ID: 1006582130

View in Genome Browser
Species Human (GRCh38)
Location 6:35083255-35083277
Sequence CTGTGGGACTGGCCAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 5, 3: 31, 4: 275}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006582120_1006582130 16 Left 1006582120 6:35083216-35083238 CCAAGATGCGGGTAGGGTGCCTG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1006582130 6:35083255-35083277 CTGTGGGACTGGCCAGCAGAAGG 0: 1
1: 0
2: 5
3: 31
4: 275
1006582118_1006582130 22 Left 1006582118 6:35083210-35083232 CCTGTGCCAAGATGCGGGTAGGG 0: 1
1: 0
2: 0
3: 3
4: 97
Right 1006582130 6:35083255-35083277 CTGTGGGACTGGCCAGCAGAAGG 0: 1
1: 0
2: 5
3: 31
4: 275
1006582126_1006582130 -3 Left 1006582126 6:35083235-35083257 CCTGTGTGGGCTGGAGGGCGCTG 0: 1
1: 0
2: 3
3: 44
4: 280
Right 1006582130 6:35083255-35083277 CTGTGGGACTGGCCAGCAGAAGG 0: 1
1: 0
2: 5
3: 31
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006582130 Original CRISPR CTGTGGGACTGGCCAGCAGA AGG Intronic
900517563 1:3090239-3090261 GCCTGGGACTGCCCAGCAGACGG + Intronic
900703198 1:4060678-4060700 CTCTGGGCTTGGCCTGCAGAAGG + Intergenic
901809627 1:11760198-11760220 CACTGCGCCTGGCCAGCAGAAGG + Intergenic
901819623 1:11819297-11819319 CAGTGGGACTGGGCTGGAGAAGG + Intronic
901926342 1:12568498-12568520 ATGTGAGACGGGGCAGCAGAGGG + Intronic
904402308 1:30264842-30264864 CTATGGGATGGGCCAGCATACGG - Intergenic
904615640 1:31748143-31748165 TTGTGGGGCTGGCCAGCAGATGG - Intronic
905099732 1:35509109-35509131 CTGTGGCACAGGCAAGAAGAAGG + Intronic
905275035 1:36812078-36812100 ATGTGAGAGAGGCCAGCAGATGG + Intronic
905994838 1:42372867-42372889 ATATGGGACTGGACAGTAGAAGG - Intergenic
906247572 1:44287879-44287901 CAGGGGGACTGGCCAGCAAAAGG + Intronic
906665887 1:47621758-47621780 GTGTGGAGCTGGCCTGCAGACGG + Intergenic
907255493 1:53175610-53175632 CTGCAGGACAGGCCAGCAGCTGG - Intergenic
907268360 1:53276276-53276298 CTGGGGACCTGCCCAGCAGAGGG + Intronic
909190399 1:72542464-72542486 CTGTGGGACATGGGAGCAGAGGG - Intergenic
910291163 1:85601844-85601866 CAGTGTGTCTGGCCAGCAGCTGG - Intergenic
910609880 1:89129311-89129333 CTGAGGGACTGGACACCACATGG - Intronic
912391242 1:109304619-109304641 CCGTGGTACTGCCCAGCAGGAGG + Intronic
912391506 1:109306378-109306400 CCGTGGTACTGCCCAGCAGGAGG + Intronic
915420931 1:155780954-155780976 CTGTGGGTTTGGGCAGCACAGGG + Intronic
915817655 1:158986614-158986636 CTCTGAGAGAGGCCAGCAGATGG + Intergenic
915894256 1:159799137-159799159 CTCTGGGTCTGGCCTACAGAGGG - Intergenic
916075457 1:161197792-161197814 CGGTGGGTCTGGCTAGGAGAAGG + Intronic
918301902 1:183212316-183212338 CTCTGTGAGTGGTCAGCAGAAGG - Intronic
919408236 1:197210513-197210535 CTGTGGGACAGGTCCACAGATGG - Intergenic
920337699 1:205256346-205256368 TTCTGTGAGTGGCCAGCAGAGGG - Intronic
922799723 1:228359736-228359758 CTGCGGGGCTGGCCAGCACCTGG - Intronic
