergenic
1003121922 6:3325098-3325120 AAGAAGGGGAAGGAGGAGGAGGG + Intronic
1003273229 6:4625367-4625389 CAGACTTGGGAGGAGGAGAACGG + Intergenic
1003532201 6:6947074-6947096 GAAAAGGTGGAGGAGGTGGAAGG - Intergenic
1003679985 6:8243398-8243420 AGAAATGGGAAAGAGGAGGAGGG - Intergenic
1003722344 6:8718006-8718028 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1004119676 6:12808834-12808856 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1004241182 6:13924384-13924406 TAAAAGAGAGAGGAGGAGGAGGG + Intergenic
1004258389 6:14085817-14085839 CAAAATGTGCAAGAGGAGAAAGG - Intergenic
1004372761 6:15066784-15066806 ATAAATAGGGAGGAGGAAGAAGG + Intergenic
1004588889 6:17029864-17029886 CAGAATGGAAAGGTGGAGGAAGG + Intergenic
1004680690 6:17891509-17891531 CCAACTGGGGAGGCTGAGGAAGG + Intronic
1005277207 6:24231660-24231682 GAAAATGGTGAAGAGGGGGAGGG + Intronic
1005344442 6:24875569-24875591 TAAAATGGGGAGGAGGCCGGGGG + Intronic
1005434840 6:25797842-25797864 AAAAATAGGGAGGACGAGGCGGG - Intronic
1005500138 6:26422159-26422181 CAGGCTGAGGAGGAGGAGGAGGG - Intergenic
1005641132 6:27797517-27797539 CAAAATGTGGGGTAGGGGGAAGG - Intergenic
1006149523 6:31979204-31979226 GAGGAGGGGGAGGAGGAGGAAGG + Intronic
1006574131 6:35031530-35031552 CAAAATGGGGAGGAGGAGGAAGG - Intronic
1006680060 6:35790579-35790601 GAAGAAGGGGAGGAGGAGAAAGG + Intronic
1006806653 6:36793481-36793503 AAACATGGGGCGGAGGAGGCTGG - Intronic
1007185591 6:39968911-39968933 CCAAATAGAGAGGAGAAGGAAGG + Intergenic
1007400030 6:41598161-41598183 GAAAATGGGGAGGAGAAGGTGGG - Intronic
1007424398 6:41737257-41737279 CCAAATTGGGAGCAGGAGGGAGG - Intronic
1007531781 6:42549104-42549126 CATAAAGGGGAAGAGGAGGGAGG + Intergenic
1007563692 6:42831676-42831698 CTGAATGTGGAGGAGGAGAAAGG - Intronic
1007616111 6:43180607-43180629 CCAAAGGGGGAGGAGGGGGGTGG - Exonic
1007732730 6:43958672-43958694 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1007752956 6:44081175-44081197 CAAAATGGGGCAGGGGAGGGGGG + Intergenic
1008193458 6:48488570-48488592 CAAAATGGGAAGGTGGACAATGG + Intergenic
1008246135 6:49175926-49175948 GAGAAAGGGGAGTAGGAGGAAGG + Intergenic
1008541991 6:52553554-52553576 TAGAATGGGGAGGAGGAAGGAGG - Intronic
1008673971 6:53799850-53799872 CAAAATGGAGAGAAGAAGGAAGG - Intronic
1009043951 6:58215232-58215254 CATAGTGGGGGAGAGGAGGAGGG - Intergenic
1009358891 6:62789579-62789601 CTAAAGGTGGAGGAGGAGCAGGG + Intergenic
1009445194 6:63734117-63734139 CAAAATCGGGACGAGGCAGATGG + Intronic
1010056310 6:71569466-71569488 CAAAATAGGGAAGAGGGTGAGGG - Intergenic
1010232218 6:73545113-73545135 TAAGAGGAGGAGGAGGAGGAAGG - Intergenic
1010311404 6:74390030-74390052 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1010511540 6:76726750-76726772 GAAAAGGAGAAGGAGGAGGAAGG - Intergenic
1011049444 6:83128008-83128030 GAAAGTGGGGAAGGGGAGGAGGG + Intronic
1011164059 6:84426029-84426051 CCATATGGGGAAGAGGGGGAGGG + Intergenic
1011484715 6:87829849-87829871 GAAGAAGAGGAGGAGGAGGAAGG - Intergenic
1011484792 6:87830139-87830161 AAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1011553309 6:88549277-88549299 AAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1011737874 6:90330986-90331008 CTTGGTGGGGAGGAGGAGGATGG + Intergenic
1011800786 6:91013442-91013464 TAAAGGGGTGAGGAGGAGGATGG + Intergenic
1012054493 6:94388452-94388474 CAAGTTGGGGAGGCTGAGGAAGG + Intergenic
1012059146 6:94455432-94455454 AATAATGAAGAGGAGGAGGAAGG - Intergenic
1012267805 6:97167716-97167738 CAAAATGGGTAGGAGTTGGAGGG - Intronic
1012399125 6:98830460-98830482 TAAAAAGAGGAGGAGGAGTAGGG + Intergenic
1012637731 6:101566083-101566105 GAAAAGGAGGAGGAAGAGGAGGG + Intronic
1013314396 6:108927194-108927216 GGAAATGGGGAAGTGGAGGAAGG + Intronic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014069277 6:117162247-117162269 CAAAATGGGAAGGCGGTAGAAGG - Intergenic
1014528051 6:122524134-122524156 GAGGAGGGGGAGGAGGAGGAAGG - Intronic
1014561912 6:122901174-122901196 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1014591291 6:123274759-123274781 CATAATTGGGAGGATGAGGCAGG + Intronic
