ID: 1006582694

View in Genome Browser
Species Human (GRCh38)
Location 6:35085995-35086017
Sequence CAGGGTGGTCAGCGTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 321}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006582686_1006582694 -4 Left 1006582686 6:35085976-35085998 CCCCAGGGATTCAAGGGCTCAGG 0: 1
1: 0
2: 0
3: 19
4: 196
Right 1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG 0: 1
1: 0
2: 3
3: 20
4: 321
1006582679_1006582694 9 Left 1006582679 6:35085963-35085985 CCCCTCTCCCTGGCCCCAGGGAT 0: 1
1: 1
2: 8
3: 81
4: 746
Right 1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG 0: 1
1: 0
2: 3
3: 20
4: 321
1006582680_1006582694 8 Left 1006582680 6:35085964-35085986 CCCTCTCCCTGGCCCCAGGGATT 0: 1
1: 1
2: 13
3: 128
4: 1514
Right 1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG 0: 1
1: 0
2: 3
3: 20
4: 321
1006582671_1006582694 26 Left 1006582671 6:35085946-35085968 CCCCACTGGCCAAGATCCCCCTC 0: 1
1: 0
2: 0
3: 10
4: 182
Right 1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG 0: 1
1: 0
2: 3
3: 20
4: 321
1006582681_1006582694 7 Left 1006582681 6:35085965-35085987 CCTCTCCCTGGCCCCAGGGATTC 0: 1
1: 0
2: 4
3: 63
4: 728
Right 1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG 0: 1
1: 0
2: 3
3: 20
4: 321
1006582683_1006582694 2 Left 1006582683 6:35085970-35085992 CCCTGGCCCCAGGGATTCAAGGG 0: 1
1: 1
2: 2
3: 41
4: 400
Right 1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG 0: 1
1: 0
2: 3
3: 20
4: 321
1006582675_1006582694 17 Left 1006582675 6:35085955-35085977 CCAAGATCCCCCTCTCCCTGGCC 0: 1
1: 0
2: 2
3: 48
4: 609
Right 1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG 0: 1
1: 0
2: 3
3: 20
4: 321
1006582688_1006582694 -5 Left 1006582688 6:35085977-35085999 CCCAGGGATTCAAGGGCTCAGGG 0: 1
1: 0
2: 4
3: 27
4: 310
Right 1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG 0: 1
1: 0
2: 3
3: 20
4: 321
1006582685_1006582694 1 Left 1006582685 6:35085971-35085993 CCTGGCCCCAGGGATTCAAGGGC 0: 1
1: 0
2: 2
3: 28
4: 338
Right 1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG 0: 1
1: 0
2: 3
3: 20
4: 321
1006582678_1006582694 10 Left 1006582678 6:35085962-35085984 CCCCCTCTCCCTGGCCCCAGGGA 0: 1
1: 0
2: 11
3: 100
4: 950
Right 1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG 0: 1
1: 0
2: 3
3: 20
4: 321
1006582672_1006582694 25 Left 1006582672 6:35085947-35085969 CCCACTGGCCAAGATCCCCCTCT 0: 1
1: 0
2: 0
3: 24
4: 162
Right 1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG 0: 1
1: 0
2: 3
3: 20
4: 321
1006582673_1006582694 24 Left 1006582673 6:35085948-35085970 CCACTGGCCAAGATCCCCCTCTC 0: 1
1: 0
2: 0
3: 14
4: 283
Right 1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG 0: 1
1: 0
2: 3
3: 20
4: 321