923101396 1:230820629-230820651 CTATGGCACAGGCCAGGAGAAGG - Intergenic
1063126055 10:3137575-3137597 CTGGGGGAGTGTCCACCAGACGG - Intronic
1067049245 10:43002594-43002616 CTGTGGGCCTGGAGGGCAGATGG + Intergenic
1067315140 10:45154411-45154433 ATGAGGGATTGGCCAGCACAAGG - Intergenic
1067545159 10:47187682-47187704 CTGTGGGACTGCCCTGCAGCGGG - Intergenic
1068117794 10:52752994-52753016 CTGTGGGCTTGGACAGGAGAAGG + Intergenic
1069680046 10:70277797-70277819 CTGTGGGACAAGTCAGCAGAAGG - Intronic
1069908201 10:71744538-71744560 CAGAGGGTTTGGCCAGCAGATGG - Intronic
1069910009 10:71753170-71753192 CTGCGTGTCTGTCCAGCAGATGG + Intronic
1070071777 10:73096853-73096875 CGGCGCGACTGGGCAGCAGAGGG + Exonic
1070165251 10:73892730-73892752 CTGTGCGAATGTACAGCAGAGGG - Intergenic
1071570875 10:86696184-86696206 CTGAGAGACTGCGCAGCAGAGGG - Intronic
1073419126 10:103409850-103409872 CTGTGATACTGGACAGCAAATGG - Intronic
1073764664 10:106668849-106668871 TTGGGGGACTGTCCAGGAGAGGG + Intronic
1074051619 10:109885996-109886018 CTGAGGGACTGGCCAGAGGTGGG + Intronic
1075951418 10:126481006-126481028 CAGTGGGACTGCAGAGCAGAGGG - Intronic
1076868556 10:133181514-133181536 CTGTGGGGATGGCCAGCGGCCGG + Intronic
1077217703 11:1401987-1402009 CTGGGGGACTGGCCAGCAGGAGG - Intronic
1077225301 11:1436859-1436881 CAGTGGGAGTGGCCAAGAGAGGG + Intronic
1077237483 11:1488643-1488665 CAGTGGGTCTGGTCAGCACACGG + Intronic
1078357973 11:10647031-10647053 CTGAGGGGCTGGCAGGCAGAAGG + Intronic
1078441453 11:11371976-11371998 CTGTGGGTCTGGCTAGCACCTGG + Intronic
1079545131 11:21624684-21624706 CTGTGGCACTGGACATGAGATGG + Intergenic
1082239423 11:49855277-49855299 CTTTTGGAGTGGGCAGCAGAGGG + Intergenic
1082848379 11:57744216-57744238 GTGGTGGACTGGACAGCAGAGGG - Exonic
1084026304 11:66452251-66452273 CTGGGGGACAGGGAAGCAGAGGG + Intronic
1084309714 11:68309838-68309860 GTGGGGGCCTGGCCAGCAGGTGG - Intergenic
1084696781 11:70760652-70760674 CTGTGGGAGTGTGCAGCACAGGG + Intronic
1085325156 11:75601031-75601053 CTGGGGCTCTGGGCAGCAGAGGG + Intronic
1088109340 11:106244491-106244513 CATTGGGACTGGACAGAAGAAGG + Intergenic
1088869840 11:113881161-113881183 CTGTGAGACTTGCCAACTGATGG - Intergenic
1089907912 11:122064205-122064227 GTGTGGGAGTGGACATCAGAAGG + Intergenic
1091043663 11:132306070-132306092 CTGTGCCACTGCCCAGCAGTAGG - Intronic
1091935394 12:4430750-4430772 CTGTGGGATGTGGCAGCAGAGGG + Intronic
1093935262 12:24993957-24993979 CAGTGGGAGGGCCCAGCAGATGG - Exonic
1094010699 12:25806450-25806472 CTGGGGGACTGACCTGCAAAGGG + Intergenic
1096154507 12:49334494-49334516 CTGTGGGACTCTCTAGAAGAGGG - Intronic
1097174603 12:57135622-57135644 CCGAGGGCCTGGCCAGCACAAGG - Intronic
1097188313 12:57207647-57207669 CAGTGGGAATGGTCAGCAGCTGG + Intronic
1097222447 12:57459251-57459273 GTGTGAGAACGGCCAGCAGAGGG + Intronic