1014804868 6:125818095-125818117 GAAAGTAAGGAGGAGGAGGAAGG - Intronic
1014925512 6:127266424-127266446 AAAAATGGGGAGGGGGGGGACGG - Intergenic
1015190000 6:130461883-130461905 CACAATTGTGGGGAGGAGGAGGG - Intergenic
1015389929 6:132670127-132670149 GGAAAAGGAGAGGAGGAGGAGGG + Intergenic
1015536319 6:134270872-134270894 CTCAATGGGGAGGATGAGGAGGG - Intronic
1015850691 6:137568795-137568817 GAAAAGGAGGAGGAGAAGGAGGG + Intergenic
1016003555 6:139066911-139066933 GAAAATGGAGAGAAGGAGGAAGG - Intergenic
1016779598 6:147943471-147943493 GCAAAGGAGGAGGAGGAGGATGG - Intergenic
1017060383 6:150478905-150478927 CTAAAGGGGGATGGGGAGGATGG - Intergenic
1017260717 6:152383557-152383579 CAAGAAGGGGAAGAGTAGGAGGG - Intronic
1017398655 6:154033277-154033299 TAAAGTGTGGAGGAGGAGAAAGG + Intronic
1017512648 6:155128054-155128076 GAAAAGGGGGAGAAGGAGGGAGG - Intronic
1017587144 6:155939131-155939153 CAAAATGGGGAGGAAAATAATGG - Intergenic
1017737869 6:157380745-157380767 CCAGCTGGGGAGGAGGAAGAAGG + Intergenic
1017810727 6:157981791-157981813 GCGAGTGGGGAGGAGGAGGAAGG + Intergenic
1018038064 6:159898613-159898635 AAGAAGAGGGAGGAGGAGGAAGG - Intergenic
1018266251 6:162027831-162027853 GAAAGTGGAGAGGAGGAAGAAGG + Intronic
1018437595 6:163776875-163776897 GAGGATGAGGAGGAGGAGGAGGG + Intergenic
1018471674 6:164102715-164102737 CCACCTGGGGAGGAGGGGGAGGG - Intergenic
1018581130 6:165309245-165309267 GAAGAGGAGGAGGAGGAGGAGGG - Intronic
1018700165 6:166420046-166420068 CAAGCTGGGGACCAGGAGGAGGG + Intronic
1018732620 6:166663722-166663744 GAAGTTGGGGAGGAGGAGGAGGG + Intronic
1018936821 6:168279171-168279193 GAGAATGGGAAGGAGGAGAATGG + Intergenic
1018938921 6:168295075-168295097 CAAACAGCAGAGGAGGAGGAAGG - Intronic
1018996554 6:168714716-168714738 GATGGTGGGGAGGAGGAGGATGG + Intergenic
1018996661 6:168715413-168715435 GATGATGGCGAGGAGGAGGATGG + Intergenic
1018996730 6:168715904-168715926 GAGGATGAGGAGGAGGAGGATGG + Intergenic
1019162968 6:170081158-170081180 GAGGAGGGGGAGGAGGAGGAGGG + Intergenic
1019249605 6:170734617-170734639 AGGAGTGGGGAGGAGGAGGAGGG + Intergenic
1019320840 7:414566-414588 GAGTAGGGGGAGGAGGAGGAAGG - Intergenic
1019375503 7:689620-689642 AAAGATGGGGAGGATAAGGAGGG + Intronic
1019490908 7:1312814-1312836 TCAAATGGGGAGGTGGAGCAGGG + Intergenic
1019551837 7:1606927-1606949 CACGAAGAGGAGGAGGAGGAGGG - Intergenic
1019776108 7:2912983-2913005 GGTGATGGGGAGGAGGAGGAGGG + Intronic
1020080180 7:5282684-5282706 AGGAATGGGGAGGAGGAAGAAGG + Intronic
1020080205 7:5282756-5282778 AGGAATGGGGAGGAGGGGGAGGG + Intronic
1020125794 7:5531866-5531888 AAGGAGGGGGAGGAGGAGGAAGG - Intronic
1020461360 7:8433541-8433563 GTGAAGGGGGAGGAGGAGGACGG - Intergenic
1020577353 7:9949902-9949924 GAAGAGGGGGAGGAGGAGGAGGG + Intergenic
1020577401 7:9950017-9950039 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1020753930 7:12176949-12176971 CATCATTGAGAGGAGGAGGATGG + Intergenic
1020823033 7:12994253-12994275 CATAATGGGGAGGAGAAAGAAGG - Intergenic
1021279105 7:18694903-18694925 GAAAATGAGGAGTAGGAGGGAGG - Intronic
1021435918 7:20615362-20615384 AAAAATGTGGAGGAGGAACAAGG - Exonic
1021562379 7:21981394-21981416 GAAAATGGGGAGGGAGAGGCTGG - Intergenic
1021612618 7:22472921-22472943 TAAAATGGAGAGGATGATGATGG + Intronic
1021664927 7:22967696-22967718 CATAATGGTGGGTAGGAGGAAGG + Intronic
1021717193 7:23470759-23470781 GAGAAGGGGGAGGAGGAAGAAGG + Intergenic
1021785865 7:24152079-24152101 CAGACTGGGGAGAAGGAGAAGGG - Intergenic
1021960526 7:25868297-25868319 CAAACTGAGGAGGAGGAAGTGGG - Intergenic
1022037810 7:26550571-26550593 AAAAATGAGGAGGAAGAGGGAGG + Intergenic
1022097152 7:27148136-27148158 CAAAAAGGGGAGGAGGAAGGAGG - Intronic
1022102386 7:27176110-27176132 CAGGGTGCGGAGGAGGAGGATGG + Intronic
1022141992 7:27500676-27500698 CAAACCAGGGAGAAGGAGGAGGG + Intergenic
1022401924 7:30046826-30046848 AAAAAAAGGGAGGAGGAGCAGGG - Intronic
1022440132 7:30426361-30426383 GAACATGGGGATGAGAAGGAAGG - Intronic
1022470162 7:30677092-30677114 CAAGATGAGGTGCAGGAGGAGGG + Intronic
