ID: 1006575030

View in Genome Browser
Species Human (GRCh38)
Location 6:35038779-35038801
Sequence CAGAAAAAGGAAAAGTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1551
Summary {0: 1, 1: 0, 2: 12, 3: 165, 4: 1373}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006575030_1006575033 11 Left 1006575030 6:35038779-35038801 CCTGGCCACTTTTCCTTTTTCTG 0: 1
1: 0
2: 12
3: 165
4: 1373
Right 1006575033 6:35038813-35038835 TTCTTTCTTTTATAAAACAAAGG No data
1006575030_1006575034 12 Left 1006575030 6:35038779-35038801 CCTGGCCACTTTTCCTTTTTCTG 0: 1
1: 0
2: 12
3: 165
4: 1373
Right 1006575034 6:35038814-35038836 TCTTTCTTTTATAAAACAAAGGG 0: 1
1: 0
2: 14
3: 138
4: 1345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006575030 Original CRISPR CAGAAAAAGGAAAAGTGGCC AGG (reversed) Intronic
900343559 1:2200098-2200120 AAAGAAAAGGAAAATTGGCCAGG + Intronic
900683758 1:3933653-3933675 AAGAAAAAAAAAAAGAGGCCAGG + Intergenic
900913819 1:5620542-5620564 CAGAAAAGGCAACAGTGGCCTGG - Intergenic
901106573 1:6760913-6760935 AAGAAAAGGAAAAAGGGGCCGGG + Intergenic
901276896 1:7998852-7998874 AAGAAAAAGTAGAAGAGGCCAGG + Intergenic
901298203 1:8177257-8177279 AAAAAAAAAAAAAAGTGGCCAGG + Intergenic
901357252 1:8661682-8661704 AAGAAAAAGGACATCTGGCCTGG + Intronic
901583375 1:10264954-10264976 AAGAAAAAGAAAAAAAGGCCGGG - Intronic
901589923 1:10332808-10332830 CAAAAAAAAAAAAAGAGGCCAGG - Intronic
901745700 1:11371937-11371959 AAAAAAAAGAAAAAGTGGCCAGG - Intergenic
901842468 1:11962743-11962765 CTAAAAAAGGAAAAAAGGCCGGG + Intronic
902406391 1:16185992-16186014 AAGAAAAAGAAAAAGAGGCCAGG - Intergenic
902648043 1:17817677-17817699 AAGAAAAAAGAAAAGTGGTTGGG - Intronic
902831623 1:19017551-19017573 CATAAAAAGAAGAAGAGGCCGGG + Intergenic
903425075 1:23247365-23247387 AAGAAAAAAGAAAAATGGGCTGG + Intergenic
903515073 1:23904898-23904920 CAGGAAGAGGTAGAGTGGCCTGG - Intronic
903582601 1:24383206-24383228 AAGAAAAGTGAAAAGTGGACAGG - Intronic
903746774 1:25592361-25592383 GAAAAAAAAGAAAAATGGCCAGG - Intergenic
903782129 1:25827429-25827451 CAAAAAAAGGAAAACTGGCTGGG - Intronic
904235292 1:29112294-29112316 AAAAAAAAGAAAAAGAGGCCAGG - Intronic
904240748 1:29143458-29143480 AAAAAAAACAAAAAGTGGCCGGG - Intergenic
904537072 1:31206730-31206752 CAGAAAAATTAAAATAGGCCAGG - Intronic
904589178 1:31599629-31599651 TAAGAAATGGAAAAGTGGCCAGG + Intergenic
905130820 1:35755700-35755722 AAGACAAATGAAAAGTGGCTGGG - Intronic
905135031 1:35792502-35792524 AAGGAAAAGAAAAAGAGGCCAGG - Intergenic
905271469 1:36790383-36790405 TAGTAAAAGAAAAAATGGCCTGG + Intergenic
905374777 1:37512893-37512915 TAGAAAAAAGAAAAGTGGCCAGG + Intronic
905377097 1:37530002-37530024 AAGAAAAAAAAAAAGAGGCCAGG - Intergenic
905693987 1:39961640-39961662 CAGAAAAAAGGAAAAGGGCCAGG - Intronic
905702052 1:40024454-40024476 CAAAGAAAGCAGAAGTGGCCAGG - Intergenic
906114138 1:43344830-43344852 AATAAAATGGAAAAGGGGCCAGG + Intronic
906220921 1:44078729-44078751 AACAAGAAGGAAAAGCGGCCGGG - Intergenic
906235818 1:44208591-44208613 TAGAAAAAGAAAAATTAGCCAGG - Intergenic
906342555 1:44993475-44993497 AAGAAAAAAAAAAATTGGCCAGG - Intergenic
906366957 1:45218567-45218589 CAAAAACAGGAAAATTAGCCAGG - Intronic
906376597 1:45301526-45301548 AAAAAAAAGGAAAATTAGCCAGG + Intronic
906379486 1:45323360-45323382 CAGAAAAAGAAAAATTAGCCAGG - Intergenic
906491192 1:46270072-46270094 CAAAAAAAAAAAAATTGGCCGGG + Intronic
906803089 1:48754577-48754599 GAGAAAAAGGAAAAGGGGACTGG + Intronic
906985766 1:50681812-50681834 CAAAAAAAACAAAAGAGGCCGGG - Intronic
907074836 1:51568725-51568747 GAGAAAAAGAAAAATTAGCCAGG - Intergenic
907278577 1:53330177-53330199 AAAAGAAAGGAAAAGAGGCCGGG + Intergenic
907378796 1:54067551-54067573 CAGGAAAAGGAAAAGAGGAAAGG - Intronic
907432220 1:54419613-54419635 AAAAAAAAGAAAAAGAGGCCAGG + Intergenic
907436780 1:54454784-54454806 AAAAAAAAAAAAAAGTGGCCGGG - Intergenic
907493843 1:54828490-54828512 CCAAAAAAGAAAAATTGGCCAGG - Intronic
907544976 1:55252071-55252093 CAAAAAAAAAAAAATTGGCCAGG - Intergenic
907645286 1:56236290-56236312 CAGAAGAAGGAAAAGTCCACAGG + Intergenic
907653461 1:56318843-56318865 CAGAAAAAAGATAAATGTCCAGG - Intergenic
908203801 1:61824359-61824381 CAAAAAAAAAAAAAGTGGACCGG - Intronic
908305017 1:62804383-62804405 AAAAAAAAGGAAAAAAGGCCAGG - Intronic
908341167 1:63180902-63180924 CAGAAAAGGGGAAATAGGCCAGG - Intergenic
908447730 1:64216880-64216902 CTAAGAAAGGAAAAGGGGCCAGG - Intronic
908534409 1:65065699-65065721 CTGGAAAAGCAAAAGGGGCCAGG + Intergenic
908553461 1:65233165-65233187 CAAAAGAAGGGAAAGTGGCCAGG - Intergenic
908559054 1:65286540-65286562 AACAAAAAGGATAACTGGCCAGG - Intronic
908614730 1:65906848-65906870 CATCAAAAGGCAAAGTAGCCAGG - Intronic
908694318 1:66820906-66820928 AACAAGAAGGAAATGTGGCCAGG - Intronic
908721322 1:67129293-67129315 AAGAAAAAAAAAAAGTAGCCAGG + Intronic
909427818 1:75547524-75547546 CAGTCAAAGCAAAAGTGTCCTGG + Intronic
909442727 1:75716182-75716204 GAGAAAAGGGAACACTGGCCTGG + Intergenic
910150663 1:84139761-84139783 GAAAAAAAGGAAAAAGGGCCGGG + Intronic
910272353 1:85410342-85410364 GAGAAAAAGGAAATGAGGCCGGG + Intronic
910315852 1:85882864-85882886 CAGAACAAGGAAAATTGTCAGGG - Intronic
910327893 1:86030726-86030748 AAGAAAAAAGAAAATTAGCCTGG - Intronic
910687085 1:89928461-89928483 AAGAAAAAAGAAAAATGGGCTGG + Intronic
910707577 1:90146355-90146377 TAGAAAAGGAAAAAGAGGCCGGG + Intergenic
910800964 1:91145625-91145647 CATATAAAGAAAAATTGGCCGGG - Intergenic
910895517 1:92065289-92065311 CTGAAACAGGAAGAGTGGCGTGG - Intergenic
910924056 1:92380115-92380137 CAAAAAAACGAAAATTAGCCGGG + Intronic
910983914 1:92985975-92985997 AACAAAAAGAAAAAGAGGCCGGG - Intergenic
911010816 1:93279164-93279186 CAGAGAAAGGAAAAGAGGCGAGG + Intergenic
911078030 1:93898783-93898805 CAAAAAAATGAAAATTAGCCAGG - Intronic
911130611 1:94383742-94383764 CAGAAAGCAGAATAGTGGCCAGG + Intergenic
911209652 1:95125994-95126016 AAAAAAAAGGAAAAGAGGCCAGG + Intronic
911608200 1:99932287-99932309 AAAAAAAAAAAAAAGTGGCCAGG - Intergenic
911658532 1:100473681-100473703 CAGAAAAATCAATTGTGGCCAGG - Intronic
911991741 1:104706897-104706919 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
912009819 1:104946383-104946405 AAGAAAAAAGAAAAATGGGCTGG + Intergenic
912053769 1:105568609-105568631 CAGTCAAAGCAAAAGTGGACTGG - Intergenic
912187007 1:107289612-107289634 TAGAATAAGGAAAAGTGCCTGGG - Intronic
912519733 1:110237154-110237176 AAGAAAAAGAAAAATTAGCCAGG + Intronic
912582817 1:110735618-110735640 CAGAAAAGGGAAAGGTAGCTGGG - Intergenic
912766219 1:112414068-112414090 AAGAAAAAGAAAAAAAGGCCAGG + Intronic
912769731 1:112452637-112452659 CAAAAAAAAAAAAAGAGGCCAGG - Intronic
913225680 1:116696123-116696145 TAAAAAAAAGAAAATTGGCCAGG - Intronic
914084518 1:144440811-144440833 AAGAAAAAGAAAAATTAGCCGGG - Intronic
914262525 1:146011140-146011162 AAGAAAAAGAAAAAGGGGCTTGG - Intergenic
914692260 1:150041003-150041025 TAAAAAAAGGAAAAGAGGCCAGG - Intergenic
914767043 1:150647497-150647519 AAAAAAAAAAAAAAGTGGCCTGG + Exonic
914776889 1:150745363-150745385 ATGAAAAGGGAAAATTGGCCAGG + Intronic
914836209 1:151209025-151209047 CAAAAAAAAAAAAAGCGGCCAGG - Intronic
914838192 1:151225763-151225785 AAGAAAAAAGAAAAGAGGCCAGG - Intronic
914840128 1:151241504-151241526 AAGAAAAAGAAAAAGGGGGCAGG + Intronic
914949561 1:152100629-152100651 AAGAAGATGGAAAACTGGCCGGG - Intergenic
915154070 1:153859857-153859879 CAAAGAAAGGAAAAATTGCCTGG - Intronic
915394085 1:155568819-155568841 AAGAAAAAGAAAAAAAGGCCGGG - Intergenic
915401052 1:155622148-155622170 CAGAAAAAGAAAAAGGGGAGGGG - Intergenic
915456307 1:156043108-156043130 AAGTAAATGGAAAAGGGGCCAGG - Intronic
915742232 1:158127693-158127715 CAGAGGAAGGAAATGAGGCCTGG + Intergenic
915964096 1:160291505-160291527 CAGAAAAAGGAACACATGCCAGG + Intronic
916002107 1:160626911-160626933 CAAAGAAAGGAAGATTGGCCTGG - Intronic
916362614 1:163987957-163987979 CAGAAAAAAGAAAAGAGGGATGG + Intergenic
916577757 1:166082361-166082383 CAGAAAAAGAAAAGGAGTCCAGG - Intronic
916620380 1:166490237-166490259 CAGAAAAAGGAAAAGACGAGGGG - Intergenic
916824138 1:168428214-168428236 CAGAAAAAGGAAAAGTGGAGAGG + Intergenic
916853589 1:168727697-168727719 CAGAAAAAAAAAAATTAGCCCGG - Intronic
917365961 1:174232486-174232508 AAAAAAAAAAAAAAGTGGCCGGG + Intronic
917533768 1:175859765-175859787 AAAAAATAGGAAAAGTAGCCAGG - Intergenic
917621528 1:176801438-176801460 GAGAAAAGGGAAAACTGGCTGGG + Intronic
917976381 1:180241976-180241998 CAGAAAAAAAAAAAATCGCCAGG - Intronic
918000747 1:180492951-180492973 CAGAAATAAGAATACTGGCCAGG + Intronic
918047615 1:180951017-180951039 CAGAAATGGGCAAAGTGTCCCGG + Exonic
918240230 1:182614507-182614529 CAAAAAAAAAAAAAATGGCCGGG + Intergenic
918266811 1:182850302-182850324 CAAAAAAAAGAAAAATGGCGTGG + Intronic
918345033 1:183599847-183599869 CAAAAAAAGAAAAAGAGGGCAGG - Intergenic
918662462 1:187106426-187106448 AAGAGGAAGGAAAAGTGGACTGG - Intergenic
919087588 1:192938860-192938882 CAGAAAAAGGAAAATAAGCAGGG + Intergenic
919236713 1:194855154-194855176 AAGAAAAAGGAAAAAGGGCCCGG + Intergenic
919273524 1:195382796-195382818 CAAAAAAAGAAAAATTAGCCAGG + Intergenic
919474962 1:198021539-198021561 CAAAAAGAGGACAAGAGGCCGGG - Intergenic
919647853 1:200113883-200113905 TATAAAAAAGAAAAGAGGCCGGG + Intronic
919862472 1:201749738-201749760 AAGAAAAAGCAAAATTAGCCAGG + Intronic
920063464 1:203246472-203246494 CAGTAAAAAGATCAGTGGCCTGG + Intronic
920549322 1:206845446-206845468 AAGAGAAAGGAAAAGTAGACGGG - Intergenic
920558263 1:206920157-206920179 CATAAAAAGTGAAGGTGGCCAGG + Intronic
920798499 1:209163756-209163778 CAGAAACAGCAAAAGTGGTGGGG - Intergenic
920903792 1:210139245-210139267 AAGAAAAAAGAAAATTAGCCAGG - Intronic
920937861 1:210452472-210452494 CAGATGAAAGAAAACTGGCCAGG - Intronic
921026524 1:211288047-211288069 CAAAAAAAGAAAAATTAGCCAGG + Intronic
921095930 1:211887308-211887330 TAGAAAAGGGAGAACTGGCCAGG - Intergenic
921295046 1:213693533-213693555 CAGAAAAAGGAAGAGGGATCGGG + Intergenic
921328664 1:214013766-214013788 CAGATAAAGGAGAGGTGGCCTGG - Intronic
921603296 1:217130391-217130413 AAGAAAAAGAAAAATTAGCCAGG - Intronic
921637352 1:217512159-217512181 CAAAAAAAGAAAAATTAGCCAGG + Intronic
922047797 1:221963621-221963643 AAGAAAAAGAAAAGTTGGCCAGG + Intergenic
922071645 1:222200655-222200677 CAAAAACAGCAAAAGGGGCCAGG + Intergenic
922193563 1:223340472-223340494 AAGAGACAGGAAAAGTGTCCTGG + Intronic
922333406 1:224597837-224597859 CAGAAACAGGTAAAATGACCTGG + Intronic
922483383 1:225955086-225955108 AAGAAAAAGAAAAGGTGGCTTGG - Intergenic
922553549 1:226515688-226515710 TATAAAAAGGAAATGAGGCCAGG - Intergenic
922647876 1:227309067-227309089 CAGAAAAAAGAAAAAAGGCCAGG + Intronic
922713476 1:227851901-227851923 TACAAAAAAGAAAAGTAGCCAGG - Intergenic
922820952 1:228485234-228485256 AAAAAAAAGGAAACTTGGCCGGG - Intergenic
923210202 1:231797008-231797030 CAGAAAATGTAAGAGAGGCCAGG - Intronic
923334962 1:232960225-232960247 AAAAAAAAAAAAAAGTGGCCGGG + Intronic
923371084 1:233313571-233313593 CAGAAAAAGAGAAAGTGGGGAGG + Intergenic
923729565 1:236537308-236537330 TAGAAAAAGGAACTGCGGCCGGG - Intronic
923883673 1:238131376-238131398 CAGAAAAGAAAAAAGGGGCCAGG - Intergenic
923917368 1:238524161-238524183 GAGAAAGATGAAAAGAGGCCAGG + Intergenic
924572291 1:245247859-245247881 GAGCAAAAGAAAAAATGGCCAGG - Intronic
924617774 1:245628176-245628198 AAGAAAAAGGAAACTTGGCCGGG + Intronic
924644966 1:245869372-245869394 CAGGAAAAGGAAGACTTGCCCGG - Intronic
1062953998 10:1528352-1528374 CATAAATATGAAATGTGGCCAGG - Intronic
1063352884 10:5372848-5372870 AAGAAAAATAAAAACTGGCCAGG - Intronic
1063644631 10:7866709-7866731 TAGAAAAAGCCAAAGTTGCCAGG + Intronic
1063963786 10:11328858-11328880 CAGAAAACAGAAAAGGGGGCTGG - Intronic
1064545294 10:16444286-16444308 CAAAAAAAAGAAAAGAGGCCGGG - Intronic
1064677036 10:17770676-17770698 CAGAAAATTTAAATGTGGCCGGG - Intronic
1064680688 10:17808576-17808598 TAGAAAAAGAAAATCTGGCCAGG - Intergenic
1064704132 10:18053308-18053330 CAGAGAAAGGAAAATTGTCAAGG + Intergenic
1064716812 10:18184998-18185020 CAAAAAATGAAAAATTGGCCAGG - Intronic
1064724065 10:18259568-18259590 AAAAAAAAGTAAAAGTAGCCAGG + Intronic
1064893190 10:20203463-20203485 AAGAAAAAGAAAAATTAGCCAGG - Intronic
1065145911 10:22767903-22767925 GAGAAAAAAGAAGAGTGGTCTGG + Intergenic
1065147742 10:22788251-22788273 TAAAAAAAGAAAAAGTGGCTGGG - Intergenic
1065414125 10:25466076-25466098 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
1065483744 10:26217399-26217421 CAGATAAAGGAAATGAGGGCTGG + Intronic
1065627690 10:27648761-27648783 GGGAAAAAGGAAAAATGACCTGG - Intergenic
1065680138 10:28222200-28222222 AAAAAAAAAAAAAAGTGGCCAGG + Intronic
1065874921 10:29989213-29989235 CAAGAAAAGGAAAAATGGCCGGG - Intergenic
1066037256 10:31505235-31505257 CAAAAAAAGGAAAACTATCCAGG - Intronic
1066053446 10:31659059-31659081 CAGAAAAAGGACAGGCGGACTGG + Intergenic
1066292945 10:34030304-34030326 CAGCAAGGGGAAAAGAGGCCAGG - Intergenic
1066675154 10:37880013-37880035 AAAAAGAAGGTAAAGTGGCCGGG - Intergenic
1067932003 10:50571452-50571474 CAGGAAATGGAAAAGGTGCCAGG - Intronic
1068420742 10:56788994-56789016 CAGAAAAAAGAAAAGAGGCCAGG - Intergenic
1068893052 10:62168584-62168606 CAGAAAAAAAAAAAATAGCCTGG - Intergenic
1069087790 10:64161694-64161716 CTGAAGCAGGAAAAGTAGCCGGG - Intergenic
1069163207 10:65115745-65115767 CTTAAAAAAAAAAAGTGGCCGGG + Intergenic
1069180975 10:65357990-65358012 CTCAAAAAAAAAAAGTGGCCTGG - Intergenic
1069257300 10:66349025-66349047 CAGAAAACGGAAAAGTTGATGGG + Intronic
1069489729 10:68851011-68851033 CAAAAAAAGCAAGAGAGGCCAGG + Intronic
1070042601 10:72796276-72796298 CAAAAAAAGGAAAATTGGCCAGG + Intronic
1070102313 10:73399844-73399866 CAAAAAACTGAAATGTGGCCAGG + Intronic