1099534046 12:83823885-83823907 CTGTGGCCCTTTCCAGCAGAGGG - Intergenic
1100998448 12:100329695-100329717 CTGTGGGTCAGGCCAGAACATGG + Intronic
1103508197 12:121455305-121455327 CTCTGGGGCAGCCCAGCAGAAGG + Intronic
1104475101 12:129064561-129064583 CTGGAGGACTGACCAGCACAGGG + Intergenic
1104675676 12:130710344-130710366 CTGATGGAGTGCCCAGCAGAGGG - Intronic
1104859445 12:131916864-131916886 ATGTGTGTCTGGCCTGCAGAGGG + Intronic
1106461847 13:29977399-29977421 CTCTGGGACCAGCCAGTAGATGG + Intergenic
1109886460 13:68552063-68552085 CAGTGTGACTGGCCAGAGGATGG + Intergenic
1110328999 13:74249875-74249897 CTGGGGGACAGGGCAGCAGGTGG + Intergenic
1110874483 13:80491276-80491298 CTATGGGACTAGCCAGCAAATGG - Intergenic
1112520315 13:100089079-100089101 CTGTGTGAGAGGTCAGCAGAGGG + Exonic
1113455718 13:110447267-110447289 GTGTCGGGCTGGCAAGCAGAGGG - Intronic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1113765922 13:112881226-112881248 CTGTGGGTCTGACCAGCAAGGGG - Intronic
1115304874 14:31923636-31923658 ATGTGTGACTAGCCAGCAGCAGG + Intergenic
1117111085 14:52455410-52455432 CTGTGTGTCTGGCAAGCAGCAGG + Exonic
1118752178 14:68815511-68815533 CTGTGATACTGGCCAGGAAAGGG - Intergenic
1119855853 14:77900226-77900248 CTGTGGAAGTGGGCATCAGAAGG + Intronic
1121296246 14:92827481-92827503 ATGTGGGAATGGCCAGTTGATGG - Intronic
1121660272 14:95630045-95630067 CTGTGGGTTTGACCAGCTGAAGG + Intergenic
1121792057 14:96705904-96705926 CTCTATGACTGGCCAGCAGGAGG - Intergenic
1122060915 14:99136189-99136211 CTGGGAGCCTGGCCTGCAGAGGG + Intergenic
1122306989 14:100772709-100772731 CTGTGGGAAGGGCCAGCAAAGGG - Intergenic
1122594341 14:102878927-102878949 CGGTAGGATTGGCCAGCAGGTGG + Intronic
1122620191 14:103052520-103052542 GTGTGGGAATGGCCAGCCCAAGG - Intronic
1122630103 14:103103861-103103883 CTTTGAGCCTGGCCAGAAGAGGG + Intronic
1122652338 14:103232552-103232574 GAGTGGGGCTGGGCAGCAGAAGG + Intergenic
1122695227 14:103549165-103549187 CTGTGGGAATGGCCATCAGGTGG + Intergenic
1122930439 14:104930985-104931007 CTGTGGGTCTGGCCAGCCAGGGG - Intronic
1124095028 15:26641391-26641413 CTCTGGCACTGGCCAGAGGAAGG + Intronic
1125228218 15:37420545-37420567 CTGTAGATCTGGCCATCAGAAGG - Intergenic
1127351506 15:58157503-58157525 CTGTGGCACTGGTCAGCATTTGG - Intronic
1128239723 15:66093750-66093772 CTGTGGGGCTGGCCACCAAGAGG - Intronic
1128496583 15:68201658-68201680 CTGTGGTCCTTGCCAGCAGCAGG + Intronic
1128637506 15:69312619-69312641 CGGGGGGACTGGACAGGAGAAGG - Intronic
1128649646 15:69401145-69401167 CTCTGGGACTGGCTAGGAGGAGG + Intronic
1129769821 15:78195831-78195853 AGGTGGGTCTGGCCAGCAGGTGG - Intronic
1130128334 15:81113858-81113880 TGATGGGACTGGCCACCAGAAGG - Intronic
1130952272 15:88602142-88602164 CAGTGGGTCTTTCCAGCAGAAGG + Intergenic
1131074950 15:89489654-89489676 GTGTGGGACTGAGAAGCAGAAGG - Intronic
1131298323 15:91172215-91172237 CTGTGGGACAGGGATGCAGAGGG - Intronic