1022797553 7:33744210-33744232 CAACATGAGGAGGTGGATGATGG + Intergenic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1023553958 7:41400437-41400459 CAAAATTGGGAGGCTGAGGCCGG - Intergenic
1023736056 7:43237053-43237075 AAAACTAGGGAGGAGAAGGAGGG + Intronic
1023806170 7:43874601-43874623 CAAAAAGGGTGGGAGGAGGCTGG + Intronic
1023820979 7:43980401-43980423 CCAAATGGGGCTGAGGAGCAAGG + Intergenic
1023850220 7:44146158-44146180 CGAGACGGGGAGGAGGGGGAGGG - Intronic
1023910656 7:44553329-44553351 GAGGAGGGGGAGGAGGAGGAAGG + Intergenic
1023996408 7:45161621-45161643 GAAACAGGGGAGGGGGAGGAGGG + Intronic
1024023310 7:45390394-45390416 GAAGATGGGAAGGAGGTGGAGGG + Intergenic
1024109788 7:46133636-46133658 GAGGAGGGGGAGGAGGAGGAGGG - Intergenic
1024195568 7:47055368-47055390 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1024527009 7:50357412-50357434 CAAAATGAGAAGCAGGAAGAGGG - Intronic
1024542273 7:50486603-50486625 CAACATGTGAATGAGGAGGAAGG - Intronic
1024939566 7:54747635-54747657 TAAAATGGGGAAGATGAGAAGGG - Intergenic
1025198800 7:56949724-56949746 AGAAATGGGGAGGAGTGGGAGGG - Intergenic
1025307294 7:57873035-57873057 AAAAAGGAGGAGGAGGGGGAGGG + Intergenic
1025488528 7:61081695-61081717 CAAAATGGGGAAGATGAGTGGGG + Intergenic
1025551577 7:62256197-62256219 CAAAATGGGGAAGATGAGTGGGG + Intergenic
1025673146 7:63627209-63627231 AGAAATGGGGAGGAGTGGGAGGG + Intergenic
1026191879 7:68136335-68136357 GAAGAAGAGGAGGAGGAGGAAGG + Intergenic
1026308781 7:69166169-69166191 GAGAAGGGGGAGGGGGAGGAGGG + Intergenic
1026638631 7:72105766-72105788 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1026678344 7:72446914-72446936 GAAATTGGAGAGGAGGAAGAGGG + Intronic
1026840813 7:73669038-73669060 GAAAATGGGGCAGAGGAGGGAGG + Intronic
1026905066 7:74058102-74058124 AAGAATGAGAAGGAGGAGGAGGG - Intronic
1027001496 7:74657694-74657716 AAAAAGGAGGAGGAGGAGGAGGG + Intronic
1027253504 7:76414682-76414704 AAAAAAAAGGAGGAGGAGGAGGG - Intronic
1027328319 7:77065173-77065195 CCAAATGGGGCTGAGGAGCAAGG - Intergenic
1027464928 7:78503578-78503600 GAGGAGGGGGAGGAGGAGGAGGG - Intronic
1027753824 7:82185512-82185534 GAGGAGGGGGAGGAGGAGGAGGG + Intronic
1027900667 7:84110265-84110287 AAAACTAGGGAGCAGGAGGAAGG - Intronic
1028042578 7:86073504-86073526 GAAGAAGAGGAGGAGGAGGAGGG - Intergenic
1028070824 7:86448032-86448054 AAAAAAAAGGAGGAGGAGGAGGG + Intergenic
1028908281 7:96178776-96178798 GACAAATGGGAGGAGGAGGAGGG - Intronic
1028964432 7:96786456-96786478 GAAAAGGAGGTGGAGGAGGAGGG - Intergenic
1029161856 7:98558212-98558234 AAAAAAGGGAGGGAGGAGGAGGG - Intergenic
1029230531 7:99064300-99064322 CAAAAAGACGAGGAGGAGGAGGG - Intronic
1029459443 7:100686711-100686733 GAACAGGAGGAGGAGGAGGAGGG - Exonic
1029534125 7:101145888-101145910 AAAAAGGAGGAGGAGGAGAAGGG + Intergenic
1029584404 7:101461288-101461310 AAGAAGGAGGAGGAGGAGGAGGG - Intronic
1029749252 7:102533841-102533863 CCAAATGGGGCTGAGGAGAAGGG + Intergenic
1029767195 7:102632945-102632967 CCAAATGGGGCTGAGGAGAAGGG + Intronic
1029857486 7:103532292-103532314 GAAAGTGGGGAGTGGGAGGAGGG + Intronic
1029983689 7:104902419-104902441 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
1029987302 7:104934154-104934176 TGAACTGGGGAGGAGGAGGGAGG - Intergenic
1030067944 7:105674758-105674780 CAAATAGAAGAGGAGGAGGAAGG - Intronic
1030921285 7:115391772-115391794 AAAAATTGGGAGAAGGAGGCGGG - Intergenic
1030981928 7:116196363-116196385 CAAGATGTGGAGAAGGAAGATGG - Intergenic
1031100926 7:117479483-117479505 GAAAAGGAGGAGGAGGAGGAAGG + Intronic
1031222183 7:118982186-118982208 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1031762917 7:125737116-125737138 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1031854624 7:126907280-126907302 AAGAAAGGGGAGGAGGAAGAGGG + Intronic
1031952283 7:127904685-127904707 CACAATGGGAAGGGGTAGGAGGG - Intronic
1031970405 7:128060999-128061021 CAGAATTGGGAGGTGGAGCAGGG + Intronic
1032464353 7:132134536-132134558 GAAAATGGGGAGGCAGAGGGAGG + Intronic
1032523694 7:132563744-132563766 GAAAAGGAGGAGAAGGAGGAGGG - Intronic
