ID: 1006574342

View in Genome Browser
Species Human (GRCh38)
Location 6:35033313-35033335
Sequence GAACTAAGCAAATCCTCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006574340_1006574342 18 Left 1006574340 6:35033272-35033294 CCACAGGTCTCCAGAAGGACTTG 0: 1
1: 0
2: 2
3: 23
4: 190
Right 1006574342 6:35033313-35033335 GAACTAAGCAAATCCTCAGCTGG No data
1006574337_1006574342 28 Left 1006574337 6:35033262-35033284 CCATATGTTCCCACAGGTCTCCA 0: 1
1: 0
2: 1
3: 13
4: 204
Right 1006574342 6:35033313-35033335 GAACTAAGCAAATCCTCAGCTGG No data
1006574339_1006574342 19 Left 1006574339 6:35033271-35033293 CCCACAGGTCTCCAGAAGGACTT 0: 1
1: 0
2: 1
3: 13
4: 163
Right 1006574342 6:35033313-35033335 GAACTAAGCAAATCCTCAGCTGG No data
1006574341_1006574342 8 Left 1006574341 6:35033282-35033304 CCAGAAGGACTTGCTGCAGCAGA 0: 1
1: 0
2: 3
3: 22
4: 249
Right 1006574342 6:35033313-35033335 GAACTAAGCAAATCCTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006574342 Original CRISPR GAACTAAGCAAATCCTCAGC TGG Intronic
No off target data available for this crispr