1131333413 15:91523740-91523762 CTGTTGGTCTGGGAAGCAGATGG + Intergenic
1132083453 15:98886697-98886719 CAGTGTGTCTCGCCAGCAGATGG - Intronic
1132600254 16:769945-769967 CTGTGGGAGTGGCCACGAGGCGG + Intronic
1132913660 16:2329695-2329717 CTGGGGAACTGGCCAGGAGGAGG + Exonic
1132959233 16:2612886-2612908 CTGTGGGAGTGGCTCGCAGGTGG + Intergenic
1132972293 16:2694861-2694883 CTGTGGGAGTGGCTCGCAGGTGG + Intronic
1133343609 16:5055370-5055392 CTGGGGGGCAGGCCTGCAGAGGG - Intronic
1133543878 16:6786246-6786268 GTATGGGCCTGGCCAGGAGACGG + Intronic
1134608020 16:15586619-15586641 CAGTGGGGCTGGGCTGCAGATGG + Intronic
1135007344 16:18838141-18838163 CTGGTGGACTGGACAGCAGGAGG - Exonic
1135252894 16:20916022-20916044 CTATGGGAGTGGCCAGCAACTGG - Intronic
1135603592 16:23803735-23803757 CTATGGGACTGGCAAACAGGAGG - Intergenic
1140528205 16:75641475-75641497 CTTTGGGACTGGACAGTAGGAGG - Intronic
1140578682 16:76202927-76202949 TTGTGGGACTGTCCATCACATGG + Intergenic
1142178360 16:88655450-88655472 CTGGGGGTCTCGACAGCAGAGGG + Intronic
1142848752 17:2694390-2694412 CTGTGGCCCTGGCCAGGAGTGGG + Intronic
1142899594 17:3003909-3003931 CTGTGGGACTGTCCAGCTGGAGG + Intronic
1146400623 17:32497647-32497669 CTCAGGGAGTGTCCAGCAGAGGG + Intronic
1147588389 17:41666069-41666091 CCGTGGGCCCGGCCAGCAGAGGG - Intergenic
1148103182 17:45105133-45105155 CTGCTGGTCTGGCCAGCAGAGGG - Intronic
1148506041 17:48127882-48127904 CTGTGGGGCTGGCCAGCTGTCGG - Intergenic
1149131062 17:53302977-53302999 CTCTGGGAAAGGCCAGCAGACGG - Intergenic
1149657362 17:58317371-58317393 CTGTGGGCCGGGCAAGTAGACGG - Intronic
1151148509 17:72063938-72063960 GTGTGTGACTGGTCACCAGAAGG + Intergenic
1151959998 17:77400769-77400791 CTGTGGGTCTGGCCTGGGGAAGG + Intronic
1152267100 17:79301517-79301539 CTGTGAGACTGGCCTGTGGATGG - Intronic
1154182035 18:12146283-12146305 CTGTGGGACTTTCCAGGAGGAGG + Intergenic
1154197442 18:12276913-12276935 CAGTGGGTCTGGCCAGGAGCAGG - Intronic
1155062159 18:22238185-22238207 CAGGGGGAATGACCAGCAGAGGG + Intergenic
1157083604 18:44554608-44554630 TTCTGGGAATGGCAAGCAGAAGG - Intergenic
1159122571 18:64187601-64187623 CTGTGAAAAAGGCCAGCAGACGG - Intergenic
1160533843 18:79580827-79580849 CACTGGGACCGCCCAGCAGAGGG - Intergenic
1160616718 18:80136383-80136405 ATGTGGGATTGGCCAGCAGCAGG - Exonic
1160857272 19:1223270-1223292 ACGTGGGATTGGCCACCAGAGGG - Intronic
1161696036 19:5768746-5768768 ATGTGGGACCAGCCAGCTGAGGG - Intronic
1162141836 19:8589824-8589846 CCGTGGGAGTGTCCAGCAGCAGG - Intronic
1163127402 19:15251658-15251680 GTGCGGGACAGGGCAGCAGAAGG + Intronic
1163551374 19:17967792-17967814 CTGGAGGGCTGGCCAGCAGATGG + Intronic
1164404929 19:27936330-27936352 CTGTGGGGCAGGGCAGCAGCTGG + Intergenic
1165137644 19:33679978-33680000 CTGTCGGAGTGTCCTGCAGAAGG - Intronic
1166141525 19:40807857-40807879 CTCTGGGACTGGCCACTAGGTGG - Exonic