1032746313 7:134790133-134790155 GAAAAGGGGGAAGAGGAGGGAGG + Intronic
1032801056 7:135317588-135317610 AAAGATGGGGAGCAGGAAGAAGG - Intergenic
1032869959 7:135974540-135974562 CAAAAAAAAGAGGAGGAGGAGGG + Intronic
1032948703 7:136882387-136882409 GAAGAGGGGGAGGAGGAGAAAGG - Intronic
1033019664 7:137711022-137711044 GAAAAGGGGGAGGAGGAGGACGG - Intronic
1033334850 7:140443905-140443927 CTAAATAGGGAGGAGGAGGTGGG + Intergenic
1033399948 7:141013203-141013225 CAAGATAGCCAGGAGGAGGAAGG + Intronic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034271196 7:149804117-149804139 CAGAATTGGGAGGAGGAAGGGGG - Intergenic
1034691394 7:153017249-153017271 CCAGAGGGAGAGGAGGAGGAAGG + Intergenic
1034889430 7:154827303-154827325 GGAAAAGGGGAGGAGGAAGAGGG - Intronic
1034889768 7:154829512-154829534 GAAAATGGAGAGAGGGAGGAAGG + Intronic
1035161138 7:156950509-156950531 GAAAGTGAGGAGGAGGAGGAGGG + Exonic
1035239566 7:157520929-157520951 GAGACTGGGGAGGAGGAGGGTGG + Intergenic
1035265294 7:157686761-157686783 AGAAGTGAGGAGGAGGAGGAGGG + Intronic
1035390034 7:158497534-158497556 CCAAATTGGTAGCAGGAGGAGGG + Intronic
1035498491 8:73039-73061 AGGAGTGGGGAGGAGGAGGAGGG - Intronic
1035722044 8:1799288-1799310 AAGGAGGGGGAGGAGGAGGAGGG - Intergenic
1036227430 8:6971525-6971547 CACTATGAGAAGGAGGAGGAGGG - Intergenic
1036521684 8:9497769-9497791 CTAAAGAAGGAGGAGGAGGAAGG - Intergenic
1036557852 8:9875794-9875816 CAAAATGAGGAAGAGGTGGCTGG + Intergenic
1037297105 8:17413209-17413231 GAGATGGGGGAGGAGGAGGAGGG - Intronic
1037470176 8:19200858-19200880 GAAGAAGGGGAGGAGGAGGAAGG + Intergenic
1037568858 8:20141615-20141637 GAAGAGGGGGAGGAGGAGGAGGG + Intergenic
1037699315 8:21259602-21259624 GAAAAAGAGGAGGAGGAGAAGGG + Intergenic
1037710390 8:21350903-21350925 CACAGTGGGAAGGAGGAGGGAGG + Intergenic
1037716812 8:21407904-21407926 CAGAGTGGGGAGGAGGAAGGTGG - Intergenic
1037760426 8:21738194-21738216 GAGGAGGGGGAGGAGGAGGAGGG - Intronic
1037760433 8:21738209-21738231 GGAAGAGGGGAGGAGGAGGAGGG - Intronic
1037773739 8:21818938-21818960 AAAGATGAGGAGGAGGAGGGTGG - Intergenic
1037778864 8:21854159-21854181 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1037871911 8:22506051-22506073 AAAAATGGAGGGTAGGAGGAGGG - Intronic
1038020587 8:23549281-23549303 CAAAAGTGAGAGGAGGAGGCAGG - Intronic
1038150951 8:24942121-24942143 GAAAGGAGGGAGGAGGAGGAGGG - Intergenic
1038284992 8:26198582-26198604 AAAAAGAAGGAGGAGGAGGAGGG - Intergenic
1038313415 8:26463163-26463185 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1038440385 8:27567363-27567385 GAAAAGAGGGAGGAGGAGAAGGG - Intergenic
1038481034 8:27901942-27901964 GAAAATGGGGAGATGGAGGCTGG + Intronic
1038483642 8:27918788-27918810 GAGAAAGAGGAGGAGGAGGAGGG + Intronic
1038490422 8:27966548-27966570 CAATAAGGGTAAGAGGAGGAAGG + Intronic
1038609734 8:29049305-29049327 CGCAATGGGGAGGAGGAGGAGGG + Intronic
1038780350 8:30564612-30564634 CACAATGGGCAGGAGCAGGTTGG - Intronic
1038839875 8:31174723-31174745 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1038898296 8:31812580-31812602 TAAAAAAGGAAGGAGGAGGAAGG - Intronic
1038900842 8:31841994-31842016 TAGAATGGGGAGGAGGAGGAGGG - Intronic
1039045330 8:33444362-33444384 CAGCATGGGGAGGAGGAACAAGG + Intronic
1039166098 8:34681665-34681687 GAATGTGGGGAGGAGGAGAAAGG + Intergenic
1039548679 8:38428255-38428277 CTGAAAGGGGAGGAAGAGGAGGG - Intronic
1039691292 8:39867639-39867661 AAGGAGGGGGAGGAGGAGGAAGG - Intergenic
1039792954 8:40890482-40890504 GGCAATGGGGAGGGGGAGGAGGG - Intronic
1040079828 8:43275084-43275106 GGAAAAGTGGAGGAGGAGGAGGG - Intergenic
1040454417 8:47581752-47581774 GAAAAAAGGGAGGAGAAGGAAGG + Intronic
1040455862 8:47596931-47596953 CAAGATGTGGAGGTGGAAGATGG - Intronic
1040546443 8:48401629-48401651 CAAAAGGGGTAGGAGGAAGGAGG + Intergenic
1041237956 8:55823775-55823797 AAACCTGGGGAGGAGGAGGAAGG + Intronic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1041328554 8:56697299-56697321 GAAAAGGAGGAGGAGAAGGAGGG - Intergenic
1041487185 8:58392185-58392207 GAAGATGGGGAGGAGTAGGAGGG - Intergenic