1070457342 10:76630470-76630492 AAGAATGATGAAAAGTGGCCAGG - Intergenic
1070478986 10:76862567-76862589 CAGACAAAGCAAAAGTGGACTGG + Intergenic
1070610998 10:77932501-77932523 CTCAAAAAGGAGAAGTGGCTGGG + Intergenic
1070623583 10:78032808-78032830 CAAAAAAAAAAAAATTGGCCGGG - Intergenic
1070735297 10:78859806-78859828 CAGAAAAATCAGTAGTGGCCCGG + Intergenic
1070871598 10:79758726-79758748 GAGAAAAAGGAAAGGTGGTAAGG + Intergenic
1070991644 10:80738705-80738727 GAGAAAAAGGAAAAAGGGGCGGG - Intergenic
1071207887 10:83304030-83304052 AAAAAAAATGAAAATTGGCCAGG + Intergenic
1071310577 10:84339768-84339790 CAAAAAAAGAAATAGTGGCCAGG - Intronic
1071347118 10:84703343-84703365 CAGCAGAAGCAAAAGTAGCCTGG - Intergenic
1071499624 10:86194076-86194098 CAGAGAAAGGAGAAGTGTTCTGG - Intronic
1071638519 10:87280889-87280911 GAGAAAAAGGAAAGGTGGTAAGG + Intergenic
1071656723 10:87457063-87457085 GAGAAAAAGGAAAGGTGGTAAGG - Intergenic
1071674878 10:87646270-87646292 AAGACAAAGGAAAAGGGGCTTGG + Intergenic
1072131865 10:92501677-92501699 AAGAAAAAAGAAAAAAGGCCGGG + Intronic
1072167002 10:92823442-92823464 AAGATAAAGAAAAAGAGGCCGGG + Intergenic
1072180821 10:92978111-92978133 AAGAAAAAAGAAAAGTGGGCTGG + Intronic
1072328814 10:94325301-94325323 AAGAAAAAGGGAAAGAGGCTGGG + Intronic
1072333500 10:94376340-94376362 TATAATAAGGAAAAATGGCCTGG + Intergenic
1072455949 10:95575901-95575923 AAAAAAAAAAAAAAGTGGCCGGG + Intergenic
1072699651 10:97631636-97631658 CATAAAGAGGAAAAAGGGCCAGG + Intronic
1072922144 10:99585318-99585340 CTGAAAAAGGTTAAGGGGCCAGG - Intergenic
1072936642 10:99719487-99719509 CAAAAAAAGAAAAAAAGGCCAGG - Intronic
1073410288 10:103335969-103335991 AAAATAAAGGAAAAGAGGCCAGG + Intronic
1074069518 10:110052093-110052115 CAGAAAAAGCCAAACTGGGCTGG - Intronic
1074132191 10:110589978-110590000 CAGCAACAGGAAAGGTGGGCAGG + Exonic
1074411951 10:113236012-113236034 CAGAAATACAAAAAGTAGCCGGG + Intergenic
1074448634 10:113540923-113540945 AAGAAGAAGCAAAAGTTGCCAGG + Intergenic
1074456738 10:113602171-113602193 CAGAAAAGCAAAAAGGGGCCGGG - Intronic
1074692113 10:116015649-116015671 AAGAAAATGGGAAGGTGGCCAGG - Intergenic
1074847996 10:117415722-117415744 CTGAAAAAGAAAAAGTAGCCAGG + Intergenic
1075162226 10:120034380-120034402 CTACAAAAGGAAAAGAGGCCTGG + Intergenic
1075271795 10:121058817-121058839 AAAAAAAATGAAAAGGGGCCGGG - Intergenic
1075386753 10:122060707-122060729 AGGAAAAAGAAAAAGAGGCCAGG + Intronic
1075573894 10:123564548-123564570 AAAAATAAGAAAAAGTGGCCAGG + Intergenic
1075664576 10:124221409-124221431 CAGATAAAGGAAATGAGGCCGGG + Intergenic
1076013321 10:127007519-127007541 CAGACACAGGGAAAGTGACCCGG + Intronic
1076044822 10:127283282-127283304 CAGAAATGGGAAAGGAGGCCTGG + Intronic
1076094314 10:127718672-127718694 AAGAAAAAGAAAAATGGGCCGGG + Intergenic
1076245300 10:128942679-128942701 TACAAAAAGGAGAAGTGGCTAGG + Intergenic
1076366464 10:129924117-129924139 CAGAAAACAGAAAACAGGCCAGG + Intronic
1077116276 11:886162-886184 AAAAAAAAGGAAAAATGGCGGGG + Intronic
1077599591 11:3564941-3564963 CAAAAAATGGCAAAGTGGCTGGG - Intergenic
1077620254 11:3715426-3715448 TAGAAAAAAAAAAAATGGCCGGG - Intronic
1077885810 11:6386924-6386946 CAAAATATGGCAAAGTGGCCGGG + Intergenic
1078226198 11:9393676-9393698 AAGAAAAAGGAAATTAGGCCTGG - Intronic
1078634904 11:13040327-13040349 CTGAAAAAGGATAAGGGGCGGGG - Intergenic
1079006747 11:16796814-16796836 AAGAAAAAGAAAAACTAGCCAGG - Intronic
1079047664 11:17121276-17121298 CAAAAAAATTAAAAGTAGCCAGG - Intronic
1079164624 11:18028165-18028187 TAGAAAAAAGTAAAGAGGCCTGG + Intronic
1079208976 11:18443618-18443640 CAAAAATACAAAAAGTGGCCAGG - Intronic
1080697493 11:34615507-34615529 AAGAAAAAGTAGAAGAGGCCAGG - Intergenic
1081443855 11:43110390-43110412 AAGAAAAAGAAAAAGTGGGCAGG + Intergenic
1081769590 11:45640847-45640869 TAAAAGAAGGAACAGTGGCCGGG + Intergenic
1081785299 11:45742350-45742372 CAGAAAAAGGAAAAATACCAGGG + Intergenic
1081841591 11:46205821-46205843 CAAAAAAGGGAGAAGAGGCCAGG + Intergenic
1081868708 11:46373445-46373467 CAGAAAAACAAAAATTAGCCAGG - Intronic
1082084676 11:48040082-48040104 AAGAAAAGGCAAAAGCGGCCAGG - Intronic
1083182820 11:60998861-60998883 AAAAAAAAGGAAAACAGGCCAGG + Intronic
1083345319 11:61985702-61985724 CAAAAAAACAAAAAGTGGGCTGG - Intergenic
1083417912 11:62537253-62537275 CAAAAAAATAAAAAGAGGCCAGG - Intronic
1083441632 11:62680318-62680340 AAGAAAAAGAAAAATTAGCCGGG - Intergenic
1083472648 11:62894459-62894481 CAAAAAAAGAACAAGAGGCCGGG + Intergenic
1083580780 11:63823891-63823913 AAGAAAAAGAAAAACAGGCCAGG - Intronic
1083791772 11:64990313-64990335 AGGAAACAGGAAATGTGGCCGGG - Intronic
1083818523 11:65151870-65151892 AAGAAAAAGGGAAAGAGGCTGGG + Intergenic
1083870143 11:65482292-65482314 AAGAAAAAGAAAAAGCAGCCTGG + Intergenic
1083925679 11:65804556-65804578 AAGAAAAATAAAAGGTGGCCGGG + Intergenic
1083985127 11:66209398-66209420 AAAAAAAAGGAACAGTGGGCAGG + Intronic
1084015980 11:66381928-66381950 AAAAAAAAGAAAAAATGGCCGGG + Intergenic
1084326838 11:68405308-68405330 CAGAAAAAAAAAAATTAGCCCGG + Intronic
1084537622 11:69766876-69766898 AAGAAAAAAGAAAAGAGGCCGGG + Intergenic
1085228430 11:74943795-74943817 CAGAAAAAAGAAATGTAGCCTGG - Intronic
1085470035 11:76752123-76752145 CAGAGAAAGGAAAAATGGGATGG - Intergenic
1085571723 11:77564802-77564824 AAGAAAAAGAAAAATTAGCCAGG + Intronic
1085700910 11:78745523-78745545 CAGAAAGAGGGACAGTGGACGGG - Intronic
1085719061 11:78897291-78897313 CAGCAAAGGGAAAAGAAGCCTGG - Intronic
1085762278 11:79252393-79252415 CAAAAAAAGAAAAATTAGCCGGG - Intronic
1086390888 11:86361627-86361649 AAGAATAAGCAAAAGTGTCCAGG + Intergenic
1086520551 11:87663701-87663723 AAGAAATGGGAAAAGTGTCCAGG + Intergenic
1087039186 11:93782216-93782238 CATAAAGGGGCAAAGTGGCCAGG - Intronic
1087074053 11:94112106-94112128 CAGAAAAAGGAGAATGGGCATGG + Exonic
1087239617 11:95760289-95760311 CTGAAATTGGAATAGTGGCCTGG - Intergenic
1087814255 11:102641152-102641174 CAGGCAAAGGAAAAGTGGCACGG + Intergenic
1088152329 11:106759636-106759658 TATAAAAAGGAGAAATGGCCAGG + Intronic
1088260125 11:107935892-107935914 AAAAAAAAAAAAAAGTGGCCAGG - Intronic
1088266669 11:107994016-107994038 CAAAAAAAGGAAAAAAGGCCAGG - Intergenic
1088279826 11:108124571-108124593 TAGAAAAAGGGAAGGGGGCCAGG - Intronic
1088604647 11:111516411-111516433 CAGAAATAGCATAAGAGGCCAGG + Intronic
1089215378 11:116831658-116831680 CAGAAAAGGAAAATGGGGCCAGG - Intronic
1089307384 11:117535259-117535281 CAGAGAGAGGGAAAGTGGCATGG - Intronic
1089331443 11:117691732-117691754 CAGAAAAAGGAACAGGGGAGGGG + Intronic
1089552608 11:119292147-119292169 CTGAAAAAGAAAAGGAGGCCAGG - Intronic
1089673537 11:120073603-120073625 AAGAAAAAAGAAAAAAGGCCTGG - Intergenic
1089811182 11:121133025-121133047 TAAAAAATGGAAAACTGGCCGGG - Intronic
1089877403 11:121738220-121738242 AAGAAAAAGGAAGACTGGGCCGG - Intergenic
1089890083 11:121872134-121872156 CAGAAAAAGAAGAGGAGGCCGGG + Intergenic
1090159538 11:124478208-124478230 AAAAAATAGAAAAAGTGGCCAGG + Intergenic
1090520637 11:127475344-127475366 CAGAAAAAGGAAGAGGGGAGAGG - Intergenic
1090567899 11:128015689-128015711 CAGCAAAAGCAAAAATGTCCAGG - Intergenic
1090764837 11:129867475-129867497 CAGAAATAGAAAAATTAGCCGGG - Intronic
1091465206 12:678070-678092 AAGAAAAAGAAAAAGAGGGCCGG + Intergenic
1091469634 12:715500-715522 AAAAAAAAGGAAAAAAGGCCGGG - Intergenic
1091622160 12:2097439-2097461 CAAAAAAATTAAATGTGGCCAGG - Intronic
1091739902 12:2953625-2953647 CAAAAAAAAAAAATGTGGCCAGG - Intergenic
1091775208 12:3180328-3180350 CAGAAAAAATAAAATTAGCCAGG + Intronic
1091971191 12:4788440-4788462 CATAAAAACAAAAAGGGGCCTGG + Intronic
1092233754 12:6792777-6792799 CTGAAAAAGGAGAAGAGGCAAGG + Intronic
1092366868 12:7883559-7883581 AAGAAAAAGAAAAAGAGGCCGGG - Intronic
1092459707 12:8675421-8675443 CAGTAAAAAGAGAGGTGGCCGGG - Intergenic
1092610269 12:10165267-10165289 AAAAAAAAAGAAAATTGGCCGGG + Intronic
1092818571 12:12332236-12332258 AAGAAAAAGGAAAAGAGAGCAGG - Intronic
1093710390 12:22322912-22322934 AAGGAAAAAGAAAAGTGTCCTGG - Intronic
1093929371 12:24939167-24939189 CATAAAAAGCAAAGGTGGCTGGG - Intronic
1094018887 12:25893350-25893372 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1094129210 12:27056645-27056667 CAGTCAAAGCAAAAGTGGACTGG - Intronic
1094388662 12:29923734-29923756 CAGAAAATGCAATGGTGGCCAGG + Intergenic
1094542405 12:31373322-31373344 CAAAAAAAGGGCAAATGGCCGGG - Intergenic
1095451646 12:42337589-42337611 CAAAAAAAAGAAAAGAGGCCAGG - Intronic
1096053726 12:48633381-48633403 AAGTAAAACGTAAAGTGGCCAGG - Intergenic
1096079851 12:48826122-48826144 GAGAAAAGGGAAGAGGGGCCAGG - Intronic
1096107652 12:49006558-49006580 TAGAAAAAGGTAAACTAGCCAGG - Intronic
1096232946 12:49907008-49907030 CAAAAATAGGAAAAGTAGCCAGG - Intergenic
1096282390 12:50267513-50267535 AAAAAAAAGTAAATGTGGCCAGG - Intronic
1096366836 12:51035327-51035349 AACCAAAACGAAAAGTGGCCGGG - Intergenic
1096381486 12:51162148-51162170 AAGAAAAAGGAACAGAGGCTGGG + Intronic
1096724032 12:53546743-53546765 AAAAAAAAGAAAAAGAGGCCAGG - Intronic
1097002033 12:55884973-55884995 CAGAAAAAGAAAAAAAAGCCAGG - Intergenic
1097028877 12:56077755-56077777 CAAAAAAAGGAAAAAAAGCCAGG + Intergenic
1097117494 12:56708438-56708460 CAAAAAAAGGAGAAAAGGCCAGG - Intergenic
1097285560 12:57874386-57874408 CGGAAAAAGGAAAAGGAGCCTGG - Intergenic
1097296243 12:57965960-57965982 CAGAAAAAGGAAAAGAGGAGGGG + Intergenic
1097705873 12:62867736-62867758 CAGAAAAAAAAAAAATAGCCAGG - Intronic
1097791590 12:63821383-63821405 GAAAAAAAGAAAAACTGGCCGGG + Intergenic
1097879835 12:64676764-64676786 AAAAAAAAAAAAAAGTGGCCAGG - Intronic
1097882579 12:64699434-64699456 AAAAAAAAAGAAAAGGGGCCAGG + Intergenic
1097971153 12:65634373-65634395 CAGCAAAAGGAAAAGGTGCATGG - Intergenic
1098724132 12:73940768-73940790 CAAAAAAAGAAAAATTAGCCAGG - Intergenic
1098958785 12:76716184-76716206 CAGAAAAATGAAAAGAGGCTGGG + Intergenic
1098959977 12:76729619-76729641 AAGAAAAAGAAAAAATGGCTGGG + Intergenic
1098970418 12:76849147-76849169 CAAAAAAAAGAAAATTAGCCGGG + Intronic
1099020668 12:77400382-77400404 AATAAAAAGGAAAAATGGTCAGG - Intergenic
1099319911 12:81133200-81133222 TAGAAAAGAGAAAAATGGCCAGG + Intronic
1100056354 12:90515942-90515964 AAGAAAAAGAAAAAGTGGGTGGG - Intergenic
1100281135 12:93119533-93119555 CAGAAAAACTAATCGTGGCCAGG + Intergenic
1100738743 12:97567328-97567350 AAGAAAAAGGTAAAAAGGCCTGG - Intergenic
1100949876 12:99835268-99835290 CACAAAAAGAAAAATTAGCCAGG + Intronic
1100954751 12:99894346-99894368 AAGAAAAAAGAAAATTAGCCAGG + Intronic
1101099379 12:101376941-101376963 CAGAAATACAAAAATTGGCCGGG - Intronic
1101642536 12:106598184-106598206 TAGAAGAAGGAAAAGTTACCAGG - Intronic
1101851165 12:108403514-108403536 CAGAAGAAGGAAAAAAGGCCAGG - Intergenic
1102079633 12:110087369-110087391 AAGAAAAAGAAAAAATAGCCAGG + Intergenic
1102104255 12:110307052-110307074 AAGAAAAAGAAATTGTGGCCGGG - Intronic
1102307269 12:111814544-111814566 AAAAAAAAAAAAAAGTGGCCAGG + Intergenic
1102526632 12:113516585-113516607 AAAAAAAAAGAAAAGAGGCCGGG - Intergenic
1103118786 12:118362718-118362740 TAGAGAAAGGAAAACAGGCCAGG + Intronic
1103341568 12:120223871-120223893 GAGAAAAAGGAACAGGGGCCAGG + Intronic
1103509341 12:121463927-121463949 GAGAAAAAAAAAAACTGGCCAGG + Intronic
1103529643 12:121591950-121591972 AAGAAAAAGAAAAATAGGCCGGG + Intergenic
1103574697 12:121868814-121868836 AAGAAATAGGCAAAGGGGCCGGG - Intergenic
1103646354 12:122396337-122396359 GAGGAAAAGGCAAAATGGCCAGG + Intronic
1103658921 12:122497846-122497868 CAGAAAAAAAAAAAGTAGCTGGG + Intronic
1103667781 12:122583825-122583847 CAGAAAAAGAAAAACAGGCTGGG + Intronic
1103718308 12:122959504-122959526 TATGAAAAGGAAAAGAGGCCAGG - Intronic
1104314308 12:127682746-127682768 CAGAAAAAAAAAAAGTGTGCCGG - Intergenic
1104325531 12:127792768-127792790 AAGAAAAAGAAAAATTAGCCTGG + Intergenic
1104520132 12:129466478-129466500 TTTAAAAAGGAAAAGTTGCCAGG - Intronic
1105458510 13:20562975-20562997 CTTAAAAAGAAAAAGAGGCCAGG - Intergenic
1105528219 13:21195441-21195463 AAGAAAACGGAGAATTGGCCTGG - Intergenic
1105838490 13:24231995-24232017 CTGATAAAGGACAGGTGGCCAGG - Intronic
1105850237 13:24327967-24327989 CAGAAAAAAAAAAAATAGCCGGG + Intergenic
1105901090 13:24753859-24753881 TAGAAATATGAAAACTGGCCGGG + Intergenic
1106152856 13:27122796-27122818 TAAAAACAGGAAACGTGGCCAGG + Intronic
1106751303 13:32771610-32771632 CAGGAAGAGGAAAAGTTGCCTGG + Intronic
1106918364 13:34539487-34539509 GAGAAAAAGAAAAAAAGGCCAGG + Intergenic
1107511675 13:41091749-41091771 CAGAGAGAGGAAAAATGGCCGGG - Intergenic
1107616446 13:42172968-42172990 CAAAAAAAAGAAAAAAGGCCAGG - Intronic
1107849568 13:44557165-44557187 CAAAAAAAGAAAAAGTGGCCGGG + Intronic
1108060935 13:46532614-46532636 AAGAAAAAAGAAAATTAGCCGGG - Intergenic
1108134022 13:47335459-47335481 AAGAAATAGGAAAAGGGGGCCGG - Intergenic
1108211842 13:48147340-48147362 CAAAAATAGGAAAAGAGGCTGGG - Intergenic
1108328385 13:49358563-49358585 AAGAAAGAGGCAAAGAGGCCAGG + Intronic
1108377780 13:49829323-49829345 AAAAAAAAAAAAAAGTGGCCGGG + Intergenic
1108389052 13:49929786-49929808 CAAAAAAAAAAAAAGTGGCTGGG - Intronic
1108783665 13:53868323-53868345 AAAAAAAAAAAAAAGTGGCCGGG - Intergenic
1108800838 13:54092760-54092782 CAGTAATTGGAAAAGTGGCCAGG - Intergenic
1109024576 13:57142030-57142052 CAGAGAAAGGAAAAGTCACATGG - Intronic
1109025563 13:57148600-57148622 CAGAGAAAGGAAAAGTCACATGG - Intronic
1109026553 13:57155173-57155195 CAGAGAAAGGAAAAGTCACATGG - Intronic
1109027545 13:57161744-57161766 CAGAGAAAGGAAAAGTCACATGG - Intronic
1109028531 13:57168309-57168331 CAGAGAAAGGAAAAGTCACATGG - Intronic
1109322296 13:60825957-60825979 AACAAAAGGGAAAAGGGGCCAGG - Intergenic