1006582690_1006582694 -6 Left 1006582690 6:35085978-35086000 CCAGGGATTCAAGGGCTCAGGGT 0: 1
1: 0
2: 0
3: 16
4: 195
Right 1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG 0: 1
1: 0
2: 3
3: 20
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006582694 Original CRISPR CAGGGTGGTCAGCGTGAGGA GGG Intronic
900114420 1:1022406-1022428 CAGGGTGATCCGCATGAGGCTGG - Exonic
900163072 1:1233495-1233517 CACGGGGGTCAGCGTGCGGCCGG - Exonic
900475098 1:2872374-2872396 CAGGGGTGACAGCGTGTGGAGGG + Intergenic
900494577 1:2970714-2970736 CATGGGGCTCAGTGTGAGGAAGG + Intergenic
900694659 1:4002317-4002339 CAGGTTGTGCTGCGTGAGGAAGG + Intergenic
901638466 1:10681245-10681267 CGTGGAGGTCAGGGTGAGGATGG - Intronic
901780844 1:11593550-11593572 CAGGGTGGTCAGCCAGGTGAGGG + Intergenic
901933447 1:12612185-12612207 CAGGCTGCACAGAGTGAGGATGG + Intronic
902037492 1:13468236-13468258 CAGGGTGGACAGTTTGAGGAAGG + Intergenic
902513088 1:16976640-16976662 CAGGGTTGACAGGGTGGGGAGGG + Intronic
903215152 1:21839606-21839628 GAGGGTGGCCATGGTGAGGAAGG + Intronic
903295967 1:22343188-22343210 CAGGGTGGACAGGGAGACGATGG + Intergenic
903647187 1:24902596-24902618 GAGGGTTGGCAGCGTGGGGAAGG + Exonic
904005316 1:27360484-27360506 CAGGGTAGTAAGGGTGGGGAAGG - Intronic
904789777 1:33010726-33010748 AAGGGTGGTCAGGGTGAGGATGG - Intronic
905013446 1:34761975-34761997 CAGGGAGGGCACCCTGAGGATGG + Exonic
905250652 1:36646203-36646225 CAGGAAGGTCAGCATGTGGAGGG - Intergenic
906601862 1:47137433-47137455 AGGGGTGGTCAGAGAGAGGAAGG + Exonic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
907360101 1:53907237-53907259 CAGCCTGGTCAGGGTGAGGGAGG + Intronic
907890298 1:58630738-58630760 AAGGGTGGTCAGGGTGAGGATGG - Intergenic
908775709 1:67638145-67638167 CAGCGTGGTCAGAGAGAGGCTGG + Intergenic
910813325 1:91260366-91260388 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
911037869 1:93569419-93569441 CATGGTGGGCAGCAGGAGGAAGG - Intronic
911429214 1:97762005-97762027 GAGGGTGGACAGTGGGAGGAGGG + Intronic
912699824 1:111869068-111869090 CAGGATGGGCAGCGTGTGGAAGG - Intronic
912801133 1:112720343-112720365 CAGGGTGGTGAGCCTGAGAAGGG - Intergenic
916085913 1:161269238-161269260 CAGGGTGCTGAGGGTGGGGAAGG + Intronic
916245069 1:162679187-162679209 GAGGATGGTCAGTGGGAGGAGGG - Intronic
918984980 1:191613884-191613906 CAGCGAGGTCAGAGTGATGATGG + Intergenic
919849440 1:201662739-201662761 CATGGTGGTTAGGGTGAGGAAGG - Intronic
920458063 1:206116276-206116298 CAGGGTGGTCCAGGTGAGGTAGG + Exonic
922621500 1:226992008-226992030 GAGGGTGGGGAGAGTGAGGAGGG + Exonic
922621506 1:226992026-226992048 GAGGGTGGGGAGAGTGAGGAGGG + Exonic
924124879 1:240840015-240840037 CAGGGTGGTAACAGTGAGGGTGG - Intronic
924522484 1:244817022-244817044 CAGGGTGGGGAAGGTGAGGAAGG - Intergenic