1041693831 8:60714947-60714969 CATAGTGGGGAGGGGCAGGAGGG + Intronic
1041714676 8:60922763-60922785 GAACAGGGAGAGGAGGAGGAAGG + Intergenic
1041968122 8:63704699-63704721 TAAAATGGGGAGGTAGAAGAGGG - Intergenic
1042010477 8:64239924-64239946 CAATATGGGGAGCAGGAGAAAGG - Intergenic
1042026875 8:64433335-64433357 CAAGATAGGGAGGCTGAGGAAGG + Intergenic
1043457166 8:80424176-80424198 CAAAATGGTCAGGAAGAGCAGGG + Intergenic
1043695519 8:83211002-83211024 CAAAATGGTCAAGAGGATGAGGG + Intergenic
1043765753 8:84130063-84130085 CAAAAGAGGCAGGAAGAGGAGGG - Intergenic
1044014202 8:87030933-87030955 GAAGAGGGGGAGGAGGGGGAAGG - Intronic
1044372327 8:91426684-91426706 CAGAAGAGGGAGGAGGAAGAGGG - Intergenic
1044435937 8:92164391-92164413 GAAAATGGGGAGTAGGTGAAAGG + Intergenic
1044798121 8:95924759-95924781 CTCCATGGGGAGGAGGAGAAGGG - Intergenic
1045130012 8:99140624-99140646 AAGGAGGGGGAGGAGGAGGAAGG - Intronic
1045130036 8:99140687-99140709 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
1045231391 8:100310128-100310150 AAGAAGTGGGAGGAGGAGGAGGG - Intronic
1045358607 8:101411788-101411810 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1045471609 8:102517723-102517745 CAATTTGGGGAGGAGCTGGAAGG - Intergenic
1046399937 8:113691896-113691918 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1046680576 8:117164956-117164978 CAGAATGGGGGAGAGGAGGCAGG - Intronic
1046711173 8:117513203-117513225 CAGAATGGTGAGGAGGAGGAGGG - Intergenic
1046809580 8:118517844-118517866 CAGAATGGGCTGGGGGAGGAGGG + Intronic
1047151680 8:122271262-122271284 GAAGAGGGGAAGGAGGAGGAAGG - Intergenic
1047308190 8:123670214-123670236 TCAAAGGAGGAGGAGGAGGAAGG - Intergenic
1047526415 8:125638086-125638108 AAAAAGGAGGAGGAGGAGGAGGG + Intergenic
1048007633 8:130432012-130432034 GAAAATGGGGAGGAGAAGGAGGG + Intronic
1048048075 8:130792011-130792033 AAAAATGGGGAGGAGGAAAATGG - Intronic
1048137091 8:131757041-131757063 CAAACTGTGGTGGTGGAGGAGGG - Intergenic
1048293435 8:133197559-133197581 CATAGAGAGGAGGAGGAGGAGGG - Intronic
1048343247 8:133556655-133556677 GAAAATGGGAAGGAAGAGAAGGG + Intronic
1048766127 8:137846353-137846375 GGAAAGGGGGAGGAGGAAGAGGG - Intergenic
1049036448 8:140079966-140079988 AAGAAGGAGGAGGAGGAGGAGGG + Intronic
1049122033 8:140747676-140747698 AAGGAAGGGGAGGAGGAGGAGGG + Intronic
1049195840 8:141315229-141315251 CAGGATGGGGAGGAGGGGCAGGG + Intergenic
1049217141 8:141413378-141413400 CTAAATGGGGCCCAGGAGGAAGG + Intronic
1049250973 8:141588826-141588848 CAAAATGGGAGGGAGGAGCTGGG + Intergenic
1049328471 8:142037351-142037373 GAGGAGGGGGAGGAGGAGGAAGG + Intergenic
1049533294 8:143167046-143167068 GAAAGTGGGGAGGGGAAGGAAGG + Intergenic
1049533718 8:143168474-143168496 GAAAGTGGGGAGGGGAAGGAAGG + Intergenic
1049936748 9:506762-506784 CCCAAGTGGGAGGAGGAGGATGG + Intronic
1050080527 9:1910956-1910978 CAAAAAGGGGGAGAGGGGGAGGG + Intergenic
1050191107 9:3027391-3027413 CAAAGTGAAGAGGAGGAGGCTGG + Intergenic
1050744238 9:8858093-8858115 GAAGAGGAGGAGGAGGAGGAGGG - Intronic
1051170386 9:14314705-14314727 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1051412723 9:16807536-16807558 GAAAATGAGAAGGAGGTGGAGGG + Intronic
1051414585 9:16825608-16825630 CTTCCTGGGGAGGAGGAGGAGGG + Intronic
1051428632 9:16960031-16960053 GAAAATGCGGAGAAGGAAGAAGG - Intergenic
1052205255 9:25831143-25831165 CAAGAGGTGGAGGAGGTGGAAGG + Intergenic
1052585408 9:30422509-30422531 AAAAGAGTGGAGGAGGAGGAGGG + Intergenic
1052613583 9:30809101-30809123 AAAAATGGTAATGAGGAGGAAGG + Intergenic
1052873579 9:33533242-33533264 TAACATGGGGAGGCAGAGGAGGG + Intronic
1052918221 9:33940086-33940108 AAAAAGGAGGAGGAGGAAGAAGG + Intronic
1053130158 9:35610051-35610073 TAGAATGGGGTGGGGGAGGAGGG - Exonic
1053263594 9:36693950-36693972 GAAAAGGAGGAGGAGGAGGAAGG - Intergenic
1053278661 9:36802130-36802152 GAAAGGGGGAAGGAGGAGGACGG + Intergenic
1053504052 9:38625587-38625609 GAAAAGGAGGAGGAGGAGAAGGG - Intergenic
1053698845 9:40666158-40666180 CAAAATGGGGAAGATGAGTGGGG + Intergenic
1053944849 9:43296390-43296412 CAAAATGGGGAAGATGAGTCGGG + Intergenic