1109349208 13:61155469-61155491 AAGAAAGATGAATAGTGGCCAGG - Intergenic
1109351515 13:61188444-61188466 TAGAAATAGGAAAAGTAGCCGGG + Intergenic
1109489141 13:63072234-63072256 CAGTCAAAGAAAAAGTGGACTGG - Intergenic
1109625541 13:64968874-64968896 CAGAAAAAAGAAAAAAGGCCAGG - Intergenic
1109654542 13:65372462-65372484 CAAAAATAGAAAAATTGGCCGGG + Intergenic
1109708434 13:66130435-66130457 TAAAAGAAGGAAAAGTGGCCGGG - Intergenic
1109827684 13:67743936-67743958 AAAAAAAAAAAAAAGTGGCCAGG - Intergenic
1109916255 13:68988371-68988393 CAAAAAAAGAAAAACTGTCCAGG + Intergenic
1109955914 13:69565760-69565782 CAGCAAAAGGAAAAGTCACATGG - Intergenic
1110079343 13:71291147-71291169 TAGAAAAAGGAAAAGAGGAGGGG - Intergenic
1110218016 13:73044647-73044669 AAGAAAAAGATAAACTGGCCAGG - Intergenic
1110299464 13:73908773-73908795 AAGAAAAATGAAAACCGGCCAGG - Intronic
1110511919 13:76361087-76361109 CAGGATAAGAAAAAATGGCCTGG + Intergenic
1110704196 13:78586536-78586558 CAGAGAAAGGCACCGTGGCCGGG - Intergenic
1111013871 13:82350243-82350265 CAGAAAATGGAAAAGTTGCATGG - Intergenic
1111065946 13:83091425-83091447 CAGAAAAAGGCAATGTGGGAAGG - Intergenic
1111067986 13:83122830-83122852 CTGAATAAAGAAAATTGGCCGGG + Intergenic
1111169600 13:84508254-84508276 CAGAGAAATGCAAATTGGCCAGG - Intergenic
1111387842 13:87551504-87551526 AAAAAAAAAGAATAGTGGCCAGG + Intergenic
1111738361 13:92171147-92171169 CAGCAAAAGGAAAAGAGGAAGGG - Intronic
1111859423 13:93682855-93682877 AAAAAAAGGGAAAAGTAGCCAGG + Intronic
1112019436 13:95358917-95358939 TACAAACAGGAACAGTGGCCTGG - Intergenic
1112641002 13:101275100-101275122 CAGAAACAGGAGGCGTGGCCGGG - Intronic
1112641076 13:101275723-101275745 CACAAAAAGGAAAAGAAACCAGG + Intronic
1112763838 13:102719715-102719737 CAGAAAATAAAAAATTGGCCAGG + Intergenic
1113156472 13:107328211-107328233 TAGGAAAAGGAAAAGTAGCCAGG - Intronic
1113267554 13:108635793-108635815 CAAAAACAGGAAAACTGGCTGGG - Intronic
1113428613 13:110230453-110230475 GAGAGAAAGGAAAAGTGGATGGG + Intronic
1113782728 13:112985985-112986007 CGGGAAGAGGAAGAGTGGCCGGG - Intronic
1114220812 14:20694593-20694615 CTGATAAGGAAAAAGTGGCCCGG - Intronic
1114261660 14:21041288-21041310 CAAAAAAGGCAAAAATGGCCAGG - Intronic
1114367878 14:22049578-22049600 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1114471792 14:22968179-22968201 TAAAAAGAGGAAAAGGGGCCGGG - Intronic
1114721633 14:24888925-24888947 CAAAAAGAGGAAAAGGGGCAGGG - Intronic
1114790877 14:25656957-25656979 CAGAATTAAGAAAAGTGCCCTGG + Intergenic
1115177540 14:30581409-30581431 CAGGAAAAGGAAAACTGGCCAGG + Intronic
1115226681 14:31110296-31110318 AAAAAAAAGAAAATGTGGCCGGG - Intronic
1115684144 14:35776912-35776934 AAAAAAAAGTCAAAGTGGCCTGG + Intronic
1115689789 14:35830651-35830673 ATAAAAAAAGAAAAGTGGCCGGG - Intronic
1115823104 14:37233911-37233933 CAGTCAAAGCAAAAGTGGACTGG - Intronic
1115839367 14:37450106-37450128 AAAAAAAAAGAAAGGTGGCCAGG - Intronic
1116201250 14:41799958-41799980 AAGAAAAAGGAAAAGGGACAGGG + Intronic
1116621373 14:47208245-47208267 CAGCAAAAGCAAAGGTAGCCAGG + Intronic
1116839462 14:49804867-49804889 CAAAAATAGAAAAAGTAGCCAGG + Intronic
1116851753 14:49915876-49915898 CAGAAAAAAGGAAAGTAGCATGG - Intergenic
1117363941 14:55006023-55006045 CAAAAAAATGAAAATTAGCCAGG - Intronic
1117386545 14:55219775-55219797 CAGACAAAGCAAAAGTGAACTGG + Intergenic
1117869935 14:60189756-60189778 CAGAAAAAGGAAGAAGGGACTGG - Intergenic
1117933837 14:60878698-60878720 CAGTCAAAGCAAAAGTGGACTGG - Intronic
1118195569 14:63622604-63622626 CAAAAAAACCAAAAGTAGCCAGG + Intronic
1118225520 14:63895402-63895424 TAGAAAATGGAAATTTGGCCAGG - Intronic
1118236098 14:64006665-64006687 CAAAAAAAGAAAAATTAGCCAGG + Intronic
1118338454 14:64875189-64875211 GAGAAAAATGAAAGGTGGTCTGG + Intronic
1118384816 14:65247061-65247083 CAGATAAAGAAAAACAGGCCAGG + Intergenic
1118503085 14:66381718-66381740 GTGAAAAGGGAAAAGTGGGCAGG - Intergenic
1118606741 14:67509612-67509634 CATAAAAAGGAGAATTGACCAGG - Intronic
1118772861 14:68953581-68953603 AAGAAAAGGGACAAGTGACCAGG + Intronic
1118789066 14:69072445-69072467 AAGAAAAAATAAAAGAGGCCAGG + Intronic
1119120247 14:72068789-72068811 GAGAGAAAGGAAGAGTGGGCCGG - Intronic
1119277497 14:73371934-73371956 AAGAAAGAGGAGAAGTGACCAGG + Intronic
1119731466 14:76953800-76953822 AAGAGAAAGTGAAAGTGGCCCGG - Intergenic
1119991121 14:79198870-79198892 TAGAAAAAGCAAAACTGGCCAGG + Intronic
1120556526 14:85934546-85934568 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
1120678494 14:87451043-87451065 CATAAAGTGGAAGAGTGGCCAGG - Intergenic
1120724845 14:87927126-87927148 AAGAAATAGAAAAATTGGCCAGG + Intronic
1120868745 14:89318452-89318474 GAGAGAAAGAAAAAGGGGCCGGG - Intronic
1120896704 14:89539134-89539156 TAAAAAAAAGAAAAGTGGCCAGG - Intronic
1120942570 14:89962887-89962909 AAGAAAAAAGAAAGGTGACCAGG + Intronic
1120984832 14:90325517-90325539 CAAAAAAAAGCAAAGAGGCCAGG - Intronic
1121201058 14:92118675-92118697 CTAAAAAAGGTAAAGGGGCCGGG + Intronic
1121732836 14:96198188-96198210 TAGAATTAGGAAGAGTGGCCAGG + Intergenic
1121843413 14:97153155-97153177 CAGTAAAAGAAAAATAGGCCTGG - Intergenic
1122682663 14:103477999-103478021 TAAAAAAAAAAAAAGTGGCCGGG + Intronic
1122702922 14:103602317-103602339 CAAAATAAATAAAAGTGGCCGGG + Intronic
1123675801 15:22709683-22709705 AAGAAAAAAGAAAATTAGCCAGG - Intergenic
1123819717 15:24016015-24016037 CAGACAAATTAAAAGTGGCATGG + Intergenic
1123821133 15:24031522-24031544 CAGAAAAAGGAAAAGGACTCAGG + Intergenic
1123829709 15:24122255-24122277 TAGAAAAAGGAAATGTCACCTGG + Intergenic
1123859773 15:24452847-24452869 TAGAAAAAGGAAATGTCACCTGG + Intergenic
1123899147 15:24858863-24858885 GAGAAAAAGGAAAAGGGGGTGGG - Intronic
1123950001 15:25262096-25262118 AAGAAAAAGAAAAAGAGGCCGGG + Intergenic
1124203043 15:27694763-27694785 GAGAAAAAGGAAAAGGGGCGGGG - Intergenic
1124389002 15:29236486-29236508 CATAAAAAAAAAAAGTAGCCAGG + Intronic
1125398881 15:39278997-39279019 CAAAAAAAAAAAAAGTAGCCGGG + Intergenic
1125640390 15:41225585-41225607 CAGAAAAAAAAAAAAAGGCCGGG + Intronic
1125868814 15:43078670-43078692 CAGAAATAGAAAAACTGGCCAGG + Intronic
1125954299 15:43778538-43778560 CAAAAAAAGAAAAAAAGGCCAGG + Intronic
1126016112 15:44352614-44352636 CAGAAAAGTGAAGAGTAGCCAGG + Intronic
1126554832 15:49974383-49974405 AAAAAAAAGGACAAGTGGCTGGG - Intronic
1126623767 15:50666506-50666528 AGGAAAAAGAAAAAGAGGCCGGG + Intronic
1127119783 15:55761367-55761389 CAAAAATAGAAAAAGAGGCCAGG - Intergenic
1127120156 15:55764964-55764986 AAGAAAAAGAAAAATTAGCCAGG + Intergenic
1127139742 15:55962737-55962759 CAAAAAAAGTAAAAGAGGCTGGG - Intronic
1127202888 15:56676398-56676420 CAGAAAAAGAAAAAGTTGAGTGG - Intronic
1127430706 15:58904689-58904711 CAGACAAAAAAAAATTGGCCGGG - Intronic
1127524531 15:59779272-59779294 CAGAGAAATGACAAGTGGCCTGG + Intergenic
1127826006 15:62703514-62703536 CAGATAAAGTAAGACTGGCCAGG - Intronic
1128012438 15:64310709-64310731 AAAAAAAAGGAAAAGAGGCCGGG + Intronic
1128154175 15:65382419-65382441 AAAAAAAAGGAAAAATGGACTGG + Exonic
1128504383 15:68256402-68256424 TAAAAAAGGGAAAAATGGCCGGG - Intronic
1128654293 15:69449038-69449060 AAAAAAAAAAAAAAGTGGCCGGG - Intergenic
1129139556 15:73584919-73584941 CAGACAGAGGGACAGTGGCCTGG - Intronic
1129285245 15:74519221-74519243 CAGACAAAGGAATATTGACCAGG + Intergenic
1129434543 15:75527886-75527908 AAACAAAAAGAAAAGTGGCCAGG + Intronic
1129588780 15:76896207-76896229 CAAAAATATGAAAATTGGCCAGG + Intronic
1129810523 15:78506628-78506650 AAGAAACACGAAAAGTGGCTTGG + Intergenic
1130065906 15:80604866-80604888 AAGAATAAAGAAATGTGGCCTGG + Intergenic
1130202102 15:81841714-81841736 CAGAAAAAAAAAAAGTGTCAGGG + Intergenic
1130236403 15:82138690-82138712 CAGGAAGAGGACAAGTGGCCTGG - Exonic
1130286770 15:82562207-82562229 CAGACAAAGGAAAAGTGCTGAGG - Intronic
1130334632 15:82948568-82948590 AAGAAAAAAGAAAAGGGGCTGGG + Intronic
1130512171 15:84599036-84599058 CACAAAAAGGAAAAGATGCAGGG - Intergenic
1130560270 15:84952588-84952610 AAGAAAACAGAAAAGTCGCCGGG + Intergenic
1131184181 15:90261372-90261394 AAAAAAAAAAAAAAGTGGCCGGG - Intronic
1131218002 15:90555811-90555833 CTAAAAAAGAAAAAGAGGCCAGG - Intronic
1131706338 15:95000135-95000157 CACAGAAAGGAAAAGACGCCAGG + Intergenic
1131722189 15:95181846-95181868 CACAAAAATGGAAACTGGCCTGG - Intergenic
1132042913 15:98540170-98540192 AAAAAAAAAAAAAAGTGGCCGGG - Intergenic
1132169124 15:99629651-99629673 GAGAAAAAGGGAAAAAGGCCGGG + Intronic
1132348506 15:101122778-101122800 CTCAAAAACCAAAAGTGGCCAGG + Intergenic
1132944584 16:2525973-2525995 CAGAAAAAGGAACACTGGGCTGG - Intronic
1133115709 16:3576963-3576985 TAGAAAAAAGAGATGTGGCCAGG - Intronic
1133186767 16:4105517-4105539 CAAAAAAAAAAAAATTGGCCGGG + Intronic
1133208029 16:4245797-4245819 AAGAAAAAGAAAAAATGGCCAGG - Intergenic
1133238425 16:4400657-4400679 CAAAAAAACAAAAAGTAGCCGGG + Intronic
1133256120 16:4517437-4517459 AAGAAAAGGGAGCAGTGGCCAGG + Intronic
1133722078 16:8504105-8504127 CAGTCAAAGTAAAAGTGGACTGG - Intergenic
1133725970 16:8537952-8537974 AAGAAAAAGGAAAGGTGTCATGG + Intergenic
1133728548 16:8559036-8559058 AAGAAAAATAAAAAGAGGCCGGG - Intergenic
1133901554 16:9980110-9980132 CAGAAAAAGAAAAATTAGCTGGG + Intronic
1133936725 16:10275411-10275433 CAAAAAAAGGAAACCAGGCCAGG + Intergenic
1133982797 16:10645971-10645993 AAAAAAAAGAAAAACTGGCCAGG + Intronic
1133988382 16:10685590-10685612 GAGAAAGAGGAAAAGAGGCTGGG - Intronic
1134120494 16:11580752-11580774 AAGAAAAAGGAATAGGGGCCTGG - Intronic
1134475533 16:14570352-14570374 AAGAAAAAGGAAAGAGGGCCGGG + Intronic
1135018790 16:18946468-18946490 CAGAAAAACAAAAGCTGGCCGGG + Intergenic
1135021420 16:18966247-18966269 AAAAAAAAGAAAAAGTGGCCAGG - Intergenic
1135064732 16:19299926-19299948 AAGAATAAGGAAAGGGGGCCAGG + Intronic
1135187801 16:20330134-20330156 AAGAAAAAGGAAAAGCTTCCTGG - Intergenic
1135416756 16:22274286-22274308 CAAAAAAAGAAAAGCTGGCCTGG + Intronic
1135470052 16:22722085-22722107 AAAAAGAAGGAAAAGTGGACTGG + Intergenic
1135580074 16:23618001-23618023 AAGAAAAAGAAAAATTAGCCAGG + Intronic
1135621431 16:23959275-23959297 AAGAAAAATGGAAAGTGGTCAGG - Intronic
1135656542 16:24255665-24255687 CAGCAAAAGGCAAACTTGCCTGG + Exonic
1135711385 16:24720391-24720413 CAAAAAAAGAAAAAGAGGTCAGG + Intergenic
1136261561 16:29080934-29080956 AAGAAAAAGAAAAATTAGCCAGG - Intergenic
1136413330 16:30089634-30089656 CTGAAAAATGAAAAAGGGCCAGG + Intronic
1136562993 16:31052102-31052124 AAGAAAAAGAAAAATTAGCCAGG - Intergenic
1136623443 16:31445743-31445765 AAGAAAAAAAAAAAGAGGCCAGG + Intergenic
1136669524 16:31843872-31843894 TGGATAAAGGAAAAGTGGGCTGG + Intergenic
1137505867 16:49053168-49053190 AAGAGAAAGAAAGAGTGGCCGGG - Intergenic
1137582935 16:49645127-49645149 CAGAAAAATGAAAATTGCCAAGG + Intronic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137615142 16:49841939-49841961 AAGAAGAAAGAAAAATGGCCAGG + Intronic
1137632344 16:49955726-49955748 TAAAAATAGGAAAACTGGCCGGG - Intergenic
1137833469 16:51567535-51567557 CAGAAAAAAAAAAAGTAGCCAGG - Intergenic
1138030791 16:53558042-53558064 AAAAAAAAAAAAAAGTGGCCTGG + Intergenic
1138238381 16:55405426-55405448 AGGAAAAAGGAAAAGTGGAAAGG + Intronic
1138673690 16:58635602-58635624 AAGAAAAAGAAAAATTAGCCAGG + Intergenic
1138773944 16:59697545-59697567 CAGTAAAATGAAAAGAGGCAAGG - Intergenic
1138958099 16:61995671-61995693 CATAAAAAGTAAAAGTAGGCCGG - Intronic
1139114371 16:63931665-63931687 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1139190819 16:64860960-64860982 AAGAAAAAGAAAAAAAGGCCCGG + Intergenic
1139543325 16:67635313-67635335 CAAAAAAACAAAAGGTGGCCAGG - Intronic
1139598588 16:67972319-67972341 CTGAAAAAGAAAAATTAGCCAGG + Intergenic
1139625291 16:68183706-68183728 CATAAAAAGGCAGTGTGGCCAGG + Intronic
1139686158 16:68605284-68605306 GAGAAGAAGGAAAACAGGCCAGG - Intergenic
1139743971 16:69059499-69059521 AAGAAAAAAGAAAAGTGGCCAGG - Intronic
1139795041 16:69476013-69476035 CAAAAAAAGAAAAAAAGGCCGGG - Intergenic
1139824713 16:69747860-69747882 AAGAAACAGGAATAGTGGCCAGG + Intronic
1139895389 16:70284305-70284327 CAAAAAAAACAAAAATGGCCGGG + Intronic
1139930819 16:70524677-70524699 CAAAAAAAGAAAAATTAGCCGGG - Intronic
1139947006 16:70648390-70648412 TAAAAAAAGGAAAATTAGCCAGG + Intronic
1140192467 16:72829635-72829657 CAGAAAAAGGATGAGTGGGAGGG - Intronic
1140244441 16:73235376-73235398 AAAATAAAGAAAAAGTGGCCGGG - Intergenic
1140378385 16:74463868-74463890 TAAAAAAAAAAAAAGTGGCCAGG - Intronic
1140518492 16:75562170-75562192 AAGAAAAAAAAAATGTGGCCAGG - Intergenic
1141193813 16:81844287-81844309 AAGAAAAATGAAAAGGTGCCCGG - Intronic
1141573605 16:84950095-84950117 GATAAAAAGAGAAAGTGGCCTGG + Intergenic
1141574710 16:84956398-84956420 CAGGAAGAGGAAAATTGGCCAGG + Intergenic
1141732430 16:85831838-85831860 AAAAAAAAAGAAAACTGGCCAGG + Intergenic
1141888061 16:86906641-86906663 CAGGAAAAGGAGAAGTCTCCTGG + Intergenic
1142301491 16:89261150-89261172 CAAAAAAAAGAAAAGTCGGCCGG + Intergenic
1142350741 16:89578357-89578379 AAAAAAGAGGAAAAGTGGGCTGG - Intronic
1142578805 17:927592-927614 AAAAAAAAGCAAAAGTAGCCAGG + Intronic
1142770303 17:2091975-2091997 AAAAAAAAGAAAAAGGGGCCAGG - Intronic
1142992968 17:3743996-3744018 AAAAAAAAAGAAAAGAGGCCGGG - Intronic
1143042306 17:4047645-4047667 AAAAAATAAGAAAAGTGGCCGGG + Intronic
1143191620 17:5044163-5044185 GAAAGAAAGGAAAGGTGGCCAGG - Intronic
1143373925 17:6456401-6456423 CAGAAAAATGACAAGAGGCATGG - Intronic
1143454481 17:7057463-7057485 AAAAAAATGTAAAAGTGGCCGGG - Intergenic
1143493622 17:7297944-7297966 AAAAAAAAAAAAAAGTGGCCAGG + Intergenic
1143525473 17:7469459-7469481 CTTAAAGAGGGAAAGTGGCCAGG - Intronic
1143617544 17:8062632-8062654 CACAGAAAGGAAAAATGGTCTGG + Intergenic