1167411740 19:49348074-49348096 CTCTGCATCTGGCCAGCAGATGG - Intronic
1167933812 19:52890431-52890453 CTGGGGCAGTGGGCAGCAGAGGG - Intronic
927967489 2:27280449-27280471 CCAGGGGACTGGGCAGCAGAAGG - Exonic
928105565 2:28468631-28468653 CAGTGGGCCTGGCCAGAGGAGGG + Intronic
928206709 2:29289809-29289831 GTGTGGGAATGCCCAGCAGAGGG + Intronic
928615435 2:33034001-33034023 CTGGGGGACAGGAGAGCAGATGG + Intronic
930167153 2:48214323-48214345 CAGTGGAACAGGGCAGCAGAGGG + Intergenic
930984021 2:57563212-57563234 ATGAGGGACTGAGCAGCAGAAGG - Intergenic
931637632 2:64355111-64355133 CTGTGGGACCAGCCCTCAGAAGG - Intergenic
933707661 2:85303976-85303998 CTGTGGGACGAGCCAGCCGAGGG - Exonic
934987509 2:98898593-98898615 CTGTGGGTCTGGGCAGACGAGGG - Intronic
935365771 2:102289305-102289327 CTGTGGCTCTGGCCACCAGCTGG + Intergenic
936640225 2:114303894-114303916 CTGGGGGATGGGCCAGCAGTGGG - Intergenic
937247808 2:120504708-120504730 CAGTCGGTCTGGCGAGCAGACGG + Intergenic
937590799 2:123611079-123611101 CTGGGCGACTGGACAGGAGAAGG - Intergenic
938131590 2:128720238-128720260 TTGGGGGACTGGAAAGCAGATGG + Intergenic
938262132 2:129903740-129903762 CTGAGGAACAGGCCTGCAGAGGG - Intergenic
938406214 2:131034744-131034766 CTGTGCCACTGGCCAGCCCAGGG + Intronic
944621752 2:201522897-201522919 AGCTGGGAGTGGCCAGCAGATGG - Intronic
945030609 2:205660063-205660085 CTGTGGGGCTGGGCAGCAGGTGG + Intergenic
946154916 2:217801017-217801039 TTCTGAGACTGGCCAGGAGAGGG - Exonic
946162099 2:217841582-217841604 CTGTGGTGCTGGCCAGCAGGAGG - Intronic
946192259 2:218013752-218013774 CTGGGGGTCTGGCCAGGAGTTGG + Intergenic
946902286 2:224384145-224384167 CTGTGGGACTGGGTGACAGAGGG - Intronic
947623838 2:231607126-231607148 CCCAGGAACTGGCCAGCAGATGG - Intergenic
947770505 2:232666605-232666627 CTGCTGGTTTGGCCAGCAGATGG + Intronic
948423820 2:237875923-237875945 CTGTGGGGCTGGGCACCAGATGG - Intronic
948505107 2:238423080-238423102 CTGTGGCAGTGACCAGCACATGG + Intergenic
948562729 2:238864958-238864980 CGGTGGGCCTGGCCACCCGAGGG + Intronic
948815427 2:240507850-240507872 CTGTGGGACAGGCCAGCAGCGGG - Intronic
948884227 2:240874914-240874936 CAGCGGGACTGGACAGCTGAGGG + Intronic
949073587 2:242041172-242041194 CTGTGGAACTGGCCAGTGGCTGG - Intergenic
1170306545 20:14944855-14944877 TTGTGGGACGGGCAGGCAGAAGG - Intronic
1171259995 20:23723879-23723901 CTGAGGGACTGGACATCAGTGGG - Intergenic
1171269065 20:23799412-23799434 CTGAGGGACTGGACATCAGTGGG - Intergenic
1171354634 20:24534456-24534478 CTGAGGCAAAGGCCAGCAGAGGG - Intronic
1171977777 20:31606253-31606275 CTGAGGCACTGGCGAGGAGAGGG + Exonic
1173423814 20:42926112-42926134 CTGTGGGTCTGACCTGCAGAGGG + Intronic
1173454928 20:43194291-43194313 CTGAGGGACCAGGCAGCAGATGG - Intergenic
1173779041 20:45738004-45738026 CTGTGGGGCTGAACAGGAGAGGG - Intergenic
1174157661 20:48527106-48527128 CTGTGTCGCTGGCCTGCAGAAGG - Intergenic