1054310134 9:63465559-63465581 CAAAATGGGGAAGATGAGTGGGG + Intergenic
1054408922 9:64789711-64789733 CAAAATGGGGAAGATGAGTGGGG + Intergenic
1054442080 9:65273525-65273547 CAAAATGGGGAAGATGAGTGGGG + Intergenic
1054488202 9:65747972-65747994 CAAAATGGGGAAGATGAGTGGGG - Intergenic
1054715471 9:68553440-68553462 AAAAATGGGTAGAAGAAGGAAGG + Intergenic
1054764735 9:69034096-69034118 AAAAATAGGGTGGAGGAGGTGGG - Intergenic
1054991409 9:71331661-71331683 GAAGAGGAGGAGGAGGAGGAGGG + Intronic
1055212743 9:73817034-73817056 GAAAGTGGAGAGGAGGGGGAAGG + Intergenic
1055455206 9:76465649-76465671 CACCCTGGGGAGGAGGAGGGTGG + Intronic
1055699090 9:78921758-78921780 CAGAAGGCTGAGGAGGAGGAAGG + Intergenic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1055897712 9:81198529-81198551 AAAAAGGAGGAGAAGGAGGAAGG + Intergenic
1056119549 9:83473655-83473677 TAACATGGAGAGGAGGAAGAGGG + Intronic
1056240102 9:84636740-84636762 AAAGAAGAGGAGGAGGAGGAGGG - Intergenic
1056433654 9:86554111-86554133 GAAGAAGAGGAGGAGGAGGAGGG - Intergenic
1056767978 9:89456517-89456539 GAAGAAGGGGAGGAGAAGGAGGG + Intronic
1056820910 9:89841531-89841553 GAAAAGAGTGAGGAGGAGGAAGG - Intergenic
1056928499 9:90854801-90854823 CAAAATGGACAGGGGAAGGAAGG - Intronic
1057480369 9:95440563-95440585 AAAAACAGGGAGGGGGAGGAGGG + Intergenic
1057556950 9:96095546-96095568 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1057744776 9:97742076-97742098 GAAGATGAGGAGGAGGAGGAGGG + Intergenic
1057869202 9:98706122-98706144 AAAAAGAAGGAGGAGGAGGAGGG + Intronic
1057884779 9:98822070-98822092 CAAACTAGGCAGGAGGAGGAGGG - Intronic
1058100759 9:100915583-100915605 CAACATGGTGGGGAGGGGGAGGG + Intergenic
1058400935 9:104618333-104618355 GAAAATAGGGAAGAGGAGGAAGG + Intergenic
1058452466 9:105109989-105110011 GAAATCTGGGAGGAGGAGGAAGG + Intergenic
1058734022 9:107877633-107877655 CACAATGGGGACTAGAAGGAAGG + Intergenic
1058913285 9:109541023-109541045 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1058950443 9:109898747-109898769 CCAAATATGGGGGAGGAGGAAGG - Intronic
1059220693 9:112615123-112615145 AAAAATGAAGAGGAGGAGGCCGG + Intronic
1059353802 9:113684580-113684602 CAAACCGGGGGGAAGGAGGATGG + Intergenic
1059431215 9:114251436-114251458 CAGAAGGGGAAGGAGGAGGAGGG - Intronic
1059592777 9:115679956-115679978 AAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1059670437 9:116485898-116485920 CAAAAGGGTGAGGAAGAGGCAGG + Intronic
1059946953 9:119418944-119418966 GAAGCAGGGGAGGAGGAGGAAGG + Intergenic
1060163232 9:121386436-121386458 CAAGATGGGGAGGGGAAGGAGGG + Intergenic
1060501113 9:124156580-124156602 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1060504763 9:124189496-124189518 TAGGCTGGGGAGGAGGAGGAGGG + Intergenic
1060620122 9:125057666-125057688 CCGAGTGTGGAGGAGGAGGAGGG + Intronic
1060690746 9:125657276-125657298 GAGAAAGGGGAGGGGGAGGAAGG - Intronic
1061081536 9:128373712-128373734 CAACTTGGGAAGGAGGAAGAGGG - Intronic
1061202055 9:129143648-129143670 CCAAAGGGGGAGGGGGCGGAAGG - Intronic
1061257319 9:129460351-129460373 AAAGATGGAGAGGAGGAGGGAGG - Intergenic
1061541570 9:131280305-131280327 GAAAATGACGAGCAGGAGGAAGG - Intergenic
1061598900 9:131652620-131652642 CAAGATGGGGAGGTGGAAGATGG - Intronic
1061764812 9:132875050-132875072 AAGAAGGGGAAGGAGGAGGAGGG + Intronic
1061836909 9:133335610-133335632 CGGTGTGGGGAGGAGGAGGATGG - Intronic
1061910387 9:133719268-133719290 CAAAAGGGGAAGAAGGAAGAAGG + Intronic
1061989194 9:134149013-134149035 GTCACTGGGGAGGAGGAGGACGG + Intronic
1062084979 9:134643720-134643742 AAAAGTGGAGAGGAGAAGGAAGG + Intronic
1062183441 9:135203325-135203347 CTAATTTGGGAGGAGGAGGTGGG - Intergenic
1062226641 9:135456174-135456196 CGACGTGGGGAGGAGGAGAAGGG - Intergenic
1062430911 9:136526508-136526530 CAAGACGGGGAGGAGGGGCAGGG + Intronic
1062607144 9:137353430-137353452 CATAATGAGGAGGAGGGGAAGGG - Intronic
1062676969 9:137752367-137752389 GACACCGGGGAGGAGGAGGAAGG + Exonic
1062733574 9:138122130-138122152 AAAAGAGGGGAGGAGGGGGAGGG - Exonic
1202781211 9_KI270717v1_random:39365-39387 CAAAATGGGGAAGATGAGTGGGG + Intergenic