1143949199 17:10619407-10619429 CAAAAACAAAAAAAGTGGCCTGG - Intergenic
1144552373 17:16252365-16252387 TTAAAAAAGGAAAAGAGGCCGGG - Intronic
1144570804 17:16397525-16397547 CACAAAAAAGAAAATTAGCCGGG - Intergenic
1144747031 17:17622733-17622755 AAAAAAAAAAAAAAGTGGCCAGG - Intergenic
1144922489 17:18776021-18776043 GAAAAAAAAAAAAAGTGGCCGGG + Intronic
1145183375 17:20772705-20772727 CAGATAAAACAAATGTGGCCAGG - Intergenic
1145199834 17:20933489-20933511 TTCAAAAAGGAAATGTGGCCAGG - Intergenic
1145232319 17:21182542-21182564 TAAAAAAAAGAAAATTGGCCGGG - Intronic
1145235357 17:21204136-21204158 AAAAGAAAGAAAAAGTGGCCAGG + Intronic
1145721172 17:27074425-27074447 CAGACAAAGGGAAGGTAGCCTGG + Intergenic
1145824360 17:27865959-27865981 CAGAAAGAACAAAAGGGGCCAGG + Intronic
1145991721 17:29083062-29083084 CAGAGAAAGGAAAAGGGGCGGGG + Intronic
1146044568 17:29493197-29493219 AAGAAAAAGTAAGAATGGCCGGG + Intronic
1146362042 17:32185078-32185100 AAGAAAAAGAAAAACTAGCCAGG - Intronic
1146903004 17:36600448-36600470 CAGACAAAGGCCAAGTGCCCAGG - Exonic
1146997992 17:37337612-37337634 CAAAAAAACAAAAAGTAGCCAGG - Intronic
1147283176 17:39379485-39379507 CAAAAAAAAAAAAACTGGCCAGG + Intronic
1147404281 17:40199893-40199915 AAGAAAAAGAAAAAAAGGCCGGG + Intergenic
1147404827 17:40203746-40203768 CAAAAAAAAAAAAAATGGCCGGG + Intergenic
1147607145 17:41780396-41780418 CAAAAAAAGGAAAGAAGGCCGGG + Intronic
1147641707 17:42006312-42006334 CAAAAAAAAAAAAATTGGCCAGG - Intronic
1147724419 17:42557689-42557711 CAAAAAAATAAAAATTGGCCGGG + Intergenic
1147977101 17:44254269-44254291 AAGAAAAAAAAAACGTGGCCGGG - Intronic
1148003495 17:44405501-44405523 CAAAAAAAACAAAAGTGGCCGGG - Intronic
1148099084 17:45076452-45076474 AAAAAAAAAAAAAAGTGGCCAGG + Intronic
1148121929 17:45218244-45218266 AAAAAAAAGAAAAAGGGGCCAGG - Intergenic
1148146707 17:45370384-45370406 AAGAAAAAGAAAAATTAGCCGGG - Intergenic
1148255317 17:46126154-46126176 CTGAAAAAGTAAAAGTCGGCCGG + Intronic
1148272632 17:46275185-46275207 AAGAAAAAAGCAAAGTTGCCAGG - Intronic
1148371296 17:47101656-47101678 CAAACAAATGAAAATTGGCCAGG + Intergenic
1148493032 17:48035554-48035576 CAAAAAAACGAAAATTAGCCGGG - Intronic
1148611740 17:48969220-48969242 AAGAAAAAAGAAAGGGGGCCGGG + Intergenic
1148839049 17:50483046-50483068 AAGAAAAAGAAAAAAGGGCCTGG + Intronic
1149282945 17:55128774-55128796 CAAAAATAGTAAAAGTAGCCGGG - Intronic
1149471873 17:56923645-56923667 AAAAAAAAAAAAAAGTGGCCAGG - Intergenic
1149496795 17:57123580-57123602 TAAAACAAGGAAAACTGGCCAGG + Intergenic
1149632080 17:58134600-58134622 CAAAAAAAAAAAAAGTGACCTGG - Intergenic
1149645014 17:58234258-58234280 AAGAAAAAAGAAAAATGCCCAGG + Intronic
1149786988 17:59444056-59444078 AAAAAAAAAGAAAAGCGGCCAGG + Intergenic
1149916140 17:60611314-60611336 CATAAAAAGAAAACATGGCCAGG - Intronic
1149950245 17:60977338-60977360 AAGAAAAAAGAAAAATAGCCAGG - Intronic
1150012301 17:61515966-61515988 CAGTAAAAGAAAGAGGGGCCGGG - Intergenic
1150109860 17:62489359-62489381 CAAAAAAAGAAAAATTAGCCGGG - Intronic
1150399962 17:64848769-64848791 TAGAAAAAAAAAAATTGGCCAGG + Intergenic
1150463110 17:65369484-65369506 CAAAGAAAGGATAAATGGCCAGG - Intergenic
1150595900 17:66604244-66604266 CAAGAAAAAAAAAAGTGGCCTGG + Intronic
1150614769 17:66761717-66761739 AAAAAAAAAGAAAACTGGCCGGG - Intronic
1150695469 17:67401228-67401250 CAAAAGAAAGAAAACTGGCCAGG - Intronic
1150754705 17:67900846-67900868 CAAAAAAATTAAAATTGGCCAGG + Intronic
1150796445 17:68241882-68241904 AAGAAAAAAGAAAATTAGCCAGG - Intergenic
1150928629 17:69560574-69560596 AAGAAAAAAAAAAAGAGGCCGGG - Intergenic
1150947899 17:69766645-69766667 AAAAAAAAAAAAAAGTGGCCAGG - Intergenic
1151143771 17:72019894-72019916 CATTAAAAGTAACAGTGGCCAGG - Intergenic
1151170571 17:72242306-72242328 CAAAAAAAGAAAAAATAGCCAGG - Intergenic
1151751780 17:76043101-76043123 CAAAAAAATAAAAATTGGCCTGG + Intronic
1152120471 17:78415246-78415268 CAGAGAAAGAAAAAGTCCCCAGG - Intronic
1152435160 17:80271987-80272009 AAGAAAAAAGAAAAGAGGCCGGG + Intronic
1152435919 17:80275955-80275977 AAGAAAAAAAAAAACTGGCCAGG - Intronic
1152773690 17:82186941-82186963 CAAAAAAAGAAAAAGAGGCCGGG + Intronic
1153204398 18:2681422-2681444 AAAAAAAAGGAAAATTAGCCAGG + Intronic
1153299252 18:3578648-3578670 AAGAAAAAAAAAAAATGGCCGGG - Intronic
1153497545 18:5715418-5715440 CAGAAAAGGGAAGAGTTGGCAGG + Intergenic
1153698702 18:7669881-7669903 AAGAAAAAGAAAAATTAGCCGGG - Intronic
1153835766 18:8962663-8962685 CAAAAAAAGGCAGAGTGGGCTGG - Intergenic
1153842524 18:9019804-9019826 CAAAAAAAAGAAAATTAGCCAGG + Intergenic
1153890646 18:9511134-9511156 TAAAAAAATGAAAAGGGGCCTGG - Intronic
1154148030 18:11882390-11882412 GAGAAAAACAAAATGTGGCCAGG + Exonic
1154227909 18:12524979-12525001 AAGAAAAAAAAAAAGTGGCCAGG + Intronic
1154243283 18:12672111-12672133 CAGAAAAAAAAAAAAGGGCCAGG - Intronic
1154265823 18:12878039-12878061 AAGAAAAAAGAAAAATGGCCAGG + Intronic
1155006346 18:21733011-21733033 CAGTCAAAGCAAAAGTGGACCGG - Intronic
1155262113 18:24053284-24053306 CAGAAAAGGGAAAGGTGTCTTGG - Intronic
1155284309 18:24272228-24272250 AAGAAAAAAAAAAAGTTGCCAGG - Intronic
1155788606 18:29934142-29934164 CAGAAAAAGGAAAATAAGACAGG + Intergenic
1155931111 18:31709795-31709817 CAGAAATAAGAAGTGTGGCCAGG + Intergenic
1156255280 18:35389473-35389495 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1156417928 18:36917917-36917939 CAGAAACAGGAAAAATGGGAGGG - Intronic
1156504579 18:37581228-37581250 CAGAAAAGTGAAAACTGACCAGG - Intergenic
1156716671 18:40020727-40020749 CAGAAAAAAAAAAATTTGCCTGG - Intergenic
1156870721 18:41942093-41942115 TAGAAAAAGGAAATCTGTCCAGG + Intergenic
1157254626 18:46127409-46127431 ATGAAAATGGAAAAGAGGCCAGG + Intronic
1157749470 18:50165320-50165342 CAAAAATAGGAAAACTAGCCAGG + Intronic
1157898908 18:51494715-51494737 CAGAAAAAAAAAAATTAGCCAGG + Intergenic
1158136501 18:54213718-54213740 CAGATAAAGCAAGACTGGCCAGG + Intronic
1158342351 18:56480390-56480412 AAGAAAAAGAAAAAAGGGCCAGG + Intergenic
1158355618 18:56615455-56615477 CAGAAAAAGAAAAAATGGGGGGG + Intronic
1158456202 18:57610174-57610196 CATAAAAAAGACAACTGGCCGGG + Intronic
1158468131 18:57709973-57709995 AAAGAAAAGAAAAAGTGGCCAGG - Intronic
1159042851 18:63341880-63341902 AAGAATAAAGAAAAATGGCCAGG + Intronic
1159360065 18:67388572-67388594 AAGAAAAAAGAAAATTAGCCCGG - Intergenic
1159377717 18:67615297-67615319 AAAAAAAAGGAATAGTGGCCTGG - Intergenic
1160187235 18:76685373-76685395 TAGAAAAAGAAAAGCTGGCCGGG - Intergenic
1160212472 18:76893807-76893829 CATAAAAAAGAAAGGTGGGCCGG - Intronic
1160446899 18:78935009-78935031 GAGAAACAGGAAAACAGGCCGGG - Intergenic
1160527125 18:79544564-79544586 CAGGAAAAGGAAAAGCGGGGCGG - Intergenic
1160828714 19:1092718-1092740 TACAAAAAGAAAAAGTAGCCAGG + Intronic
1160886313 19:1350471-1350493 AAGAAAAAAGAAAAGTGGCTGGG - Intergenic
1161071378 19:2263341-2263363 CAAAAAAAAAAAAAGAGGCCGGG + Intronic
1161086519 19:2338062-2338084 CAGAAGATGGAAAAGGGGCCAGG - Intronic
1161229237 19:3164358-3164380 CAAAAAAAAAAAAAGTAGCCAGG - Intergenic
1161274130 19:3405896-3405918 AAGAAAAAGAAAAAGGGGCCGGG - Intronic
1161428116 19:4215775-4215797 CAAAAAAAAAAAAAGTGGCACGG + Intronic
1161476572 19:4489246-4489268 AAAAAAAAAGAAAGGTGGCCAGG - Intronic
1161502925 19:4627250-4627272 ACAAAAAAGAAAAAGTGGCCGGG + Intergenic
1161547450 19:4890401-4890423 GAGAAAAAGAAAAACTGGCCGGG - Intergenic
1161561700 19:4976795-4976817 GAGACAAAGGAAGTGTGGCCGGG - Intronic
1161738610 19:6006885-6006907 CAGAAAACCCAAAAGTGGCCGGG - Intronic
1161762046 19:6181061-6181083 AAGAAAAAGAAAAATTAGCCAGG + Intronic
1161776998 19:6269065-6269087 CAGAGAAAGGAAAGAGGGCCTGG + Intronic
1161844622 19:6705640-6705662 AAGGAAAAAGAAAATTGGCCGGG - Intronic
1161957598 19:7505277-7505299 AAGAATAAGGTAAAGTGGGCTGG - Intronic
1161970249 19:7575014-7575036 AAAAAAAAAAAAAAGTGGCCGGG - Intergenic
1162509979 19:11112090-11112112 AAGAAAAAAGAAAATTAGCCAGG - Intronic
1162640202 19:12002520-12002542 AAGAAAAAGAAAAAGTGGCCAGG - Intergenic
1162717058 19:12640787-12640809 GAGAAAAGGAAAAAGAGGCCGGG + Intergenic
1162723032 19:12673709-12673731 CAAAAAAAGAAAAAAGGGCCGGG - Intronic
1162726139 19:12690621-12690643 TAAAAAAAAGAAAAATGGCCGGG + Intronic
1162732191 19:12725072-12725094 AAGAAATAGGAAAACTGGGCCGG - Intergenic
1162732244 19:12725414-12725436 AAAAAAAAGGAAAAAAGGCCAGG - Intergenic
1162732295 19:12725727-12725749 AAGAAATAGGAAAAAAGGCCAGG - Intergenic
1162759764 19:12881624-12881646 CACGAAAAGGAACGGTGGCCAGG - Intergenic
1162816835 19:13200803-13200825 AAAAAAAAAAAAAAGTGGCCAGG - Intergenic
1162855449 19:13464842-13464864 CAAAAATAGGAAAAGTTGGCCGG - Intronic
1163007304 19:14405138-14405160 AAGAAAAAAAAAAAGAGGCCGGG - Intronic
1163039296 19:14590680-14590702 AAGAAAAAAGAAAAGAGGCTGGG - Intronic
1163087104 19:14989574-14989596 AAGAAAAAAGATAAGTGGTCAGG + Intronic
1163484680 19:17578713-17578735 CAGAAAAAAGAAAAATGGCTGGG + Intronic
1163669974 19:18621723-18621745 AAGAAAAAGAAAAAGTAGACCGG - Intergenic
1163812087 19:19439550-19439572 TAGCAAAAGGACAAGTGGTCAGG + Intronic
1163898960 19:20083908-20083930 TACAAAAAGAAAAATTGGCCAGG - Intronic
1163921184 19:20290393-20290415 GAGAAAAAGGAGAAGAGGCCGGG - Intergenic
1163950468 19:20580126-20580148 CAAAAAAAAAAAAAGAGGCCAGG - Intronic
1164155785 19:22596164-22596186 CAGAAAAAGGAAGCGCAGCCAGG - Intergenic
1164903220 19:31946112-31946134 CAAAAAAAGGTAAAGAGACCAGG + Intergenic
1164963671 19:32460248-32460270 AAGAAAAAGAAAAATTAGCCAGG + Intronic
1165043844 19:33088644-33088666 AAAAAAAAGCAAAGGTGGCCGGG - Intronic
1165191938 19:34071483-34071505 TTGAAAAAGAAAAACTGGCCAGG - Intergenic
1165319906 19:35078800-35078822 TAGAAAAAGGCAAATTGGCCAGG - Intergenic
1165379710 19:35470005-35470027 TACAAAAAGGGAAATTGGCCAGG + Intergenic
1165398038 19:35577883-35577905 AACAAAAAGGAAGAGTGGCTGGG - Intergenic
1165555087 19:36623793-36623815 CAAAAAAAAAAAAAGGGGCCGGG + Intronic
1165672230 19:37689193-37689215 AAGAAAAAAAAAAAGAGGCCGGG + Intronic
1165688682 19:37845110-37845132 AAGAAAAAGAAAAAAAGGCCGGG + Intergenic
1165701130 19:37938916-37938938 AAAAAGAAGCAAAAGTGGCCGGG - Intronic
1165727267 19:38121923-38121945 AAAAAAATGAAAAAGTGGCCAGG + Intronic
1165869463 19:38960801-38960823 AAAAAAAAAAAAAAGTGGCCGGG - Intronic
1166059073 19:40313619-40313641 CTTAAAAAGGAAAAGCGGGCTGG - Intergenic
1166063988 19:40345860-40345882 AAAAAAAAGGAAAGGTGGCTGGG + Intronic
1166077490 19:40422138-40422160 AAGAAAAAAAAAAAGTGGCCTGG + Exonic
1166138687 19:40793534-40793556 AGAAAAAAGGAAAAGAGGCCAGG - Intronic
1166377884 19:42337799-42337821 AAAAAAAAAGAAAAGAGGCCGGG - Intronic
1166395053 19:42433530-42433552 CAGGAAAAGGATAAGGGGCAGGG + Intronic
1166534816 19:43566235-43566257 AAAAAAAAAAAAAAGTGGCCAGG + Intronic
1166661660 19:44651161-44651183 TAGAAAATGGACAAGGGGCCAGG - Intronic
1166924651 19:46259044-46259066 AAAAAAAAAAAAAAGTGGCCAGG - Intergenic
1167201220 19:48066806-48066828 AAGAAAAAGAAAAATTAGCCAGG + Intronic
1167210152 19:48129053-48129075 CTCAAAAAAGAAAAGAGGCCAGG - Intronic
1167393674 19:49212984-49213006 GAAAAGAAGAAAAAGTGGCCGGG - Intergenic
1167401535 19:49274540-49274562 CCAAAAAAGGAAATCTGGCCGGG - Intergenic
1167588476 19:50389124-50389146 CAAAAAAAAAAAAAGAGGCCAGG - Intronic
1167801040 19:51742234-51742256 CAGAAAAAGTAATTGAGGCCAGG + Intergenic
1167804295 19:51769128-51769150 CAAAAAGAGGAAAACTGGCAAGG - Exonic
1168134830 19:54343301-54343323 CAAAAAAAGAAAAGGGGGCCGGG - Intergenic
1168150405 19:54444390-54444412 AAAAAATAGGAAAAGGGGCCAGG + Intergenic
1168342088 19:55630584-55630606 AGGAAAAAGAAAAAGGGGCCGGG - Intergenic
1168445479 19:56408570-56408592 CAGATGAAGAAAAAGAGGCCAGG + Intronic
1168677669 19:58290753-58290775 AAAATAAAGGAAAAGAGGCCAGG + Intronic
925020485 2:564203-564225 CAGAAAAAGGAAAGGTGGGAAGG + Intergenic
925088359 2:1131943-1131965 AAGAAAAAGGATTAGTGGCCAGG - Intronic
925372023 2:3352699-3352721 AAGAAAAAGGATGAGTGGCTGGG + Intronic
925515087 2:4673221-4673243 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
926002045 2:9341100-9341122 CATAAAAAGTAAGAGAGGCCAGG - Intronic
926006199 2:9375119-9375141 AAAAAAAAGTAAAATTGGCCAGG + Intronic
926844557 2:17122122-17122144 CAAAAAAAAGAAAATTAGCCGGG + Intergenic
927057749 2:19382679-19382701 CAGTCAAAGTAAAAGTGGACTGG - Intergenic
927141033 2:20130951-20130973 CAGGGAAAGGTAAAGTGTCCTGG - Intergenic
927233700 2:20850378-20850400 ATGGAAAAGGAAAAGTGGCTCGG - Intergenic
927353414 2:22145553-22145575 CTGAAAATGCAAAATTGGCCGGG - Intergenic
927476271 2:23416740-23416762 CAGAAAAAGGGAACGTGGCCAGG - Intronic
927588365 2:24331060-24331082 AAAAAAAAAAAAAAGTGGCCGGG - Intronic
927778872 2:25923516-25923538 AAGGAAAAAGAAAAATGGCCGGG + Intergenic
928076126 2:28266280-28266302 CAGAAAGAAGAAAGGTGGCTGGG - Intronic
928193048 2:29191581-29191603 CAGAGAAAGGAAGAGTTGTCTGG + Intergenic
928571091 2:32609177-32609199 AAAGAAAAGGAAACGTGGCCAGG - Intronic
928953484 2:36836692-36836714 CAGTAAAAAGAACAGTGGGCAGG + Intergenic
928962070 2:36937371-36937393 AAGAAAAAGAAAAAGAGGTCGGG + Intronic
929139162 2:38652083-38652105 AAGAAAAAGAAAAAGAGGCCAGG + Intergenic
929664863 2:43826134-43826156 AAGAAAAAGAAAAATTAGCCAGG - Intronic
929666809 2:43839715-43839737 CGGAAAAAGCGAAACTGGCCAGG - Intronic
929734957 2:44538072-44538094 CAGATAAAGAAAATGTGGCCGGG + Intronic
930072611 2:47380015-47380037 AAGAAAAAGTAATAGTGGCTGGG + Intronic
930381957 2:50641370-50641392 GAGAAAATGGAAGAGTGGGCAGG + Intronic
930470079 2:51801366-51801388 GAGAAAAAGGAGGAGTTGCCAGG + Intergenic
930760730 2:55032730-55032752 TAAAAAAAGCAACAGTGGCCAGG + Intronic
930791909 2:55341441-55341463 CAGAAAAAAAAAAAGGGGGCGGG - Intronic
931273499 2:60723326-60723348 CAGAAAAAAGAAAATCAGCCGGG - Intergenic