1175769477 20:61614521-61614543 GCGTGGGACTGGCCTGCAGTGGG + Intronic
1175794357 20:61762291-61762313 CAGCGGGACTGGCCAGCATCTGG + Intronic
1176179017 20:63740968-63740990 AGGTGGGAGTGGCCAGCAGCCGG - Intronic
1176217290 20:63954235-63954257 CTGTGGAAGTGGGGAGCAGAGGG - Intronic
1179991410 21:44949921-44949943 CTGGTGATCTGGCCAGCAGAGGG + Intronic
1181319083 22:21990926-21990948 CTGAGTGAGTGGCCAGAAGAGGG + Intergenic
1181669900 22:24421153-24421175 CTGTGGGACTGGGGTGCACATGG + Intronic
1181811852 22:25408049-25408071 GTGGGGGCCTGGCCAGCAGGTGG + Intergenic
1182552175 22:31106445-31106467 CTGTGGGGCTGGGCCGCAGGTGG - Intronic
1182621882 22:31622975-31622997 CTGTGTGACTGGGCATCAGCTGG - Intronic
1182978450 22:34645614-34645636 CCCTTGGACTGGCCAGCAGGTGG - Intergenic
1183184495 22:36284350-36284372 CAGCGGGGCTGGGCAGCAGATGG - Intronic
1183237459 22:36630285-36630307 CTGTGGGCGTGGACAGGAGATGG + Intronic
1184191392 22:42897652-42897674 CTGAGGGACTGCCTGGCAGACGG + Intronic
1185237803 22:49724913-49724935 CTGTGGGACCGGCCAGGGGTGGG - Intergenic
1203296420 22_KI270736v1_random:46854-46876 ACGTGGGTCTGGCCAGCAGCAGG + Intergenic
949531949 3:4964887-4964909 CTGTGGGACAGGTGAGAAGAAGG + Intergenic
949903737 3:8840943-8840965 CTGTGGAACAGGGCAGGAGAAGG + Intronic
954132804 3:48568856-48568878 CTGTGGGAGTGACCAGGAGAGGG + Intronic
954215945 3:49124549-49124571 CAGTGGCACTGGTCAGGAGATGG + Exonic
954851436 3:53604330-53604352 TTGGATGACTGGCCAGCAGATGG + Intronic
955202694 3:56865133-56865155 CTGTGGGGATGGCGAGCACATGG + Intronic
958864626 3:99486291-99486313 GAGTGGGACTGGCCTGGAGACGG - Intergenic
961601388 3:128064911-128064933 CTGTGCGTGTGGCCAGCAGATGG - Exonic
962199351 3:133388860-133388882 CTGAGGGTCTGGCCAGCATCAGG - Intronic
969183668 4:5460318-5460340 AGGTGGAAGTGGCCAGCAGAGGG - Intronic
969233809 4:5851199-5851221 CTGTGTGAGTGGCATGCAGAAGG - Intronic
969478599 4:7434979-7435001 CTGTGGGAGTGGCCAGGAGGTGG - Intronic
970114082 4:12673480-12673502 CTTTGGGACTGGCTATCAGTGGG - Intergenic
970171032 4:13290775-13290797 CCCTGGGAGGGGCCAGCAGATGG + Intergenic
971452004 4:26809324-26809346 CTGAGGGACTGGACAAGAGAGGG + Intergenic
974520849 4:62978057-62978079 TTTTGGTACTGGCCAGGAGAAGG - Intergenic
975047583 4:69824440-69824462 CTGGGAGACTGACCAGGAGAAGG - Intronic
975547370 4:75573600-75573622 CTGTAAGACAGGCCATCAGACGG - Intergenic
976836409 4:89379834-89379856 ATGAGGGAGTGGTCAGCAGAAGG - Intergenic
978940941 4:114435137-114435159 CTGTAGGAGAGGCCAGCAGATGG + Intergenic
982230962 4:153207744-153207766 ATCCGGGACTGGCCAGCAGGTGG + Intronic
985151623 4:186953209-186953231 TTGTGGGACTGGACAGCAACAGG - Intergenic
985537154 5:472088-472110 CTGTGGGACTTGCCGTCTGAGGG + Intronic
985802039 5:2010825-2010847 CTGTGGGGCTCGCCATCAGCGGG - Intergenic
986501901 5:8409572-8409594 ATGTGGGACTAGCCAGCTGAAGG - Intergenic