1203470645 Un_GL000220v1:114127-114149 GAGACGGGGGAGGAGGAGGACGG - Intergenic
1203478466 Un_GL000220v1:158099-158121 GAGACGGGGGAGGAGGAGGACGG - Intergenic
1203582211 Un_KI270746v1:19448-19470 AAAAAGGTGGAGGAGGGGGAGGG - Intergenic
1203587984 Un_KI270747v1:24968-24990 CAAAATGGGGAAGATGAGTCGGG + Intergenic
1203610505 Un_KI270748v1:91555-91577 AGGAGTGGGGAGGAGGAGGAGGG + Intergenic
1203615344 Un_KI270749v1:57741-57763 CAAAATGGGGAAGATGAGTGGGG - Intergenic
1185495701 X:553323-553345 TGAAATGGGGAGGTGGAGGGGGG + Intergenic
1185523727 X:761079-761101 AAAGAAGAGGAGGAGGAGGAGGG - Intergenic
1185603658 X:1355159-1355181 GAAAAGGAGGGGGAGGAGGAAGG + Intronic
1185603765 X:1355461-1355483 GAGGAGGGGGAGGAGGAGGAGGG + Intronic
1185608470 X:1380517-1380539 GAAGAGGGGGAGGAGGGGGAAGG + Intronic
1185661952 X:1735270-1735292 GAGGAGGGGGAGGAGGAGGAGGG - Intergenic
1185661959 X:1735285-1735307 GAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1185662142 X:1736001-1736023 GAGAAAGCGGAGGAGGAGGAGGG - Intergenic
1185688241 X:1948188-1948210 AGAAAAGGAGAGGAGGAGGAGGG + Intergenic
1185688530 X:2133727-2133749 AGAAAAGGAGAGGAGGAGGAGGG + Intergenic
1185793430 X:2945023-2945045 GAAGAGGGGGAGGAGGAGAAAGG + Intronic
1186033831 X:5398976-5398998 CAAGATGTGGAGGTGGAAGATGG + Intergenic
1186434777 X:9533352-9533374 AAAAGTGGGGAGGGGGAGGAAGG - Intronic
1186672517 X:11781663-11781685 GAAGAGAGGGAGGAGGAGGATGG + Intergenic
1186732788 X:12428155-12428177 AAAAATGGGGAGGCCGAGGTGGG - Intronic
1186827274 X:13352936-13352958 CAACACGGGGAGGCTGAGGAGGG + Intergenic
1187110294 X:16291810-16291832 CAACCTTGGGAGAAGGAGGAAGG - Intergenic
1187155037 X:16714027-16714049 CAAGAGGGTGAGGAGGTGGAGGG + Intergenic
1187335101 X:18374980-18375002 CAAAAGGGGTAGGAGTTGGATGG - Intergenic
1187623421 X:21084537-21084559 TAGAATGGGAAGGCGGAGGAAGG - Intergenic
1187679593 X:21753690-21753712 CAAAAAGGGAAGGAGGAAGCAGG - Intronic
1188000312 X:24974245-24974267 CAAGTTGGGGAGAAGCAGGAGGG + Intronic
1188026562 X:25216328-25216350 GAAAGGGGGGAGAAGGAGGAAGG - Intergenic
1188150390 X:26667306-26667328 AAAAAAGGAGAGGAGGAGGAAGG - Intergenic
1188236326 X:27736115-27736137 CAGAATGGGGTGGAGTATGAAGG - Intronic
1188433730 X:30136891-30136913 AAAAATGGGGGGGAGGGGGGAGG - Intergenic
1188461782 X:30435516-30435538 CATAAGAGGGAGCAGGAGGAGGG - Intergenic
1188505061 X:30873568-30873590 GAAAAAGGGGAGGAGGTGGAAGG - Intronic
1188801663 X:34539017-34539039 AAAAGGGGGGAGGAGGAAGAGGG + Intergenic
1189047000 X:37604046-37604068 CAAAGTGGGGAACAGCAGGAAGG - Intronic
1189132284 X:38512538-38512560 CAAGATGTGGAGGTGGAAGATGG - Intronic
1189197072 X:39161922-39161944 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1189197098 X:39162060-39162082 GAGAAAGGGGAGGAGGAGGAAGG - Intergenic
1189256321 X:39642504-39642526 CAGGATGAGGAGGAGGAGTAGGG + Intergenic
1189332977 X:40154413-40154435 ACAAAGGGGGAGGAGGGGGACGG - Intronic
1189725701 X:43966339-43966361 AAAGAGGAGGAGGAGGAGGAAGG + Intronic
1190050429 X:47145251-47145273 CAAAATGGCGACGACGAGAAGGG - Exonic
1190060962 X:47211410-47211432 GATAGTGGGAAGGAGGAGGAGGG - Intronic
1190360309 X:49643114-49643136 CATGATGGGAAGGAGGAGTAGGG + Intergenic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1190821985 X:53982061-53982083 CAAAGTAGGGAGGCGAAGGAGGG + Intronic
1191580832 X:62758996-62759018 CACACTGGTGAGGAGGAGGAAGG - Intergenic
1191595728 X:62942159-62942181 CAAAAGGGGAAGAAGGAGTAAGG - Intergenic
1191895421 X:65987438-65987460 AAAAATGAGGAGGGGGAGAAAGG + Intergenic
1191937761 X:66443178-66443200 AAAAATGAGAAGGGGGAGGAGGG - Intergenic
1191954782 X:66632437-66632459 CAGGAGGAGGAGGAGGAGGAGGG + Intronic
1192105990 X:68317460-68317482 GAAGAGGAGGAGGAGGAGGAAGG + Intronic
1192363695 X:70454602-70454624 GAAAAAGGGGAGGGGGCGGAGGG + Intronic
1192458685 X:71299166-71299188 CAAAATTGGGAGGCCGAGGCTGG - Intronic
1192629952 X:72769617-72769639 CACAATGAGGAGGATGGGGAAGG - Intergenic
1192651758 X:72951187-72951209 CACAATGAGGAGGATGGGGAAGG + Intergenic