931398990 2:61913380-61913402 AAAAAAAGAGAAAAGTGGCCGGG + Intronic
931703699 2:64928899-64928921 GCAAAAAAGGAAAAGTGCCCAGG - Intergenic
932106692 2:68949713-68949735 CAGAAAAAGAACAATTGGTCAGG - Intronic
932174571 2:69587906-69587928 AAGAAAAAAGAAATGAGGCCTGG - Intronic
932211826 2:69937773-69937795 CAAAAATAGGAAAATTTGCCAGG - Intronic
932355717 2:71067171-71067193 AAGCAAAAGGGAAAGTGCCCAGG - Intronic
932615906 2:73231412-73231434 AAAAAAAAGAAAAAGAGGCCGGG - Intronic
932743027 2:74306511-74306533 AAGAAACACGAAAAGTGGCTCGG - Intronic
932891633 2:75601902-75601924 CAGATAAAGGGAAATTGGCCAGG - Intergenic
933281637 2:80338282-80338304 AAGAAAAAGAAAAAAAGGCCAGG - Intronic
933513967 2:83277669-83277691 CAAACAAAAGAAAAGTAGCCAGG + Intergenic
933613019 2:84456955-84456977 TGAAAAAAGGAAAAGTGGCCTGG - Intronic
933736465 2:85499251-85499273 CAGGAAAAGGAAAATGGGCTGGG - Intergenic
933827677 2:86178330-86178352 AAGAAAAAAAAAAACTGGCCAGG + Intronic
934882677 2:97996844-97996866 AAGAAAAAGAAAAATTGGCGTGG - Intergenic
935080030 2:99783730-99783752 CAGAAAAAGAAAGAATGGTCAGG + Intronic
935402391 2:102674082-102674104 TTAAAAAAGAAAAAGTGGCCAGG - Intronic
935752409 2:106248134-106248156 CATTAAAAGAAAAGGTGGCCAGG + Intergenic
936279038 2:111122221-111122243 CAAAACAAGGACAAGTGGCGAGG + Intronic
936851259 2:116900730-116900752 AAGAAAAAGAAAAAAAGGCCAGG - Intergenic
937129133 2:119494212-119494234 CAGAGAAAGGAAGAGTGGTGAGG + Intronic
937312028 2:120908505-120908527 CTGAAAAGGGAAAAGAAGCCTGG + Intronic
937396255 2:121538117-121538139 AAAAAAAAATAAAAGTGGCCAGG + Intronic
937423053 2:121774529-121774551 CAGAAAAAGAAAAGTGGGCCGGG + Intergenic
937610015 2:123849983-123850005 CAGATAAAGGAAAAGAGGAAAGG + Intergenic
937662340 2:124445248-124445270 CAGAAAAAAAAAAATTAGCCAGG - Intronic
937817200 2:126264422-126264444 GAAAAAAAGAAAAATTGGCCAGG + Intergenic
937937240 2:127256104-127256126 CAGTAAAAGTAATGGTGGCCAGG + Intergenic
937960990 2:127458683-127458705 AAAAAAAAGGAAAATTAGCCAGG + Intronic
938086965 2:128408060-128408082 TAGAAAAAGCAAAACAGGCCGGG - Intergenic
938277228 2:130037553-130037575 CAAAAAAAAAAAAAGTAGCCGGG - Intergenic
938419381 2:131132124-131132146 AAAAAAAAGAAAAAGTGGCCAGG - Intronic
938461056 2:131496990-131497012 AAAAAAAAGGAAAATTAGCCAGG + Intergenic
938736339 2:134189893-134189915 AAAGAAAAGGAAAAGAGGCCAGG - Intronic
938939367 2:136155585-136155607 AAGAAAAAGAAAAAGCTGCCAGG + Intergenic
939369872 2:141285380-141285402 TAAAAGAAGGAAAAGAGGCCAGG - Intronic
939500135 2:142974230-142974252 CAGTAAAGGGAAAAGTGGGCTGG + Intronic
939743306 2:145937188-145937210 AATAAAAACAAAAAGTGGCCAGG + Intergenic
940042718 2:149377483-149377505 CATAAAAAAGCAAAGTGGCTGGG + Intronic
940225062 2:151392563-151392585 CAGGAAAGGGAAAAGTCACCTGG + Intergenic
940290878 2:152076455-152076477 GACAAAAATGAAAAGCGGCCAGG - Intronic
940526577 2:154823340-154823362 GAGAGAAAGAAAAAGAGGCCAGG + Intronic
940657559 2:156507301-156507323 AAGAAAAAGAAAAAGTGGCTGGG - Intronic
940691052 2:156921448-156921470 CAGTAAGAGGAAAAATAGCCAGG - Intergenic
940865512 2:158813848-158813870 AAGAAAAAGGAAAGGAGGCCGGG - Intronic
941039514 2:160604896-160604918 TAGGAAGGGGAAAAGTGGCCTGG - Intergenic
941202352 2:162527192-162527214 TAGAAAAAGGAAACATGGCATGG - Intronic
941620025 2:167766917-167766939 CAGGCAAAGAAAAAGTGGACTGG - Intergenic
942787477 2:179716379-179716401 CAGAAAATGGAAAATAGGTCAGG - Intronic
942938216 2:181584348-181584370 CAGAAAAAAAAAAAGTTGGCTGG + Intronic
943057540 2:183000795-183000817 AAGAAAAAAGCACAGTGGCCAGG + Intronic
943531214 2:189083300-189083322 CAGAGAACGGCAAAGGGGCCAGG + Intronic
944228811 2:197373130-197373152 AATAAAGAGGGAAAGTGGCCGGG - Intergenic
944547041 2:200809385-200809407 CAGAGAAAAGATAAGTGGCAAGG + Intergenic
944730811 2:202515592-202515614 AAGAAAAAGAAAATATGGCCAGG + Intronic
944785486 2:203065751-203065773 CAGAAAAAAAAAAAGAAGCCTGG + Intronic
944827421 2:203499424-203499446 CAAAAAAAAAAAAACTGGCCGGG + Intronic
945582377 2:211611312-211611334 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
945645138 2:212482775-212482797 CAAAAAAAGAAAAATTTGCCGGG - Intronic
945880938 2:215324190-215324212 CAGAAACAAGACAAGAGGCCAGG - Intronic
946199302 2:218062415-218062437 AAAAAAAATGATAAGTGGCCGGG + Intronic
946259959 2:218480145-218480167 CAAAAAAAAAAAAAATGGCCGGG + Intronic
946296375 2:218786953-218786975 CAAAAATAGAAAAATTGGCCAGG - Intronic
946331491 2:219011761-219011783 CAGAAAGGGGAAAAGGGGCTGGG - Intronic
946350849 2:219150965-219150987 CAGAAAAAAAAAAATTAGCCAGG + Intronic
946522544 2:220482311-220482333 TAGCAAAAGCAACAGTGGCCAGG - Intergenic
946767694 2:223055151-223055173 TAAAAAAAAAAAAAGTGGCCGGG - Exonic
946839956 2:223810019-223810041 CATAAAAAGTAAAATAGGCCGGG - Intronic
946877174 2:224140765-224140787 CAGAAAAAAAAAAATTAGCCAGG - Intergenic
946934815 2:224709040-224709062 AAGAAAAAGAAAAAGAAGCCAGG - Intergenic
947076942 2:226355054-226355076 AAAAAAAAAGAAAAGTAGCCAGG - Intergenic
947208542 2:227684600-227684622 CAGAAATTGGAAAGGAGGCCAGG - Intergenic
947264628 2:228263547-228263569 CAGAGAAAGGAAAGCTTGCCTGG + Intergenic
947367659 2:229413614-229413636 TTGAAAAAGGAAAAAAGGCCGGG - Intronic
947453311 2:230228653-230228675 CAGAACAAGGAAAATTGTCAGGG - Intronic
947640385 2:231704482-231704504 CAGAAACAGCAAAAGAGGGCCGG + Intergenic
947753584 2:232545344-232545366 AAGAAAAAGGAACAGGGGCAGGG + Intronic
947761221 2:232605154-232605176 CAAAAAAAAAAAAAGAGGCCGGG + Intergenic
948392313 2:237621259-237621281 CAGAAAAACCAAAATGGGCCTGG - Intergenic
948923371 2:241078087-241078109 TAACGAAAGGAAAAGTGGCCGGG + Intronic
949034047 2:241808143-241808165 CAGGTAAAGGGAAAGTGGCCCGG + Intergenic
1169139806 20:3221185-3221207 AAGAAAAAGAAAATCTGGCCAGG - Intronic
1169148333 20:3269200-3269222 AAAAAAAAAAAAAAGTGGCCGGG - Intronic
1169163437 20:3402736-3402758 CAAAAAAAGAAAAATTAGCCAGG - Intronic
1169372903 20:5042422-5042444 AAGAAAAAGAAAAATTAGCCAGG - Intergenic
1169493421 20:6090591-6090613 CAAAAAAAGAAAAATTAGCCAGG + Intronic
1169586980 20:7096342-7096364 AAGAAAAAGGAAACGTGGGGAGG + Intergenic
1169755945 20:9043380-9043402 TATAAAAGGGAAAAGTGGGCTGG + Intergenic
1170203331 20:13768599-13768621 AAGAAAAGGGAGAAGGGGCCAGG + Intronic
1170271242 20:14529329-14529351 CAGAAAGATGAAAAGAGACCTGG - Intronic
1170642993 20:18172393-18172415 AAAAAAAAAAAAAAGTGGCCAGG - Intronic
1170777168 20:19385928-19385950 CAGAAATAGAAAAATAGGCCAGG - Intronic
1170790966 20:19509170-19509192 CAGATGAAGGAAATGAGGCCCGG + Intronic
1171479889 20:25446328-25446350 TAGAAAAAGGAGTAGGGGCCGGG - Exonic
1171995420 20:31727169-31727191 CAGAAAAAGAACAATTAGCCAGG + Intergenic
1172234265 20:33359338-33359360 GAGAAAAGGGAGAAGTGGCTGGG - Intronic
1172249161 20:33466805-33466827 CTTAAAAAAAAAAAGTGGCCGGG - Intergenic
1172277926 20:33690777-33690799 AAGAAAAAAAAAAAGAGGCCAGG - Intergenic
1172494730 20:35372014-35372036 AAAAAAAAGAAAAAGAGGCCGGG + Intronic
1172518626 20:35553300-35553322 CAGATAAAGGGAAAGTGATCTGG + Intronic
1172538293 20:35691443-35691465 AAGAAAAAAAAAAAGCGGCCAGG + Intronic
1172591124 20:36118893-36118915 CAGATAAAGAAACAGAGGCCTGG + Intronic
1172609144 20:36236517-36236539 CAGGAAAGGAAAAAGAGGCCAGG - Exonic
1172712500 20:36936819-36936841 CAAAAAAAGAAAAATTAGCCAGG - Intronic
1172754525 20:37273907-37273929 CAGAATTAGAAAAAGAGGCCAGG + Intergenic
1173356717 20:42299940-42299962 CATAAAAGGCAAAAGTGGCCGGG - Intronic
1173518163 20:43679748-43679770 CAAAAAAATGAAAATTAGCCAGG + Intronic
1173578819 20:44131978-44132000 CAGAGAAAGGCAAAGTCACCTGG - Intronic
1173591034 20:44225082-44225104 CAGCAGAAGGAACAGCGGCCTGG + Intergenic
1173728488 20:45312845-45312867 AAGAAAAAGAAAAATTAGCCTGG + Intronic
1174638475 20:52022225-52022247 AAGAAACAGGAAAATAGGCCAGG - Intergenic
1174763083 20:53225801-53225823 CTGACAAATGAAAAGTGGCCTGG + Intronic
1174782793 20:53405698-53405720 GATAAAAAGAAATAGTGGCCAGG + Intronic
1174900130 20:54490881-54490903 GAGAGAAAGGAAAAGAGGCTGGG - Intronic
1174930917 20:54813771-54813793 AAGAAAAAGGAAAACTAGCCAGG - Intergenic
1175086935 20:56467652-56467674 AAGAAAAAGAAAAATTAGCCAGG - Intergenic
1175098574 20:56561655-56561677 AAGAAAAAGAAAAAGTTGCCGGG - Intergenic
1175216929 20:57396164-57396186 TAAAAAAAGGAAAAGAGGCAAGG - Intronic
1175450886 20:59066554-59066576 AAGAAAAAAGAAAAGTGACTGGG + Intergenic
1175616175 20:60400693-60400715 CAGAAAATGGATAAGTGACAGGG - Intergenic
1176192246 20:63817417-63817439 TAGAAAAAGAAAAAGAGGCCGGG + Intronic
1176281938 20:64318252-64318274 CAGAGAAAGGAAAAGGAACCGGG + Intergenic
1176302072 21:5103159-5103181 TAAAAAAAGGAAATGTGGGCCGG + Intergenic
1176368192 21:6046108-6046130 CAGCATAAGGCAAGGTGGCCTGG - Intergenic
1176524442 21:7855381-7855403 GAGAAAAGTGGAAAGTGGCCAGG + Intergenic
1177397761 21:20559781-20559803 GAGAAAACTGAAAATTGGCCAGG + Intergenic
1177515956 21:22151712-22151734 GAAAAGAAGGAAATGTGGCCTGG - Intergenic
1178301662 21:31458441-31458463 AAGAAAAAAGAAAACTGTCCTGG + Intronic
1178573626 21:33764390-33764412 CAGAATAAGGAAGAGCGGGCAGG + Intronic
1178642800 21:34359721-34359743 CACTAAAAGGAAAAGAGGCTGGG - Intergenic
1178658462 21:34485394-34485416 GAGAAAAGTGGAAAGTGGCCAGG + Intergenic
1178743186 21:35222675-35222697 CAGAAACAGGAAATGCAGCCAGG - Intronic
1178939749 21:36895163-36895185 CAGAAACAACAAAAATGGCCTGG + Intronic
1179019604 21:37626427-37626449 AAGAAAAGGGAAAAGTGGCCAGG - Intronic
1179412630 21:41174069-41174091 AGGAAAAAGGAAAAATGGGCAGG - Intronic
1179434026 21:41347458-41347480 TAGAAAGAGGAAAAGAGGCTGGG + Intronic
1179755327 21:43492434-43492456 CAGCATAAGGCAAGGTGGCCTGG + Intergenic
1179854957 21:44158741-44158763 TAAAAAAAGGAAATGTGGGCCGG - Intergenic
1179875395 21:44264438-44264460 AAGAAAAAGAAAAACAGGCCGGG - Intergenic
1180209094 21:46283218-46283240 CAGAAAAAGTGAAATTGGCCGGG - Intronic
1180646638 22:17344385-17344407 CACATAAAGAAAAAGTAGCCGGG - Intergenic
1181602185 22:23959215-23959237 CAGGAAAAGGACAAGAGGTCAGG - Intronic
1181606324 22:23982092-23982114 CAGGAAAAGGACAAGAGGTCAGG + Intronic
1181759361 22:25047453-25047475 AAAAAAAAGGAAAAGAGGCCAGG - Intronic
1182030714 22:27157329-27157351 AAGGGAAAGGGAAAGTGGCCAGG + Intergenic
1182154190 22:28053899-28053921 CCTTAAAAGCAAAAGTGGCCAGG - Intronic
1182236215 22:28878927-28878949 AAGAAAAAGGAAGAAGGGCCTGG - Intergenic
1182542796 22:31054133-31054155 CAGAAAAAGAGGAGGTGGCCAGG + Intergenic
1182586808 22:31348084-31348106 CAGAGAAAGAGAAAGGGGCCGGG + Intergenic
1182738355 22:32547278-32547300 AAGCAAAAGGAAGAGTGGCCGGG - Intronic
1182938252 22:34247564-34247586 AAGAAATAGGAAAAAGGGCCGGG - Intergenic
1183449857 22:37887312-37887334 AAAAAAAAGAAAAAGAGGCCAGG + Intronic
1183588354 22:38766191-38766213 CAAAAAAAAGACAACTGGCCTGG + Intronic
1183611430 22:38909345-38909367 CATAAAAAGGAATGGAGGCCGGG - Intergenic
1183614640 22:38936465-38936487 CAGAGAAAGGGCAGGTGGCCAGG + Intergenic
1183868693 22:40724239-40724261 TAAAAAAAAAAAAAGTGGCCGGG + Intergenic
1183884813 22:40870721-40870743 AAGAAAAATTAAAAGGGGCCGGG + Intronic
1183887496 22:40896827-40896849 CAGAAAAAGTAAAAGTTACCAGG - Intronic
1183894190 22:40954782-40954804 AAAAAAATGGAAAACTGGCCGGG - Intronic
1183918485 22:41143872-41143894 CAAAAAAATCAAACGTGGCCAGG - Intronic
1183965640 22:41440410-41440432 CAAAAAAAGAAAAAGAGGCCAGG - Intronic
1184008805 22:41731345-41731367 CAAAAAAAGAAAAAGTCGCCTGG - Intronic
1184125840 22:42486464-42486486 AAAAAAAAAAAAAAGTGGCCAGG + Intergenic
1184180485 22:42820703-42820725 CACAGAAAGGAAAAGTAACCTGG - Intronic
1184213769 22:43052761-43052783 CAAAAAAAAGAAAACTGGCTGGG + Intronic
1184326033 22:43786424-43786446 TAGAAAAAAAGAAAGTGGCCGGG + Intronic
1184417558 22:44361077-44361099 ACCAGAAAGGAAAAGTGGCCTGG + Intergenic
1184777364 22:46630005-46630027 AAGAAAAAGAAAATGTGGCCTGG - Intronic
1184915422 22:47565585-47565607 CAGAGAAGGGAAGAGAGGCCAGG + Intergenic
1184944498 22:47793612-47793634 CAGAAACACGAAAAGTGAGCTGG - Intergenic
1184971779 22:48027531-48027553 TAAAAAAAGTAAAACTGGCCAGG - Intergenic
949249591 3:1966630-1966652 CAAAAAATGTAAACGTGGCCTGG - Intergenic
949479916 3:4483965-4483987 CAGAAAAAGCAAAATGGGCCTGG - Intergenic
949561239 3:5204685-5204707 TTTAAAAAGAAAAAGTGGCCAGG - Intronic
949781252 3:7691387-7691409 AAGAAAAAGAAAAACTGGACTGG + Intronic
950035685 3:9883542-9883564 AAAAAAAAGGAAACCTGGCCGGG - Intergenic
950067160 3:10121874-10121896 AAAAAAAAAAAAAAGTGGCCGGG - Intronic
950231105 3:11276616-11276638 GATAAGAAGGAAAAGTGGTCAGG - Intronic
950395374 3:12729953-12729975 AAAAAAAAAAAAAAGTGGCCGGG + Intergenic
950630387 3:14278350-14278372 CAGAAATGGGAAGAGAGGCCAGG - Intergenic
951550107 3:23868600-23868622 AAGAGAAAGTAAAAGTGGCCAGG - Intronic
951809496 3:26683748-26683770 CAGAAAATGGAAAGCTGGCAAGG - Intronic
952812043 3:37412669-37412691 CAGAATAAGAAAAATAGGCCAGG + Intronic
953498332 3:43408013-43408035 CAGCAAAAGGAAAACTGGAGTGG + Intronic
954041263 3:47889210-47889232 CAGTCACAGGAAATGTGGCCAGG - Intronic
954065368 3:48101659-48101681 CAAAAAAAGAAAAATTAGCCAGG + Intergenic
954093663 3:48305098-48305120 AAGAAAAAGGAACAGAGCCCTGG - Intergenic
954248955 3:49353651-49353673 CTCAAAAAGAAAAAGTGGCTGGG - Intergenic
954268170 3:49486511-49486533 CAAAAAAAAGAAAAAGGGCCGGG - Intronic
954474249 3:50729017-50729039 CAAAAAAAGAAAAACAGGCCAGG - Intronic
954532195 3:51330677-51330699 CACAAACATGAAAACTGGCCTGG - Intronic
954728673 3:52638754-52638776 AAGAAAAAGAAAAATTAGCCGGG - Intronic
954811623 3:53251842-53251864 AGAAAAAAGGAAAAGGGGCCAGG + Intronic
955322179 3:57982315-57982337 AAAAAAAAAAAAAAGTGGCCGGG - Intergenic
955371651 3:58356894-58356916 CAAAAAAAAAAAAAGAGGCCGGG - Intronic
955550700 3:60081812-60081834 AAGAAACAGGAAAAGATGCCTGG - Intronic