1063434341 10:6018304-6018326 CAGGGAGGACAGGGTGAGGGTGG + Intronic
1064213916 10:13383690-13383712 CAGGGTGCTCCGAGTGAAGAGGG - Intergenic
1064681563 10:17815525-17815547 TAGGGCGGTCAGCAGGAGGAAGG + Intronic
1065202072 10:23322679-23322701 TACGGTGGTGAGCGGGAGGAGGG + Intronic
1065969489 10:30795147-30795169 ATGGGTGGTCGGGGTGAGGATGG + Intergenic
1067362265 10:45593946-45593968 AAGGGTAGTTAGCGTGGGGATGG + Intronic
1067457193 10:46427413-46427435 CAGGGCTGTGAGCCTGAGGATGG - Intergenic
1067630009 10:47957225-47957247 CAGGGCTGTGAGCCTGAGGATGG + Intergenic
1069708137 10:70472144-70472166 CAGGGAGGTGGGGGTGAGGAAGG - Intergenic
1069821285 10:71230240-71230262 CTGATTGGTCAGAGTGAGGAGGG + Intronic
1069995664 10:72340775-72340797 CAGGGTGATGTGAGTGAGGAGGG - Exonic
1070331629 10:75421665-75421687 CAGGGTGGACAGGGTGATTAGGG + Intergenic
1071966405 10:90857393-90857415 CAGCGTGATGAGCGTCAGGATGG + Exonic
1073036104 10:100565173-100565195 AAGGGTGGCCAGGGTGAGGCTGG + Intergenic
1074979369 10:118607588-118607610 GAGGGTGGACAGGGAGAGGAGGG - Intergenic
1075589157 10:123678819-123678841 CAGGCTGGGCAGGGTGTGGAGGG + Intronic
1075741490 10:124698946-124698968 CTGGGTGGTGTGAGTGAGGAGGG - Intronic
1076094444 10:127719987-127720009 CAGGCTGGTGAGGGTGGGGAAGG - Intergenic
1076122734 10:127949182-127949204 CAGGGTCTTCAGCTTGAAGATGG + Intronic
1076840864 10:133044563-133044585 CAGGGCGGTCAGTGGAAGGACGG + Intergenic
1077491637 11:2863335-2863357 CAGGCTGGGCAGAGTGAGGGAGG + Intergenic
1077501475 11:2911484-2911506 CAGGGTGGCCAGGGTGAGGAAGG + Intronic
1077516726 11:3006711-3006733 CAGGCTGGCCAGCGTGGGAATGG + Intronic
1078536921 11:12182768-12182790 CAAGGTGGACAGTGGGAGGAGGG - Intronic
1078655875 11:13238575-13238597 GAGGGTGGGCAGCGGGAGGATGG + Intergenic
1080147833 11:29009091-29009113 GAGGGTGGTGAGTGGGAGGAGGG - Intergenic
1080788721 11:35499934-35499956 CAGGATGGTCAGAGTCAGAAAGG + Intronic
1080852558 11:36082598-36082620 CAGGGTGGTCACAGTCAAGAAGG - Intronic
1083296404 11:61717809-61717831 CAGGCTGGTCACCCTGAGGTGGG + Intronic
1083365785 11:62140795-62140817 CTGGCTGGGCAGGGTGAGGAAGG - Exonic
1083956186 11:65984176-65984198 CAGGCTGGTCAGGGTGAGTAGGG + Intergenic
1084701200 11:70787311-70787333 CATGGTGGTCATGGTGATGATGG - Intronic
1085388725 11:76171507-76171529 CAGGGTGGGACGCCTGAGGAGGG - Intergenic
1086575895 11:88338534-88338556 CAGGGTGAGAAGGGTGAGGAAGG + Intergenic
1088927355 11:114315865-114315887 CAGGGTGCTAAGGGGGAGGATGG + Intergenic
1089341755 11:117763037-117763059 CAGAGTGGTCTGTGGGAGGAAGG - Intronic
1090556136 11:127878543-127878565 GAGGGTGGTGGGCCTGAGGAGGG - Intergenic
1090593781 11:128298721-128298743 CAGAGTGGTCAGGGAGATGATGG - Intergenic
1092947978 12:13474678-13474700 CAGGGTGGTCCCCATTAGGAGGG - Intergenic