1193248451 X:79259133-79259155 CACAAAGTGGAGGAGGAGGATGG + Intergenic
1193478940 X:82002920-82002942 GAAGAAGGGCAGGAGGAGGAAGG - Intergenic
1193601539 X:83512576-83512598 CAGAATGGAGAGGAAGAAGAAGG - Intergenic
1193952447 X:87817191-87817213 TAAACCTGGGAGGAGGAGGATGG - Intergenic
1194095458 X:89633114-89633136 GAAAATGGTGGGTAGGAGGAAGG - Intergenic
1194268621 X:91782578-91782600 CAAAATTGTGAGGTGGGGGAGGG + Intronic
1194531381 X:95053783-95053805 GAAAGTGGGGAGGAAGAGAATGG + Intergenic
1194600746 X:95918857-95918879 GATAATGGGGAGGAAGAAGATGG - Intergenic
1194995405 X:100586707-100586729 CAGTAAGGGGAGGAGGAGTAGGG - Intronic
1194997189 X:100603866-100603888 GAACAAGAGGAGGAGGAGGAAGG + Intergenic
1195496874 X:105546430-105546452 TAAAATGGAGAGAAGGAGGAAGG + Intronic
1195577558 X:106468177-106468199 GAATTTGAGGAGGAGGAGGAGGG - Intergenic
1195696234 X:107669615-107669637 AAAAAAAAGGAGGAGGAGGAGGG - Intergenic
1195766603 X:108302993-108303015 CAAATTGGGGGGGTGGAGGGGGG - Intronic
1196530204 X:116777820-116777842 GAAAATGGGGAGGCTGAGGCAGG + Intergenic
1196712355 X:118776046-118776068 AAAAATGGAGAGAAGTAGGAAGG + Intronic
1196731084 X:118942217-118942239 AAAAAAGGGAAGAAGGAGGAAGG + Intergenic
1196816903 X:119672251-119672273 CCAAGAGGGGAGGAGTAGGAAGG - Intronic
1196921157 X:120586542-120586564 AAAAATAGGAAGGAGGAGGCGGG + Intergenic
1196964172 X:121037762-121037784 GAAAAGGTGGAGGAGGTGGAAGG - Intergenic
1197308284 X:124871148-124871170 CAAACAGGGGAGGAGGAAGGGGG - Intronic
1197326485 X:125100764-125100786 CAAAATCAGGAGGAGAAGGAGGG - Intergenic
1197461110 X:126742498-126742520 CAAAATGCGCATGAGGAGGCTGG - Intergenic
1197665539 X:129219361-129219383 CCAAAGTGGGAGTAGGAGGAGGG + Intergenic
1197719973 X:129738593-129738615 AAAAAGGAGGAGGATGAGGAGGG + Intergenic
1197804151 X:130383348-130383370 CAAAATTGGGAGTAAGTGGAAGG + Intergenic
1197804200 X:130383716-130383738 CAGTAAGGGCAGGAGGAGGAGGG + Intergenic
1198139520 X:133788739-133788761 GAAGGGGGGGAGGAGGAGGAGGG - Intronic
1198150579 X:133904495-133904517 TGAAATGGAGAGGAGGAGGTAGG + Intronic
1198417878 X:136439242-136439264 TAAGTTGGGGAGGATGAGGAAGG + Intergenic
1198427989 X:136538897-136538919 TAAAATGGGCAGGAGGGGGTGGG + Intronic
1198576521 X:138016156-138016178 GAAGAGGAGGAGGAGGAGGATGG - Intergenic
1198721269 X:139623572-139623594 CAAAAGGGGGAAGAGGAGGAAGG + Intronic
1199083492 X:143604100-143604122 CAAAATGGTGAGGAGGAGCCTGG - Intergenic
1199109932 X:143919749-143919771 AAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1199271484 X:145888485-145888507 CAAAAGGGGGAAGAGTGGGAAGG - Intergenic
1199834223 X:151572992-151573014 CAAAAGGGGGTGCAGGAAGATGG + Intronic
1199991385 X:152989541-152989563 GAAGAGGGGGAGGAGGAAGAGGG - Exonic
1200005402 X:153081534-153081556 GAGGAGGGGGAGGAGGAGGAGGG - Intergenic
1200243760 X:154511810-154511832 CACAAAGGGGAGGAGCAGGGAGG + Intronic
1200585821 Y:5003493-5003515 CAAAATTGTGAGGTGGGGGAGGG + Intronic
1200699429 Y:6389602-6389624 AAAGAGGGGGATGAGGAGGAAGG + Intergenic
1201034682 Y:9775096-9775118 AAAGAGGGGGATGAGGAGGAAGG - Intergenic
1201144131 Y:11053517-11053539 AGAGATGGGGAGGAGTAGGAGGG - Intergenic
1201195075 Y:11485302-11485324 AAAAAGGAGGAGGAGGGGGAGGG + Intergenic
1201266277 Y:12210275-12210297 ACAGATGAGGAGGAGGAGGAGGG + Intergenic
1201300294 Y:12498890-12498912 GAAAAGGAGGAGGAGGAGGTGGG - Intergenic
1201396188 Y:13551888-13551910 CAAACTGGGAAAGAGAAGGATGG - Intergenic
1201637600 Y:16142713-16142735 GAATAAGAGGAGGAGGAGGAAGG - Intergenic
1201696006 Y:16827057-16827079 CAGAAATGGGAGGAAGAGGAAGG - Intergenic
1201928422 Y:19315221-19315243 GAAGAAGGGGAGGAAGAGGAAGG - Intergenic
1202274383 Y:23100275-23100297 GAAGAAGAGGAGGAGGAGGAGGG - Intergenic
1202291644 Y:23320396-23320418 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1202339693 Y:23850304-23850326 CAAAAGGGGGAAAAGGAGTATGG - Intergenic
1202427376 Y:24734026-24734048 GAAGAAGAGGAGGAGGAGGAGGG - Intergenic
1202443415 Y:24936068-24936090 GAAGAAGAGGAGGAGGAGGAGGG + Intergenic
1202531073 Y:25819778-25819800 CAAAAGGGGGAAAAGGAGTATGG + Intergenic