955865815 3:63382674-63382696 GAGAAAAAGGCAGATTGGCCAGG - Intronic
955905930 3:63807558-63807580 GAGAAAAAGCAAAAGTTGGCTGG + Intergenic
956133120 3:66072947-66072969 CATAAAAAGGAAAGAAGGCCAGG - Intergenic
956265470 3:67391794-67391816 CAGAAAAGTGCAAAGAGGCCAGG - Intronic
956609349 3:71106617-71106639 AAAAAAAAAAAAAAGTGGCCGGG - Intronic
956627493 3:71281066-71281088 AAGAAGAAGAAAAAGTAGCCAGG + Intronic
956927303 3:74003183-74003205 GATAAAAAGAAAAAGTGGGCCGG - Intergenic
957137763 3:76310944-76310966 CAGAAAAGGGAAAAGATGTCAGG - Intronic
957559437 3:81803215-81803237 CAAAAAAATTAAAAATGGCCAGG + Intergenic
957685182 3:83494798-83494820 CAGAAAAAGGAACAGTCAGCAGG + Intergenic
957739595 3:84247774-84247796 TAAAAAAAAAAAAAGTGGCCCGG + Intergenic
957747374 3:84362959-84362981 AAGAAAAAGACAAATTGGCCGGG - Intergenic
958037674 3:88189539-88189561 CAGAAAAAGGAAGAGGGGAGGGG - Intergenic
958536885 3:95415244-95415266 CAAATAAAGGAAAAACGGCCGGG + Intergenic
958792585 3:98669232-98669254 AAGAAAAAAGAAAAGTTGGCTGG - Intergenic
958940150 3:100303010-100303032 CACAAAAAGGAAAGATGGCTAGG - Intronic
958962228 3:100521545-100521567 CAGAAAGAGGAAATGAGGCTGGG - Intronic
959072009 3:101711100-101711122 CAGAAAAAATAAACTTGGCCAGG - Intergenic
959248367 3:103904963-103904985 CAGAAAAAGGAAAAGTAAGAAGG + Intergenic
959393909 3:105811996-105812018 AAAAAAAAGGAAATGGGGCCAGG - Intronic
959660980 3:108868239-108868261 TAGAAAAAGAAAAACTGGCTGGG + Intergenic
960164286 3:114384292-114384314 GGGAAAAAGGAAAAGGGGGCTGG + Intronic
960385842 3:117020771-117020793 CAGAGAAAGAAACTGTGGCCTGG + Intronic
960538758 3:118842377-118842399 CAGAAAAAAGAAAAGGGGAGGGG + Intergenic
960540064 3:118851904-118851926 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
960585510 3:119317470-119317492 CTGAAAATAGAAATGTGGCCAGG - Intronic
960813626 3:121650840-121650862 AATAAAATGAAAAAGTGGCCAGG + Intronic
961149145 3:124621635-124621657 CAGCAACAGGAAATGGGGCCGGG - Intronic
961151992 3:124646684-124646706 AAAAAAATGGAAAAGAGGCCGGG - Intronic
961771245 3:129251679-129251701 AAAAAAAAAGAGAAGTGGCCGGG - Intronic
961951378 3:130752879-130752901 CAGAAAATGGAATATTAGCCTGG + Intergenic
962118339 3:132535593-132535615 CAGGAAAAGGAACAGAGGCCAGG + Intronic
962627561 3:137241614-137241636 CAGAAACAGGAAAGGAGCCCTGG - Intergenic
962633425 3:137302993-137303015 CAGATAAAGGCAAAGTGATCAGG - Intergenic
962765436 3:138558067-138558089 GAGAAAAAAGAAAACTGGCCAGG + Intronic
963150640 3:142042591-142042613 AAGAAAAAGAAACACTGGCCAGG - Intronic
963153304 3:142069902-142069924 CAAAAAAAAGAAAAAAGGCCAGG - Intronic
963199734 3:142574167-142574189 CAGAAGAAAGAAACTTGGCCGGG + Intronic
963471421 3:145747060-145747082 CAGAGAAAGGGAAACTGGCAGGG + Intergenic
963584607 3:147169653-147169675 CAGAAAAAAAAAAATTAGCCTGG + Intergenic
963727669 3:148940168-148940190 CAAAAAAAAAAAAAGTTGCCAGG + Intergenic
963779169 3:149469907-149469929 CAAAAAAAAGAAAATTAGCCTGG + Intergenic
964029328 3:152118380-152118402 AAAAAAAAGGAAAATTGGCCAGG - Intergenic
964104290 3:153022481-153022503 CTCAAAAAAGAAAAGAGGCCAGG + Intergenic
964622424 3:158731076-158731098 TAGAAAAAGGCAACCTGGCCAGG - Intronic
964853904 3:161124415-161124437 CAAAAAAAGGAAAACTCTCCAGG + Intronic
965988458 3:174786153-174786175 CTGAAAAAGTAAAATTGGCCAGG + Intronic
966140324 3:176749684-176749706 GAGAAAAAGGAATAGTGGAAAGG - Intergenic
966206874 3:177413774-177413796 TAGAAAAAGAAAAGTTGGCCGGG - Intergenic
966512812 3:180783086-180783108 CAGAAAAAAAGATAGTGGCCTGG + Intronic
966524210 3:180903471-180903493 CAAAAAAAGGAAAAAGGGCCAGG + Intronic
966535945 3:181033999-181034021 TAGAAAAATCAAAATTGGCCAGG + Intergenic
966603217 3:181795865-181795887 CAAAATAAGGAAGAGAGGCCAGG - Intergenic
966613557 3:181891527-181891549 AAGAAAAAGAAAATGTGGGCTGG - Intergenic
966800492 3:183759144-183759166 CAGAAACCGGCAAAGTGGCGGGG - Intronic
966811673 3:183851862-183851884 AAAAAAAAGGAAAATAGGCCAGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966997078 3:185293404-185293426 CTCAAAAAGAAAAAGAGGCCAGG - Intronic
967032380 3:185620027-185620049 AAGAAAAAGAAAAAAAGGCCAGG - Intronic
967053083 3:185802913-185802935 CAGAAATAGGATAACTGGCCGGG - Intronic
967111061 3:186294372-186294394 CAAAAAAAGAAAAATTAGCCTGG + Intronic
967207501 3:187137515-187137537 AAGAAAAAGAAAAATTGGCCGGG + Intronic
968117634 3:196101683-196101705 TAAAAAGAGAAAAAGTGGCCAGG + Intergenic
968126101 3:196161592-196161614 CTAAAAAAGAAAAATTGGCCAGG + Intergenic
968166024 3:196466022-196466044 AAAAAAAAGTAAAAGAGGCCTGG - Intergenic
968207927 3:196821134-196821156 TAAAAAAAAGAGAAGTGGCCAGG - Intronic
968331259 3:197872559-197872581 AAGAAAAAGGAAAAGAGACTGGG + Intronic
968511847 4:999217-999239 AAGAAAAAAGAAAAATGCCCTGG + Intronic
968726590 4:2250747-2250769 CAGAAAAGGGAGAAATGGGCTGG - Intronic
968852191 4:3089546-3089568 CAAAAAAAGTAAAGATGGCCAGG - Intronic
968942876 4:3648245-3648267 CAGGAACGGGAAAGGTGGCCTGG + Intergenic
969073379 4:4557850-4557872 CACAAAAAGTAAAATTAGCCGGG + Intergenic
969296102 4:6271294-6271316 CAGACACAGGAAAAGTTGGCTGG + Intronic
970117162 4:12710292-12710314 CAGAAAGAAGAAAAGGGGCAGGG - Intergenic
970330263 4:14975259-14975281 CAGAAAAAAAAAATGTGGCCTGG - Intergenic
970582202 4:17483680-17483702 ATGAAAAGGGAAAAGGGGCCAGG - Intronic
970661572 4:18291566-18291588 GAGAAGAAGGAAAAGCAGCCAGG + Intergenic
970747148 4:19312755-19312777 TAAAAAAAAGAAAAGTGGCCGGG + Intergenic
971037927 4:22715371-22715393 CAGCAAATGGAAAAGAGGCATGG + Intergenic
971241511 4:24893238-24893260 CAGAAAAATGAAAGGTGGCTAGG + Intronic
971527831 4:27643807-27643829 AAAAAAAAAAAAAAGTGGCCAGG - Intergenic
971663415 4:29450251-29450273 GAGAGAAATGAAAAGTGGTCTGG - Intergenic
971860292 4:32093127-32093149 CAGTCAAAGCAAAAGTGGACTGG - Intergenic
971891078 4:32522781-32522803 AAGGAAAAGAAAAAGTGGACCGG + Intergenic
971943861 4:33249886-33249908 CAGAAAAAGAGAAAGTGGAAAGG - Intergenic
972231069 4:37073464-37073486 CAGAAAAAGGAAATGGGGAGGGG - Intergenic
972435260 4:39027717-39027739 AAGAAAAAGGAAAATTAGCTGGG - Intronic
972535863 4:39999427-39999449 AAAAAAAAAGAAAAGCGGCCGGG + Intergenic
972808031 4:42550634-42550656 AAATAAAAGAAAAAGTGGCCAGG + Intronic
973033214 4:45371687-45371709 GAGAAAAGGGAAAATAGGCCGGG + Intergenic
973561340 4:52139513-52139535 CAAAAATAAGAAAAGGGGCCAGG + Intergenic
973938884 4:55882299-55882321 CAGAAAATGCAAAATTAGCCGGG - Intronic
974814870 4:66990980-66991002 GAAAAAAAAGAAAAATGGCCGGG - Intergenic
975596810 4:76055068-76055090 TAGAAAAATGACAAGAGGCCAGG - Intronic
975886235 4:78968875-78968897 CAAAAAAAGAAAAATTAGCCAGG - Intergenic
976182871 4:82415568-82415590 AAAAAAAAAGAAAATTGGCCTGG - Intergenic
976232584 4:82860085-82860107 TAAAAAAAAGAAAAGTGGCCAGG - Intronic
976286100 4:83372660-83372682 TAGCAGAAGAAAAAGTGGCCAGG - Intergenic
976593341 4:86871163-86871185 CACAAAAAAGAAAATTAGCCAGG + Intergenic
976612565 4:87045108-87045130 CAGAAGAGGGCAAAGAGGCCAGG + Intronic
976841963 4:89442205-89442227 CAGTCAAAGCAAAAGTGGACTGG - Intergenic
976936861 4:90646855-90646877 CAGACAGAGCAAAAGTGTCCTGG + Intronic
977343208 4:95786587-95786609 GAGAAAAAGGAAAAGATTCCTGG - Intergenic
977365211 4:96059045-96059067 CAGAAAAAGAAAAAGTGCAGTGG + Intergenic
977940085 4:102848347-102848369 CAAAAAAAGAAAAATAGGCCGGG + Intronic
977940627 4:102854565-102854587 CAGAAAAAGGAAAACTGTCAGGG - Intronic
978516936 4:109578658-109578680 TAAAAAAAGAAAAATTGGCCAGG - Intronic
978621949 4:110641445-110641467 CAGAAAAAGCAAGCTTGGCCTGG - Intronic
978648389 4:110970327-110970349 AAGAAAAGAGAAATGTGGCCTGG + Intergenic
978678465 4:111348804-111348826 CAGCAAAAGGAAAATTCTCCAGG - Intergenic
978954387 4:114596751-114596773 TAAAAAAAGGAAAAGTGGGGTGG + Intergenic
979007930 4:115326579-115326601 AAGAAAAAGGAAAAATTTCCAGG - Intergenic
979452085 4:120884866-120884888 CAAAAAAAGAAACACTGGCCGGG + Intronic
979535080 4:121810382-121810404 AAAAAAAAAAAAAAGTGGCCGGG + Intronic
979852271 4:125587836-125587858 AAGAAAAAAGAAAATTAGCCAGG + Intergenic
979882417 4:125978138-125978160 TAGAAAAAAAAAAAGTTGCCTGG + Intergenic
979934741 4:126677574-126677596 CACATCAAGGAATAGTGGCCTGG - Intergenic
980727227 4:136778334-136778356 CAGTGAAAGTAAAAGCGGCCTGG - Intergenic
981025571 4:140073836-140073858 CAGAAAGAGGACACGTGGCCAGG + Intronic
981569801 4:146139417-146139439 CAGATAAAGGACAAATGGCAGGG - Intergenic
981724575 4:147834110-147834132 AAGAAAAAGGAAGAGAGACCTGG - Intronic
981995899 4:150975231-150975253 AAGATAAAGGTAAAGTAGCCAGG + Intronic
982016054 4:151154572-151154594 AAAAAAAAAGAAAAGAGGCCGGG - Intronic
982463820 4:155705260-155705282 CAGAAAATGTAATAGGGGCCAGG + Intronic
982663855 4:158236780-158236802 CAGAAAACAGAAAACAGGCCAGG - Intronic
983033047 4:162827570-162827592 CAAAAAATAGAAAAGAGGCCGGG + Intergenic
983193496 4:164780130-164780152 TAAAAATAGGAATAGTGGCCGGG + Intergenic
983204107 4:164894818-164894840 CATAAAAATGAAATGGGGCCAGG - Intronic
984132022 4:175889518-175889540 CAAAAAAAAAAAAAGAGGCCAGG + Intronic
984824817 4:183915118-183915140 CAGAAAAAGAAAACTTGGCCTGG - Intronic
984899560 4:184573100-184573122 CAGAAAAAGCACAAGTCACCTGG + Intergenic
985368920 4:189264219-189264241 AATAAAAAGGAATAGTGGCTTGG + Intergenic
986140542 5:5025963-5025985 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
986633242 5:9795496-9795518 AAAAAAAAAGAAAAGTAGCCAGG + Intergenic
987110620 5:14682875-14682897 CAGCAGATGGAAATGTGGCCAGG + Intronic
987238258 5:15965609-15965631 TAGTAAAAGTAAAAGTGGGCCGG + Intergenic
987446273 5:18023283-18023305 TAGAAAAACAAAAAGAGGCCGGG - Intergenic
987503954 5:18746306-18746328 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
987769699 5:22284866-22284888 CAGGAAAAGGGAAAGAAGCCAGG + Intronic
987772062 5:22318288-22318310 CCAAAAAAGGCAAATTGGCCAGG - Intronic
987954337 5:24718193-24718215 AAAAAAAAGGAAAATTAGCCAGG - Intergenic
988016740 5:25569277-25569299 CAGAAAAAGGAAAAAAGGAAAGG - Intergenic
988017057 5:25572553-25572575 CAGAAAAGGTAAAAATGGTCTGG + Intergenic
988052132 5:26044083-26044105 AAGAAAAAGAAAAAGAGGCTAGG + Intergenic
988339684 5:29954181-29954203 AAAAAAAAGGAAAACAGGCCTGG - Intergenic
988508891 5:31848752-31848774 AAGAAAAAAGAAAATGGGCCGGG + Intronic
988551342 5:32203728-32203750 CAGAAAATGGGAAACTGGCCGGG - Intergenic
988562884 5:32296805-32296827 AAAAAAAAAAAAAAGTGGCCGGG + Intronic
988593478 5:32569218-32569240 AAGAAAAAGAAAAATTAGCCTGG - Intronic
988841413 5:35087283-35087305 AAAATCAAGGAAAAGTGGCCAGG - Intronic
988861359 5:35283597-35283619 AAAAACAAGGAAAAGTGGCTAGG + Intergenic
989038625 5:37202445-37202467 TAAGAAAAGGAAAAATGGCCAGG - Intronic
989169335 5:38459298-38459320 TAAAAAAAAAAAAAGTGGCCAGG - Intronic
989388122 5:40873227-40873249 AAGAATAAGCAAAAGTGGCCAGG + Intergenic
989591321 5:43115576-43115598 AAAAAAAAAAAAAAGTGGCCAGG - Intronic
989751423 5:44898909-44898931 AAGAAAAAGAAAAAATGGCCGGG + Intergenic
990159430 5:52921274-52921296 CAGAAGTAGGAAAATTGGCCTGG - Intronic
990624290 5:57594252-57594274 CTAAAAAAAGAAAAGTGCCCTGG + Intergenic
991195756 5:63930236-63930258 GAGAAAAAGGAAAAGTTGGGGGG + Intergenic
991479103 5:67057943-67057965 AAAAAAAAAAAAAAGTGGCCAGG + Intronic
991495440 5:67221282-67221304 CAAAAAAAAAAAAAATGGCCAGG - Intergenic
991534064 5:67647283-67647305 TGAAAAAAGGAAAAGTTGCCTGG - Intergenic
991903187 5:71480563-71480585 CAAAAAAAAAAAAAATGGCCGGG - Intronic
992713325 5:79483757-79483779 AAAAAAAAAAAAAAGTGGCCGGG + Intronic
992719873 5:79550369-79550391 CAGAAAAAGAAAAATTTACCAGG + Intergenic
992969157 5:82037540-82037562 CATAAAAAGTAAATGGGGCCGGG - Intronic
993652237 5:90535989-90536011 CAGAAAAAAAAAAATTAGCCAGG + Intronic
993867220 5:93209835-93209857 CACAAAAAGGAAAAGATGCCAGG + Intergenic
993912988 5:93706865-93706887 AAAAAAAAAAAAAAGTGGCCAGG + Intronic
994069491 5:95584100-95584122 TAAAAAAAGGAAAAGTGACAAGG - Intronic
994162173 5:96568945-96568967 CAGAAAATAGAAGAGTGGGCTGG + Intronic
994198868 5:96949952-96949974 CAGAAAAAGGAAAGGTGAGGGGG - Intronic
994324815 5:98436392-98436414 AAGAAAAAGGAGCATTGGCCGGG - Intergenic
994364753 5:98900296-98900318 AAGAAAAAAGAAATGTGGTCAGG + Intronic
994943143 5:106350502-106350524 TAGAAAAGGTAAAACTGGCCAGG - Intergenic
995437489 5:112153228-112153250 AAAAAAAAGAAAAAGAGGCCGGG + Intronic
995616170 5:113966725-113966747 CAAAAAAACAAAAATTGGCCAGG - Intergenic
995714495 5:115068784-115068806 CAGAAAAAGGAGAAGAGGAGGGG - Intergenic
995736808 5:115310459-115310481 GAGAAGCAGGAAAAGTGGTCAGG - Intergenic
995866744 5:116699809-116699831 CATAAAAATGAAAAGAAGCCAGG + Intergenic
995883564 5:116868837-116868859 CAGAAAAAAAAAAATTAGCCGGG - Intergenic
995952778 5:117736774-117736796 CATTAAAAGGAAAAGTGCCTGGG - Intergenic
996363828 5:122678847-122678869 CAGAAAATGGAAAATTAGCTGGG + Intergenic
996393241 5:122986480-122986502 CAGAAAAAAGAGAAGTGGGAGGG + Intronic
996799645 5:127388838-127388860 AAGAAAAAATAAAATTGGCCAGG - Intronic
997132174 5:131287946-131287968 CAAAAATGGGAGAAGTGGCCGGG + Intronic
997249046 5:132374758-132374780 CAAAAAAAAAAAAAATGGCCAGG + Intronic
997329207 5:133047021-133047043 AAGAAAAAAAAAAAGAGGCCGGG - Intergenic
997331740 5:133068347-133068369 CAGAAAAAGGGTAAGAGGCTGGG + Intronic
997446194 5:133942146-133942168 AAGAAAAAAGAAAAGTGGCCAGG + Intergenic
997536583 5:134627344-134627366 CAAAAAAATAAAAAGTGGCGGGG - Intronic
997676534 5:135717228-135717250 CAGAAAGAGGACCAGTGGGCAGG - Intergenic
997958175 5:138296898-138296920 AAAAAAAAAAAAAAGTGGCCGGG - Intronic
998223300 5:140305871-140305893 AAGAAATACGAAAAGTAGCCAGG - Intergenic
998238950 5:140425552-140425574 CAAAAAACAGAAAAGAGGCCTGG - Intronic
998409413 5:141897927-141897949 CAAAAAAAAAAAAAGTAGCCGGG + Intergenic
998728606 5:145047712-145047734 CAGAAAAAAAAAAAATAGCCAGG + Intergenic