986573461 5:9189049-9189071 ATGTGGGACTGGCCAGTGGCAGG - Intronic
988160910 5:27517571-27517593 CTGCAGGACTTGCCAGCTGAAGG + Intergenic
988208585 5:28172863-28172885 CTGAGGGACTGGGAAGCAGGAGG + Intergenic
992770402 5:80042135-80042157 CTGAGGACATGGCCAGCAGATGG + Intronic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
997884062 5:137615157-137615179 CTATGTGACTGGCGAGGAGATGG - Intergenic
998156102 5:139788132-139788154 TTCTGCGTCTGGCCAGCAGAGGG + Intergenic
999215675 5:149932935-149932957 CCGGCGGAGTGGCCAGCAGAGGG + Intronic
1002258632 5:177978587-177978609 CTGTGGGACTGGAGAGCAGACGG + Intergenic
1002333976 5:178465535-178465557 CTGTGGGCCTGTCCACCAGGAGG - Intronic
1002427839 5:179186335-179186357 CTGAGAGGCTGGACAGCAGAAGG - Intronic
1002501229 5:179648959-179648981 CTGTGGGACTGGAGAGCAGACGG - Intergenic
1003103453 6:3195141-3195163 CCCTGGGACTGGCCAGGACAAGG + Intergenic
1004546021 6:16599007-16599029 CAGGGGGACATGCCAGCAGAAGG + Intronic
1005854971 6:29853611-29853633 CTGGGGCACTGGCCAGGAAAGGG - Intergenic
1006582130 6:35083255-35083277 CTGTGGGACTGGCCAGCAGAAGG + Intronic
1007167064 6:39836124-39836146 CTGTGAATCTGGCCGGCAGAGGG - Intronic
1007509660 6:42365252-42365274 CTGGGATACTGGCCAGCAGCTGG - Intronic
1007727808 6:43927228-43927250 CTGAGGGACATTCCAGCAGAGGG - Intergenic
1008508716 6:52256215-52256237 ATGTGGGGCTGGAGAGCAGATGG - Intergenic
1012147492 6:95703830-95703852 CTTTGGTACTGTCCAGCAGAAGG - Intergenic
1012231291 6:96763217-96763239 CTGTGGCCTTGGCCAGGAGAAGG - Intergenic
1012259342 6:97069585-97069607 CTGTGGGGCTTTCGAGCAGAGGG + Intronic
1013140539 6:107329457-107329479 CTGTGAGGCTGGCCTGTAGATGG + Intronic
1013649806 6:112182979-112183001 CTGTAGGACTTCCCAGTAGAAGG + Intronic
1014159694 6:118153875-118153897 GTCTGGGAATGGACAGCAGATGG + Intronic
1016190688 6:141261173-141261195 CTGCGGGACTGGGAAGTAGAGGG - Intergenic
1016369478 6:143357282-143357304 CTGTGGGATTTGCTAGCATAAGG - Intergenic
1016523032 6:144967965-144967987 CTGTGGGCCAGGCCAGGAGGTGG - Intergenic
1018058620 6:160072514-160072536 CTGTGGTATGGCCCAGCAGAGGG + Intronic
1022031312 7:26493780-26493802 CTCTGGTACTGGGAAGCAGAGGG - Intergenic
1024527150 7:50358408-50358430 CTGTGGGACGGGGCAGGAGAGGG + Intronic
1025888454 7:65621760-65621782 CCGTGAAACTGGCCAGCAGGTGG + Intergenic
1026337039 7:69403353-69403375 GTGTGGGACCAGCCAGCTGATGG + Intergenic
1027141218 7:75659103-75659125 CCCTGGGACTGGCCAGAAGTAGG - Intronic
1033262575 7:139856491-139856513 CTGTCGGAATGGCCACCCGAAGG - Intronic
1033549291 7:142431950-142431972 CAGTGACACTGGCCATCAGAAGG + Intergenic
1034282947 7:149866195-149866217 CTGTGGGTCTGGCGGTCAGAGGG + Exonic
1036212053 8:6850292-6850314 ACGTGTGGCTGGCCAGCAGAAGG - Intergenic
1036900426 8:12665663-12665685 GTGCGGGAGAGGCCAGCAGAGGG - Intergenic
1038397582 8:27258466-27258488 CTCTGTGATTGGCCAGCAGTGGG + Intergenic
