ID: 1006578674

View in Genome Browser
Species Human (GRCh38)
Location 6:35064099-35064121
Sequence GGCTCTCGAAAGCCACGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006578663_1006578674 16 Left 1006578663 6:35064060-35064082 CCCTGACCAGGCGGGAGAGATGG 0: 1
1: 0
2: 1
3: 16
4: 165
Right 1006578674 6:35064099-35064121 GGCTCTCGAAAGCCACGTGTGGG No data
1006578665_1006578674 15 Left 1006578665 6:35064061-35064083 CCTGACCAGGCGGGAGAGATGGC 0: 1
1: 0
2: 1
3: 8
4: 122
Right 1006578674 6:35064099-35064121 GGCTCTCGAAAGCCACGTGTGGG No data
1006578668_1006578674 10 Left 1006578668 6:35064066-35064088 CCAGGCGGGAGAGATGGCTGGGC 0: 1
1: 0
2: 1
3: 23
4: 297
Right 1006578674 6:35064099-35064121 GGCTCTCGAAAGCCACGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006578674 Original CRISPR GGCTCTCGAAAGCCACGTGT GGG Intronic
No off target data available for this crispr