999477099 5:151910563-151910585 CAGAAAAGTCAAAAATGGCCAGG - Intronic
999592046 5:153158838-153158860 CAGGAAAAGGAAAAGCAGGCGGG - Intergenic
999967543 5:156825680-156825702 GTCAAAAAGGATAAGTGGCCTGG + Intergenic
999992765 5:157064358-157064380 AAGAAAAAGAAAAATTAGCCAGG + Intergenic
1000325680 5:160170334-160170356 AAGATAAAGGAATTGTGGCCGGG + Intergenic
1000964159 5:167635366-167635388 AAGAAAAAAGAAAGGTGGGCAGG - Intronic
1001259601 5:170216560-170216582 CAAAACAATGAACAGTGGCCAGG - Intergenic
1001462156 5:171925385-171925407 CAGAAAATTGAACAGTAGCCTGG - Intronic
1001533736 5:172483350-172483372 CAAAAATAGAAAAAGTAGCCAGG - Intergenic
1002153231 5:177253930-177253952 CGAAAAAAGAAAATGTGGCCAGG - Intronic
1002154785 5:177268267-177268289 TTAAAAAAGAAAAAGTGGCCGGG - Intronic
1002255779 5:177957734-177957756 CAGTAAATGGAAAAGGAGCCAGG + Intergenic
1002970032 6:2006124-2006146 CAGAAACATAAAAATTGGCCAGG + Intronic
1003108952 6:3237601-3237623 TAAAAAAAGAAAAAGAGGCCGGG - Intronic
1003222713 6:4175801-4175823 AAAAAAAAGGAAAACTGGCCAGG + Intergenic
1003547111 6:7068650-7068672 AAGAAAAAGAAAAAGAGGCTGGG - Intergenic
1003944636 6:11063620-11063642 AAGAAAAAGCAAAAGCTGCCAGG - Intergenic
1003990423 6:11481431-11481453 CAGAAATAGGCACAGTGTCCGGG + Intergenic
1004080190 6:12384636-12384658 CAGAAAAAAAAAAAGTGGGCAGG - Intergenic
1004255159 6:14057134-14057156 AAGAAAAAGAAAAATTGGCCAGG + Intergenic
1004280933 6:14279149-14279171 TAGAAATAAGAAAAGAGGCCAGG + Intergenic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1004882059 6:20018870-20018892 GAGAAAAAGGAAGAGATGCCAGG + Intergenic
1004980742 6:21020760-21020782 AAAAAAAAGGAAAAAAGGCCAGG - Intronic
1005000588 6:21236549-21236571 CTCAAAAAGAAAAAGTGGTCTGG - Intergenic
1005045781 6:21640954-21640976 CAAAAAAAGGAAAAGATGGCCGG - Intergenic
1005079695 6:21944623-21944645 CAAAAAAAAAAAAATTGGCCAGG - Intergenic
1005491356 6:26350164-26350186 AAGAAAAAAGAAAAAAGGCCAGG + Intergenic
1005523322 6:26620270-26620292 CAAAAAAATGAAAATTAGCCCGG - Intergenic
1005609602 6:27510977-27510999 AAAAAAAAGGAAAAGAAGCCTGG + Intergenic
1005685511 6:28249998-28250020 CTGAAAACGGAGATGTGGCCCGG + Intronic
1005731008 6:28696720-28696742 AAGAAAAAGTCAAAGAGGCCCGG + Intergenic
1005747815 6:28855304-28855326 TAGAAAAAGGACAATTGGCTGGG - Intergenic
1006021363 6:31119743-31119765 CAAAAAAAAGAAAATTAGCCAGG + Intronic
1006125659 6:31836208-31836230 TCAAAAAAGAAAAAGTGGCCGGG - Intronic
1006489849 6:34378009-34378031 CAAAAAGCGGAAAAATGGCCAGG + Intronic
1006575030 6:35038779-35038801 CAGAAAAAGGAAAAGTGGCCAGG - Intronic
1006629802 6:35422920-35422942 ATTAAAAAAGAAAAGTGGCCAGG + Intronic
1006649940 6:35543281-35543303 CACAAAAATTAAAAATGGCCTGG - Intergenic
1006731614 6:36240280-36240302 CAGAAAGAGGAGGACTGGCCAGG - Intergenic
1006760292 6:36454804-36454826 CAGAAATATGAAAATTAGCCAGG - Intronic
1007088198 6:39165575-39165597 AAGAAAAAGAAAAATTAGCCAGG - Intergenic
1007127055 6:39434266-39434288 AAGAAAAATGAAAAATGGCAGGG + Intronic
1007513137 6:42390108-42390130 CAGAGAAAGAAAAAGTGTCGGGG + Intronic
1007543850 6:42675662-42675684 AAGAAAATGGAAATGTGACCAGG + Intronic
1007823242 6:44577747-44577769 CACATTAAGGAAAAATGGCCTGG + Intergenic
1008605232 6:53133485-53133507 AAAAGAAAGGAAAAATGGCCGGG - Intronic
1008614061 6:53209160-53209182 AAAAAAAAAGAAAAGAGGCCAGG - Intergenic
1009514533 6:64598163-64598185 AAGAAAAAAGAGAAGGGGCCAGG + Intronic
1009595692 6:65732681-65732703 CACAAAAAGAAATAGTGGTCAGG + Intergenic
1010749639 6:79603791-79603813 AAGAAAAAAGAAAAGTGGTCTGG - Intergenic
1011004325 6:82626481-82626503 TAAAAGAAGCAAAAGTGGCCAGG - Intergenic
1011130961 6:84051560-84051582 TAAAAGAAGGAAAAGAGGCCAGG + Intronic
1011593716 6:88996239-88996261 TTGAAAAACGAAAACTGGCCAGG + Intergenic
1012305455 6:97651349-97651371 AAGAAAAAAAAAAAGTTGCCAGG - Intergenic
1012318208 6:97807630-97807652 AATAAAAAGGAAAATAGGCCGGG + Intergenic
1012533193 6:100263551-100263573 AAGAAAAAGGAAAAGAGGAAAGG + Intergenic
1013101149 6:106987683-106987705 AAGAAAAGAGAAACGTGGCCGGG + Intergenic
1013121818 6:107148128-107148150 TAAAAAAAAAAAAAGTGGCCGGG + Intergenic
1013135207 6:107275816-107275838 CTGAAAAGGGAAAATAGGCCAGG + Intronic
1013379084 6:109548910-109548932 CAGTCAAAGCAAAAGTGGACTGG + Intronic
1013568672 6:111396823-111396845 AAGAAATAGGAAACCTGGCCAGG - Intronic
1013758368 6:113486822-113486844 AAGAAATAAGAAATGTGGCCGGG + Intergenic
1013885028 6:114952925-114952947 AAGAAACATGAAAAGTGGCTTGG - Intergenic
1013960540 6:115893921-115893943 CAGAGGAAGGAAATGAGGCCAGG + Intergenic
1014026190 6:116648807-116648829 CAGAAAAAAAAAAATTAGCCAGG + Intronic
1014125738 6:117774991-117775013 CTGAGTATGGAAAAGTGGCCAGG - Intergenic
1014201542 6:118614546-118614568 TACAAAAAGCAAATGTGGCCGGG + Intronic
1014271387 6:119340384-119340406 CAGAAATAGGACAGGAGGCCAGG - Intronic
1014525949 6:122501921-122501943 AAAAAAAAAAAAAAGTGGCCTGG - Intronic
1015161382 6:130156041-130156063 AAGAAAAAGGAAAGGAGGCCAGG + Intronic
1015364831 6:132385805-132385827 TAAAAACAGGAAAAGAGGCCGGG + Intronic
1015528568 6:134197527-134197549 CATAAAAAGCAAAAGTAGGCCGG + Intronic
1015610012 6:135006859-135006881 TACAACAAGGAAAAGTGGCATGG + Intronic
1015645826 6:135386920-135386942 AAGAAAAAAGAAAAAAGGCCAGG - Intronic
1015727076 6:136310122-136310144 CATAAAAATAAAAACTGGCCAGG - Intergenic
1015957203 6:138611074-138611096 CAAAAAAAAAAAAAGTGGCAAGG + Intronic
1015976876 6:138799548-138799570 AAAAAAAAAGAAAAGAGGCCGGG - Intronic
1016022958 6:139255115-139255137 CATAAAAAGAAAATGAGGCCGGG - Intronic
1016316982 6:142801050-142801072 CTGCACAAGGAAAAGAGGCCAGG + Intronic
1016418926 6:143863928-143863950 CTGTAAATAGAAAAGTGGCCTGG + Intergenic
1017073277 6:150595681-150595703 TGGAAAAAGGAAATGTAGCCAGG - Intergenic
1017117913 6:150996334-150996356 CAAAAAAAGGAAAGATGACCTGG - Intronic
1017145133 6:151227868-151227890 TAAAAATACGAAAAGTGGCCAGG + Intergenic
1017398114 6:154027701-154027723 AAGAAAAAGGAAAAGTGGGAAGG - Intronic
1017813782 6:158002506-158002528 AAGAAACTGGAAAAGTAGCCAGG + Intronic
1017921698 6:158878601-158878623 AAGAAAAAGGAAACTAGGCCTGG - Intronic
1018049021 6:159991663-159991685 CACTAAAAGGAAATGTGGGCTGG - Intronic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1019398881 7:839544-839566 AAAAAAAAGGAAAATTTGCCAGG - Intronic
1019469030 7:1208243-1208265 AAAAAAAAAAAAAAGTGGCCAGG - Intergenic
1019509291 7:1409277-1409299 CAGAAACATGGAAAATGGCCAGG + Intergenic
1019740233 7:2669228-2669250 CAAAAAAAGCAAAATTAGCCGGG + Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020030805 7:4931446-4931468 AAGAAAAAGGTAAAGAGGCCAGG - Intronic
1020047717 7:5055075-5055097 AAGAAAAAGTAAAAGTGCTCGGG - Intronic
1020051141 7:5082581-5082603 AAGAAAAAAGAAAATTAGCCGGG + Intergenic
1020101906 7:5398612-5398634 TAAAAAAAAGAAAAGAGGCCGGG - Intronic
1020135237 7:5584023-5584045 CCAAAAAAAGAAAAGAGGCCAGG + Intergenic
1020557227 7:9685420-9685442 AAGAAAGGAGAAAAGTGGCCGGG - Intergenic
1020685275 7:11286093-11286115 CAGAAAAAGGAAAGGAGGAAGGG - Intergenic
1020859458 7:13472756-13472778 AAGAAAAAGAAAAATTAGCCAGG + Intergenic
1020966124 7:14870794-14870816 TAAAAAAAAGAAAATTGGCCGGG + Intronic
1021089605 7:16467733-16467755 CAGAAAAAGAAAAAGTAGTGAGG - Intronic
1021090682 7:16479027-16479049 AATTAAAAGTAAAAGTGGCCGGG - Intronic
1021290804 7:18842352-18842374 CAGAAAGAGAAAATGTGGGCTGG - Intronic
1021455559 7:20826398-20826420 CAGAAACAGGGAAAGAGGCCTGG - Intergenic
1021513330 7:21457223-21457245 AAGAAAAAGGAAATCTGGCAGGG - Intronic
1022099916 7:27163351-27163373 AAGAAAAAGGAAAAGTTGAGGGG - Exonic
1022864810 7:34406530-34406552 AAGAAAAAAAAAAAGTAGCCAGG - Intergenic
1023110431 7:36805657-36805679 CAGAAAAAAAAAAATTAGCCGGG - Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023168332 7:37365141-37365163 CACAAAGTGGAAATGTGGCCTGG - Intronic
1023364828 7:39453092-39453114 CAAAAAAAGAAAAAATGCCCAGG + Intronic
1023379103 7:39588213-39588235 TAGAAGAAGGAAAAATGGGCCGG + Intronic
1023412887 7:39904913-39904935 AAGAAAAGAAAAAAGTGGCCAGG + Intergenic
1023709321 7:42975133-42975155 GTGAATGAGGAAAAGTGGCCAGG + Intergenic
1023719288 7:43076653-43076675 CAGAAAAAGGAAAAGAGGAGGGG + Intergenic
1023773929 7:43584899-43584921 TGAAAAAAGGAAAACTGGCCGGG + Intronic
1024795538 7:53015111-53015133 CAAAATAATGAAAGGTGGCCAGG - Intergenic
1024841165 7:53589301-53589323 CATAAAAAGGCAAAGTAGACAGG - Intergenic
1024909555 7:54429462-54429484 CAGAATAAAAAAAAGTGTCCAGG + Intergenic
1025032377 7:55568373-55568395 TAGAAAAAGGAACAGTTGTCAGG - Intronic
1025252606 7:57361844-57361866 CAAAAACTGGGAAAGTGGCCAGG + Intergenic
1025828032 7:65026342-65026364 AAAAAAAAAAAAAAGTGGCCGGG + Intergenic
1025887012 7:65605489-65605511 CAGAAAAAGGCAAAGTATCCTGG - Intergenic
1025915566 7:65862776-65862798 AAAAAAAAAAAAAAGTGGCCAGG + Intergenic
1026056770 7:66991636-66991658 CAAAAAAAGAAAAATTAGCCGGG + Intronic
1026437858 7:70415547-70415569 CAGACAAAAAAAAAGTGTCCTGG + Intronic
1026642749 7:72141302-72141324 AAGAAAAAGAAAAAAAGGCCAGG + Intronic
1026643728 7:72149960-72149982 CAGAAAAAAAAAAATTAGCCAGG + Intronic
1026721326 7:72833408-72833430 CAAAAAAAGAAAAATTAGCCGGG - Intergenic
1026742377 7:72987082-72987104 AAGAAAAAGGAAAGGAGGCTGGG + Intergenic
1026763134 7:73141589-73141611 CAGAAAAAGGAAATTGGGCCAGG + Intergenic
1026802224 7:73407513-73407535 AAGAAAAAGGAAAGGAGGCCGGG + Intergenic
1026820662 7:73545834-73545856 TACAGAAAGGAAAACTGGCCGGG + Intronic
1026830870 7:73609228-73609250 AAAAAAAAAAAAAAGTGGCCAGG - Intronic
1027027346 7:74863203-74863225 AAGAAAAAAGACAAGAGGCCAGG + Intergenic
1027028499 7:74871819-74871841 AAGAAAAAGGAAAGGAGGCTGGG + Intergenic
1027039599 7:74951371-74951393 CAGAAAAAGGAAATTGGGCCAGG + Intergenic
1027044649 7:74983305-74983327 AAGAAGAAAGAAATGTGGCCGGG - Intronic
1027060407 7:75080898-75080920 AAGAAAAAAGACAAGAGGCCAGG - Intergenic
1027084043 7:75251013-75251035 CAGAAAAAGGAAATTGGGCCAGG - Intergenic
1027101358 7:75377995-75378017 AAGAAAAAGGAAAGGAGGCTGGG - Intergenic
1027236262 7:76299804-76299826 AAGAAAAAGAAACACTGGCCAGG - Intergenic
1027256236 7:76432477-76432499 TATAAAAAAGAAAAGAGGCCAGG - Intronic
1027395636 7:77750972-77750994 CAGAATAAGGAAAGGAGCCCTGG - Intronic
1027512549 7:79101426-79101448 TAGAAAAAGGAAAATGGGGCCGG + Intronic
1027719240 7:81718222-81718244 CAGAAAAATGAAACTTGGTCTGG - Intronic
1027966122 7:85010886-85010908 CAGAGAATGGAAAAGTGGCTGGG + Intronic
1027972634 7:85105024-85105046 AAGGAAAAAGAAAAGTGGGCAGG - Intronic
1028060790 7:86312337-86312359 CAGGAAAAAGAAAATTGGCAGGG - Intergenic
1028072127 7:86463577-86463599 AAAAAAAAGGAAAATTGGCAAGG + Intergenic
1028108529 7:86909936-86909958 CAGTAAAAGAAATAGTGGCAGGG - Exonic
1028143252 7:87294232-87294254 CAAAAAAATCAAAATTGGCCGGG + Intergenic
1028356983 7:89922337-89922359 CAAAAAAAAGAAAATTAGCCAGG + Intergenic
1028397688 7:90390085-90390107 TAGAAAAAAGAAAACTGGCTGGG - Exonic
1028518280 7:91701274-91701296 CAAAAAAGACAAAAGTGGCCAGG + Intronic
1028541902 7:91951618-91951640 CAGAAAAGAGAAAATTGGCTGGG - Intronic
1028865363 7:95704935-95704957 AAGAAAAAGAAAAAGTGTGCAGG - Intergenic
1029304601 7:99609727-99609749 AAAAAAAAGAACAAGTGGCCGGG - Intergenic
1029391616 7:100278779-100278801 CAGAAAAAGGAAATTGGGCCGGG - Intergenic
1029425590 7:100492238-100492260 CAAAAAAAAAAAAAGGGGCCAGG + Intronic
1029460298 7:100690484-100690506 TTAAAAAAGAAAAAGTGGCCAGG + Intergenic
1029558096 7:101284459-101284481 AAAAAAAAAGAAAAGAGGCCAGG + Intergenic
1029567169 7:101346732-101346754 CTTAAAAAAAAAAAGTGGCCAGG + Intergenic
1030128762 7:106179257-106179279 CAAAAAATGGAAAATTAGCCAGG - Intergenic
1030540240 7:110821614-110821636 TAGAAAAAGGAAAGGTAGGCTGG + Intronic
1030613513 7:111714094-111714116 CAGAAAAATTGAAACTGGCCGGG + Intergenic
1031082575 7:117272766-117272788 CTGAAAAAGAGAGAGTGGCCGGG - Intergenic
1031315766 7:120256100-120256122 CAGAAAACTTACAAGTGGCCAGG - Intergenic
1031730345 7:125292626-125292648 TAGAAAAAGGAAAAAAGGGCTGG - Intergenic
1031769362 7:125823721-125823743 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1031771650 7:125851558-125851580 TCGAAAAAGAAAAAGTGGGCAGG + Intergenic
1031855403 7:126916434-126916456 CAGAAAAAGGCAAAGTATCTTGG + Intronic
1032235410 7:130117867-130117889 AAAAAAAAGAAAAAGAGGCCGGG + Intronic
1032258937 7:130319077-130319099 CACAAGAAGGAAAACAGGCCAGG - Intronic
1032595127 7:133232364-133232386 CAGGAAAAGGCAAAGGGGCAGGG - Intergenic
1032625688 7:133589381-133589403 CAGTAAAAGCAAAAATGGACAGG - Intronic
1032846939 7:135759132-135759154 CAGAAAAAAGAAAAGGGGATGGG - Intergenic
1033007496 7:137583115-137583137 CAGAAAAAAGAAAATTGGATTGG + Intronic
1033075053 7:138241846-138241868 TAGAAGAATGAAAACTGGCCAGG + Intergenic
1033334150 7:140438070-140438092 CAAAAAAGGGAAAAAAGGCCGGG + Intergenic
1033602224 7:142896688-142896710 AAGAACAAGGAAAGGTGGCAGGG + Intergenic
1033693959 7:143767772-143767794 CAAAAACAGGAAAATTAGCCAGG - Intergenic
1033828255 7:145218818-145218840 CAGAAATAAGAAACGTGGCCGGG - Intergenic
1034273315 7:149813579-149813601 CAGAAAAAGGAAAGCTGTGCAGG - Intergenic
1034350419 7:150411527-150411549 CAGAAAAGGCAAAACTGACCAGG + Intronic
1034482534 7:151333619-151333641 AAGAAAAAAGAAAAGAGGCCGGG + Intergenic
1034603606 7:152288236-152288258 AAAAAAAAAAAAAAGTGGCCAGG + Intronic
1035204655 7:157287378-157287400 GACAAAAAGGAGAACTGGCCGGG - Intergenic
1035724337 8:1815198-1815220 CAGAAGAAGGGAAAGTGGAGGGG - Intergenic
1035755825 8:2031960-2031982 TAAAAATAGGAAAATTGGCCGGG + Intergenic
1035810547 8:2487477-2487499 AAGAAAAAGAAAAAGAGGCCGGG + Intergenic
1035847386 8:2879947-2879969 CAAAAAACAGAAAAGTGGCTGGG - Intergenic
1035959821 8:4124869-4124891 CAGAAAAAGGAAAAGCGGAGGGG + Intronic