1039845316 8:41321612-41321634 CGGTGGGGCTGGAGAGCAGAGGG + Intergenic
1039923300 8:41907822-41907844 AGGTGGGAGTGGCCAGCTGATGG - Intergenic
1042485080 8:69339153-69339175 CTGTGGAACTGGCAAGTAGCTGG - Intergenic
1044273297 8:90271981-90272003 CTGTGAGACTGGGCAGTAGGAGG - Intergenic
1044470930 8:92566463-92566485 CTGTGGAGCTATCCAGCAGAAGG + Intergenic
1045315651 8:101041411-101041433 TTGTGGGACCGGCCAGCAGGCGG - Intergenic
1045959138 8:107946504-107946526 CTGTGGGACTGGGGCACAGAAGG + Intronic
1046597063 8:116273146-116273168 CTCTGGGAGAGGCCAGCAGACGG + Intergenic
1047409915 8:124615908-124615930 CTGGGGCACTGACCAGGAGAAGG - Intronic
1049599171 8:143499083-143499105 CAGTGGTCCTGGCCAGCAAAGGG - Intronic
1049666712 8:143847509-143847531 CTGTGATACTGTACAGCAGAAGG + Intergenic
1049757719 8:144318207-144318229 CTGGGGGGCTGGGCAGCAGCAGG - Intronic
1049808810 8:144553990-144554012 CGGGGGGCCTGGCCAGCACATGG + Intronic
1052079021 9:24180286-24180308 CTGTGAAAGTGGCCAGGAGAGGG - Intergenic
1052707556 9:32011120-32011142 CTGTGGGACTGGCAGCCAGCTGG - Intergenic
1053577046 9:39363955-39363977 ATGTGGGACTGGCCGGCACTGGG + Intergenic
1053841553 9:42191880-42191902 ATGTGGGACTGGCCGGCACCGGG + Intergenic
1054098616 9:60922645-60922667 ATGTGGGACTGGCCGGCACTGGG + Intergenic
1054120015 9:61198274-61198296 ATGTGGGACTGGCCGGCACCGGG + Intergenic
1054587741 9:66984288-66984310 ATGTGGGACTGGCCGGCACCGGG - Intergenic
1054965856 9:71026280-71026302 CCCTGGGAGAGGCCAGCAGATGG - Intronic
1060803398 9:126558654-126558676 CTGAGGTCCTGGTCAGCAGAGGG - Intergenic
1060875664 9:127081879-127081901 CTGTGGGAATGCCACGCAGATGG + Intronic
1061235588 9:129341143-129341165 CTGTGGGACTGGAGAGCCCAGGG - Intergenic
1061413639 9:130433902-130433924 CTGCGGGACTGGCCACCCAAGGG - Exonic
1061919366 9:133774312-133774334 CTGTGTGCCTGGCCTGCAGGAGG - Intronic
1061974053 9:134059545-134059567 CTGCGGGAATGTGCAGCAGAAGG + Intronic
1061992942 9:134170064-134170086 CTCTGGGACCAGCCAGCAGGTGG - Intergenic
1062473232 9:136715250-136715272 CTCAGGCACTGGCCAGCAGAGGG - Intronic
1062641876 9:137522947-137522969 CCGTGTGACTGGGCAGCAGGCGG - Intronic
1188961652 X:36500583-36500605 GAGAGGGACTGGCAAGCAGAAGG + Intergenic
1192083990 X:68077002-68077024 GTGTGGGAGTGGCCTGGAGAGGG + Intronic
1192195689 X:69026386-69026408 GAGGGGGACTGGCCAGTAGATGG + Intergenic
1192800128 X:74457762-74457784 GTGTGGGAATGGCAAGTAGATGG - Intronic
1197225175 X:123949786-123949808 CTGTGTGGCTGGCTGGCAGAAGG + Intergenic
1198075707 X:133191004-133191026 CTCTGGGGCTGAGCAGCAGATGG + Intergenic
1198367033 X:135951465-135951487 CTGTGGGAGAGAGCAGCAGAGGG + Intergenic
1200208118 X:154332544-154332566 CGATGGGGCTGGCCAGCCGAGGG - Intergenic
1202047638 Y:20750527-20750549 CTGTGGGACTAGCCCCCAGAAGG - Intergenic
1202048509 Y:20757677-20757699 CTGTGGGAGTGGCCACCAGCGGG - Intronic