1036000090 8:4592680-4592702 AAAAATAAGGAAAAGAGGCCGGG - Intronic
1036405428 8:8450634-8450656 CAGAAAAAAAAAAAGTGTCGTGG + Intergenic
1036447653 8:8836537-8836559 CAGAAAAAACAAAATTGGCTGGG - Intronic
1036790224 8:11712559-11712581 AAGACAAAGAAAAAGAGGCCAGG + Intronic
1037485605 8:19343909-19343931 CAGAGAAAGGCAGAGAGGCCTGG + Intronic
1037486313 8:19350643-19350665 CAGAAAATACAAAAGTGGGCTGG - Intronic
1037704798 8:21310012-21310034 CAGACAAAGGAATCTTGGCCGGG - Intergenic
1037856046 8:22371111-22371133 CTGCACAAGGAAAAGAGGCCGGG + Intronic
1037870946 8:22495852-22495874 CACAAAAATGAAAATAGGCCAGG - Intronic
1038051965 8:23822330-23822352 TAGAAAATTCAAAAGTGGCCAGG - Intergenic
1038166094 8:25086383-25086405 AAAAAATAGGAAAAGTAGCCTGG + Intergenic
1038616217 8:29097874-29097896 AAAAATAAGGTAAAGTGGCCAGG + Intronic
1038714694 8:29981188-29981210 CAGAAAATGGAACCCTGGCCAGG - Intergenic
1038784067 8:30594560-30594582 AAAAAAAAAAAAAAGTGGCCAGG + Intronic
1039045046 8:33442108-33442130 CAGAAAAACAAAAATTAGCCGGG - Intronic
1039195654 8:35028504-35028526 CAGAAAGAGGAAAAGGAGCAGGG + Intergenic
1039515098 8:38126040-38126062 CAGAAATAGAAAAATTAGCCAGG + Intronic
1039562746 8:38526150-38526172 TAAAAAAAGGAAAAGAGGCCGGG - Intronic
1039747341 8:40440921-40440943 TAGAAAAATAAAAAGTGGCTTGG - Intergenic
1039973956 8:42344146-42344168 AAAAAAAAAAAAAAGTGGCCGGG + Intronic
1039989193 8:42473591-42473613 CAGAAGCAGGAACAGTGGCATGG - Intronic
1040023070 8:42757736-42757758 AAAAAAAAAAAAAAGTGGCCCGG + Intronic
1040069322 8:43177395-43177417 CAAAAAAAAGAAAATTAGCCGGG + Intronic
1040433060 8:47362946-47362968 CAGAAAAAAGAACACTGGCTGGG - Intronic
1040485154 8:47864175-47864197 CAGGAAATGGAAATGTGACCAGG + Intronic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1040511033 8:48095013-48095035 AAAAAAAAAGAAAACTGGCCGGG - Intergenic
1040638416 8:49302867-49302889 CAGAGAAAGGAGACATGGCCTGG + Intergenic
1041347292 8:56912731-56912753 CAGAGAAAGTAGAAGTGCCCAGG - Intergenic
1041902634 8:62998568-62998590 TAGAAAAATGAAAAGCAGCCAGG - Intronic
1042049949 8:64692655-64692677 CAGAAGAGGGAAAAGTCTCCTGG + Intronic
1042252293 8:66768866-66768888 CAGAAATAGTACAAGTGGCTGGG - Intronic
1042295285 8:67211049-67211071 AAAAAAAAACAAAAGTGGCCGGG + Intronic
1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG + Intergenic
1043374431 8:79632459-79632481 AAGAGAAAGGAAAAGTGGAGAGG + Intronic
1043483010 8:80671691-80671713 CAGGAAAAGGAAATGGGGCTTGG - Intronic
1043881842 8:85552871-85552893 CAGTAAAAGGCAACTTGGCCTGG + Intergenic
1044012939 8:87017120-87017142 CAGAAAAGGTAAAATTGGTCTGG + Intronic
1044555462 8:93557689-93557711 AAAAAAAAAGAAAAGAGGCCAGG + Intergenic
1044653506 8:94523788-94523810 CAAAAAAAGAAAAACTAGCCAGG - Intronic
1044978625 8:97692665-97692687 TAAAAAAAGGAAAATTGGCTGGG - Intronic
1045075377 8:98560735-98560757 CAGAAAAACAAAATTTGGCCAGG + Intronic
1045218111 8:100168980-100169002 AAAAAAAATGAAAAGAGGCCGGG - Intronic
1045445717 8:102261405-102261427 CAAAAAAAGGACAAGCCGCCAGG + Intronic
1045477041 8:102561936-102561958 AAAAAAAAAGAAAAGAGGCCGGG - Intergenic
1045889210 8:107134668-107134690 GAGAAAAAGAAAAATTAGCCAGG - Intergenic
1046057683 8:109098118-109098140 AAGAAAAAAGAAAAGAGGCAGGG - Intronic
1046263788 8:111805348-111805370 CAAAAGAAGTAAAAATGGCCTGG + Intergenic
1046655821 8:116893009-116893031 TAAAAAAAGGAAAAAAGGCCAGG - Intergenic
1047079848 8:121447376-121447398 CAGAAAATGCAAAACTGACCAGG - Intergenic
1047280419 8:123440449-123440471 CAGAAAGACGAAAAGCAGCCAGG - Intronic
1047807766 8:128377542-128377564 CAGAAAAAGGAAAAGAGGAGGGG - Intergenic
1048013526 8:130477734-130477756 AAGAAAAAAGAAATGTGGCCGGG - Intergenic
1048077744 8:131091649-131091671 AAGAAAAAAAAAAATTGGCCGGG - Intergenic
1048410196 8:134164388-134164410 CAGAAACTGTAAAAGGGGCCAGG - Intergenic
1048891684 8:138954008-138954030 TAGATAAAGGAAATGAGGCCTGG + Intergenic
1049377382 8:142295716-142295738 CAGTAAAGAGAAACGTGGCCTGG + Intronic
1049384502 8:142334677-142334699 AAGAAACCTGAAAAGTGGCCCGG + Intronic
1049971071 9:822641-822663 CAGAAAATGTAAAACCGGCCAGG + Intergenic
1049972996 9:837859-837881 CACCAAAAGCAAAAGTGGGCCGG - Intergenic
1049973116 9:838692-838714 AAAAAAAAAAAAAAGTGGCCAGG - Intergenic
1050102796 9:2136133-2136155 AATAAAAAGTAAAAGTTGCCAGG - Intronic
1050372121 9:4932797-4932819 AGGAAAGAGGGAAAGTGGCCTGG - Intergenic
1050593029 9:7179662-7179684 ATCAAAAAGAAAAAGTGGCCGGG - Intergenic
1050861773 9:10443088-10443110 CAGAAAAAAAAAAAAAGGCCTGG + Intronic
1051359796 9:16271851-16271873 CAGAAATAGGAAAAGTGAATGGG - Intronic
1051474493 9:17490093-17490115 TAGAAATAGGAAAAGTAGGCTGG + Intronic
1051593537 9:18800397-18800419 AAAAAAAAGGAAAAATGGACAGG + Intronic
1051633240 9:19159196-19159218 CAAAAAATGAAAAATTGGCCAGG - Intergenic
1051707671 9:19897926-19897948 CAGCAAAAGGAAAAGTGGGATGG - Intergenic
1051737416 9:20215629-20215651 AGAAAAAAGGAAAAGTGGTCTGG - Intergenic
1052044465 9:23778222-23778244 AGGACAAAGGAAAAGTGGCAAGG + Intronic
1052291532 9:26846980-26847002 AAGAAGAAGAAAAATTGGCCGGG - Intronic
1052560166 9:30075328-30075350 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
1052821945 9:33144532-33144554 CAGAAAAAGAGAAAATGGGCTGG - Intronic
1052870451 9:33501155-33501177 TATAAAAAGGAGTAGTGGCCGGG + Intergenic
1053213753 9:36254042-36254064 AAGAAAAAGAAAAATTAGCCAGG + Intronic
1053234450 9:36440245-36440267 CAAAAAAAGAAAAAGTGGCAGGG + Intronic
1053247939 9:36550519-36550541 CAGAAAAATGAAAATTAGCCAGG + Intergenic
1053821289 9:41969776-41969798 CAGAAAAAAAAAAATTAGCCAGG - Intronic
1054337134 9:63817337-63817359 CACAGAAAGGAGAACTGGCCTGG + Intergenic
1055339844 9:75269580-75269602 CACAAAAAGGAGAAGTGACTGGG - Intergenic
1055571582 9:77622731-77622753 CAAAAAAAAGAAAAATAGCCAGG + Intronic
1055843325 9:80531706-80531728 CACAGAAAGAAAAAGTGGTCTGG - Intergenic
1055916387 9:81405237-81405259 CAGAAAAAAGAAAATTTGGCTGG - Intergenic
1055927669 9:81527317-81527339 TATCTAAAGGAAAAGTGGCCGGG + Intergenic
1056409091 9:86307696-86307718 TAGAAAAAGATAAGGTGGCCAGG + Intronic
1056425601 9:86472639-86472661 TAAAAAAAAGAAAAGTGGCTGGG - Intergenic
1056637087 9:88340095-88340117 CAAAAAAAAAAAAAGTGGCCTGG + Intergenic
1057330028 9:94105671-94105693 AAAAAAAAAAAAAAGTGGCCAGG + Intronic
1057332115 9:94125184-94125206 AAGAAAAAGAAAAGGTGACCAGG + Intergenic
1057600805 9:96455466-96455488 AAAAAAAAAAAAAAGTGGCCAGG + Intronic
1057696609 9:97327262-97327284 ATAAAAAAGGAAAAGTGGGCAGG - Intronic
1057777467 9:98022483-98022505 AAGAAAAAGAAAAAGGGGCTGGG - Intergenic
1057826231 9:98374219-98374241 CACAAAATAGACAAGTGGCCTGG - Intronic
1058422134 9:104842311-104842333 CAACAAAAGGCAAAATGGCCTGG - Intronic
1058679973 9:107432191-107432213 CAAAAAAAAAAAAAGAGGCCGGG + Intergenic
1058724661 9:107790602-107790624 CAGAAATAGAGAAAGTGGCTGGG - Intergenic
1059129108 9:111725673-111725695 TATAAAAAGGCAAAGAGGCCAGG + Intronic
1059193999 9:112353539-112353561 GAAAAAAAGGAAAAGAGGCCAGG - Intergenic
1059238935 9:112786414-112786436 CAGAAAAGAGACAAGAGGCCAGG - Intronic
1059239607 9:112792720-112792742 TAGAAAAAGGAAAATGGCCCAGG - Intronic
1059949127 9:119443441-119443463 AAGAAAAAGAGAAAGGGGCCAGG + Intergenic
1060347533 9:122829648-122829670 TAGAAAAAGGACATGGGGCCGGG + Intergenic
1060383911 9:123204761-123204783 CAGAAAAAAAAAAATTAGCCAGG + Intronic
1060486254 9:124048829-124048851 TAGAAAAACTGAAAGTGGCCAGG - Intergenic
1060504832 9:124189917-124189939 CAGAAAAAAAAAAAAAGGCCAGG + Intergenic
1060643419 9:125258160-125258182 AAGAAAAAGAAAAATTAGCCAGG + Intergenic
1060751285 9:126171090-126171112 AAGAAAAAAAAAAAGTAGCCAGG - Intergenic
1060827969 9:126697151-126697173 CAGAAAGAGAAAAGGAGGCCAGG + Exonic
1060947432 9:127578364-127578386 AAAAAAAAAAAAAAGTGGCCAGG + Intronic
1060997262 9:127882078-127882100 CAGAAAAAGAAAAAATTGCATGG + Intergenic
1061026523 9:128053276-128053298 AAAAAAAAAAAAAAGTGGCCAGG + Intergenic
1061065617 9:128275879-128275901 AAGAAAAAGGTAAAGTGCACCGG - Exonic
1061072492 9:128319912-128319934 CAAAAAAAAAAAAAGTGGCCAGG - Intronic
1061097323 9:128466163-128466185 AAGAAAAACGAAAAGAGGACTGG + Intronic
1061343124 9:129999435-129999457 AAGAAAAACAAAAAGTAGCCAGG + Intronic
1061443445 9:130623030-130623052 AAGAAAAAAGAAAAAAGGCCTGG - Intronic
1061546397 9:131307254-131307276 AAAAAAAAGGAAAAAGGGCCGGG + Intronic
1061834443 9:133319522-133319544 CAGTAAGAGGGAAAGGGGCCTGG + Intergenic
1061942330 9:133890454-133890476 CAGAAATGGGAAAAGTGCCGAGG + Intronic
1062226384 9:135454711-135454733 CAGAAAATGGAAAAGTGGCAAGG - Intergenic
1062283486 9:135762450-135762472 AAGAAAAAGAAAAAAGGGCCAGG + Intronic
1062411334 9:136426439-136426461 AAGAAAAAAAAAACGTGGCCAGG - Intergenic
1062570362 9:137182215-137182237 AAGAAAAAGAAAAAAGGGCCGGG + Intronic
1185574958 X:1163956-1163978 CAGAACAGAGAAAAGAGGCCAGG + Intergenic
1185607871 X:1377536-1377558 CAGAAAAAAGGAATTTGGCCGGG - Intronic
1185608971 X:1383010-1383032 CTGAAAAAAGAAAAAAGGCCAGG - Intergenic
1185767139 X:2734600-2734622 AAGAAAAAAGAAAAAGGGCCAGG - Intronic
1186038339 X:5448601-5448623 AAGAAAAAGGAAAAAAGGCCGGG - Intergenic
1186111000 X:6256096-6256118 AAGAAAAAAGAAAATTAGCCGGG - Intergenic
1186363457 X:8867377-8867399 AAAAAAAAAAAAAAGTGGCCTGG - Intergenic
1186404052 X:9286197-9286219 CAGAAGCAGGAAAGGTGCCCAGG - Intergenic
1186430133 X:9498029-9498051 CAGGAAAGGGAAAATAGGCCTGG - Intronic
1186465680 X:9782872-9782894 AAGAAAAAGAAACAGTGGCCAGG + Intronic
1186512515 X:10140525-10140547 CTGAAAAAGCAAAGGTGGTCGGG - Intronic
1186684752 X:11913884-11913906 CAGAAACAGGAAACTTGACCAGG - Intergenic
1186754675 X:12658055-12658077 CATAGAAAGGAAAAGTGGCTCGG + Intronic
1187143326 X:16615176-16615198 AAGAAAAAAAAAAAGTAGCCAGG + Intronic
1187148160 X:16656568-16656590 CACAAAAAGAAAAATTAGCCGGG - Intronic
1187949178 X:24455199-24455221 GAGAAAAAGAAAAACAGGCCAGG - Intergenic
1188010318 X:25048385-25048407 CAGCAAAAGGAACAGCTGCCTGG + Intergenic
1188231392 X:27668655-27668677 CAGAAAAAGCAATTCTGGCCAGG + Intronic
1189054800 X:37687426-37687448 AAGAAAAAAGAAAATTAGCCAGG - Intronic
1189236719 X:39492646-39492668 CAGGAAAAGGAAAACTGATCTGG - Intergenic
1189426624 X:40907607-40907629 CAAAAAAAAAAAAATTGGCCAGG - Intergenic
1189468015 X:41292429-41292451 CAGAAAATAGAAAAGAGGGCTGG + Intergenic
1189483554 X:41411639-41411661 CAAAAAAACAAAAAGTAGCCTGG + Intergenic
1189489166 X:41456315-41456337 CAGGAAAAGGAGGAGAGGCCAGG + Intronic
1189507183 X:41623705-41623727 CAAAAAAAAGAAAAGGGGCCAGG - Intronic
1190078855 X:47339102-47339124 TAGAGAAATGAAAATTGGCCAGG - Intergenic
1190315914 X:49150868-49150890 AAAAAGAAGAAAAAGTGGCCGGG - Intergenic
1190391160 X:49933156-49933178 CAGATAGAGGAAAAGGGGCTGGG - Intronic
1190419764 X:50217565-50217587 CAGTGAAGGGAAAAATGGCCGGG - Intronic
1190549996 X:51570276-51570298 AAGAAAAAGGGGAAGGGGCCAGG - Intergenic
1190754329 X:53388700-53388722 TAGAAAATCGAAAATTGGCCAGG + Intronic
1190756052 X:53403026-53403048 CAAAAAAAGAAAAATTAGCCGGG + Intronic
1191665942 X:63702765-63702787 CAGAAAATGCAGAAGTAGCCTGG + Intronic
1192325836 X:70131269-70131291 GAAAAAAAGGAATAATGGCCGGG - Intergenic
1192465248 X:71350395-71350417 CAGAATAAAGAAAAGTGAGCCGG - Intergenic
1192468194 X:71373159-71373181 AAAAAAAAAAAAAAGTGGCCAGG - Intronic
1192473041 X:71416087-71416109 CAGAATAAAGAAAAGTGAGCCGG + Intronic
1193117488 X:77789494-77789516 AAAAAAAAGAAAAAGAGGCCAGG + Intergenic
1193356905 X:80530246-80530268 CAAAAATAGGAAAATTAGCCTGG + Intergenic
1194220764 X:91187447-91187469 CAGTCAAAGCAAAAGTGGACAGG + Intergenic
1195007347 X:100699069-100699091 TAGAAAAATGAAAACAGGCCAGG + Intronic
1195010925 X:100731744-100731766 CTGGAGAAAGAAAAGTGGCCGGG + Intronic
1195062500 X:101209889-101209911 AAGAAAAGGAAATAGTGGCCAGG - Intergenic
1195969705 X:110459971-110459993 AAGACAAAGGAAAAGAGGCTTGG - Intergenic
1195990349 X:110676370-110676392 CAAACAAACGCAAAGTGGCCGGG + Intronic
1196235276 X:113272950-113272972 AATAAAAAGCAACAGTGGCCGGG + Intergenic
1196573593 X:117292165-117292187 CAAAAAAAGGAAAACTGGCTGGG + Intergenic
1196767875 X:119265462-119265484 CAGAAAATTGAAAATTGGCTAGG - Intergenic
1196835533 X:119810467-119810489 CAGTCAAAGCAAAAGTGGTCTGG + Intergenic
1196836746 X:119820618-119820640 CAAAAAAAAAAAAATTGGCCAGG - Intergenic
1197193350 X:123673406-123673428 CATAAAAATGAATTGTGGCCAGG + Intronic
1197686084 X:129441140-129441162 AAGAATTAGGAAAAGAGGCCGGG + Intergenic
1197928559 X:131672331-131672353 CAGAAAATGGCAATGTGGCAAGG - Intergenic
1198132213 X:133707210-133707232 CAGAAGGAGGAAAAGGGGCATGG + Intronic
1198221746 X:134608967-134608989 TAAAAAAAGAAAAAGAGGCCGGG - Intronic
1198244188 X:134813630-134813652 AATAAAAAGGAAAAGATGCCGGG + Intronic
1198469154 X:136929939-136929961 AAGAAAAAAGAAAAGAGGCCGGG - Intergenic
1198589599 X:138162607-138162629 AAGAAAAAGGAAAAATGAACTGG + Intergenic
1198631182 X:138640447-138640469 CAGAAGAAGCAATAGTGGCCTGG + Intronic
1198716955 X:139567759-139567781 CAGAAAAAGAAAAAGAGGAAGGG + Intergenic
1199314489 X:146361470-146361492 CAAAAAAATGAAAATTGGCTTGG - Intergenic
1199412856 X:147545059-147545081 CAGAAAGATGAAAAGGGACCTGG + Intergenic
1199815661 X:151394815-151394837 CAGAAAACAGAAGAGGGGCCTGG + Intergenic
1199819301 X:151428833-151428855 CAGAAGCAGGAAGAGTAGCCAGG - Intergenic
1200156404 X:153978561-153978583 AAAAAAAAAAAAAAGTGGCCAGG - Intronic
1200747539 Y:6915780-6915802 CAGAAAACTGGAAAGGGGCCAGG - Intronic
1200773290 Y:7147177-7147199 CAGAGAAAGAAAATGAGGCCTGG - Intergenic
1201424069 Y:13830370-13830392 CAGAAAAAGGGAAAGAGGAGGGG - Intergenic
1201706728 Y:16946019-16946041 AAGAAAAAGAAAAATTAGCCAGG + Intergenic
1201719122 Y:17077862-17077884 TAGAAAAAAAAAAAGTGGGCCGG - Intergenic