1093532696 12:20186286-20186308 CAGGTTGGTGGGCGTGATGAAGG - Intergenic
1100619104 12:96254859-96254881 CAGGGTAGACAGGGAGAGGAAGG + Intronic
1101576517 12:106002037-106002059 CAGGGTGGTTGGAGTGAGCAAGG + Intergenic
1102678106 12:114672171-114672193 CATGGTGTTCAGATTGAGGAAGG + Exonic
1103459000 12:121089101-121089123 CAGGCTGAACAGTGTGAGGAGGG + Intergenic
1104348796 12:128026902-128026924 CAGGTGGGACAGCGTGAGTAGGG - Intergenic
1104566884 12:129893395-129893417 CAGGGTGGGTAGGGTGGGGAGGG - Intronic
1104909868 12:132235556-132235578 CAGGGTGGTCAGCATGGAGTTGG + Intronic
1105299430 13:19118906-19118928 CAGGGTGGGGAGCGGGAGGGAGG + Intergenic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1106404556 13:29462509-29462531 CAGGGTGGTGGTGGTGAGGAGGG + Intronic
1107747340 13:43524484-43524506 CAGGGTGGAGGGCGTGAGGAGGG - Intronic
1110195280 13:72781710-72781732 CCGGGTGCGCAGCGTGTGGAGGG - Exonic
1112365495 13:98752407-98752429 CCGGGTGGTCACCGTGCGGCCGG - Intronic
1112651034 13:101398778-101398800 CAGGGTGCACAGCGTGGGGAGGG + Intronic
1114050937 14:18919470-18919492 CAGGGTGGGGAGCGGGAGGGAGG - Intergenic
1114111622 14:19482452-19482474 CAGGGTGGGGAGCGGGAGGGAGG + Intergenic
1114636037 14:24187427-24187449 CATGGTGGTCAGAGTGCGCAGGG + Exonic
1118776266 14:68976268-68976290 CAGGGGAGTGAGTGTGAGGAGGG - Intronic
1119467032 14:74866345-74866367 GAGGGTGGTCAGCATGTGGCTGG + Intronic
1119762109 14:77158914-77158936 CAGGGTGGTGAAGGTGAGGGTGG - Intronic
1119788547 14:77329851-77329873 GAGGGAGGTCAGCATGAGGGAGG - Intronic
1120849904 14:89160337-89160359 CAGGTTGGTCAGTGTGCTGAAGG + Exonic
1122305934 14:100766443-100766465 CTGGGTGGTGAGCGTGAAGCTGG + Intergenic
1122918671 14:104870655-104870677 CAGGGTGCTCAGGGTGAGTTTGG + Intronic
1123962814 15:25423928-25423950 CAGAGTGGTCACAGTGAGGGTGG - Intronic
1125173225 15:36790991-36791013 GAGGGTGGACAGTGGGAGGAGGG - Intronic
1125727038 15:41873445-41873467 CAGTGTGGTCTGGGTGATGATGG - Intronic
1126482099 15:49136176-49136198 CATGGTGGCAAGCGTGGGGAGGG + Intronic
1127473943 15:59314680-59314702 CTTGGTGGTCAGACTGAGGAGGG + Intronic
1128112258 15:65083980-65084002 CAGGGAGGGCAGCCTGATGATGG - Intergenic
1129183909 15:73894239-73894261 CAGTGTGGGCTGCGGGAGGATGG - Intergenic
1129681796 15:77662342-77662364 AAGGGCGGTCAGAGGGAGGAAGG + Intronic
1130059194 15:80557453-80557475 GAGGGTGGACAGTGGGAGGAGGG + Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1132006285 15:98230380-98230402 CAGCATGGGCAGCATGAGGAGGG + Intergenic
1132722956 16:1326002-1326024 CAGAGGGCTCAGCGTCAGGACGG - Exonic
1132845528 16:1999344-1999366 CAGGGTGGTTAACGGGAGGCTGG + Intronic
1133836851 16:9375111-9375133 CAGGGTGGGGTGTGTGAGGAAGG + Intergenic
1135686221 16:24500291-24500313 CATGGTGGTGAGGGTGAGGGAGG - Intergenic
1136090959 16:27919680-27919702 CTGTGTGGTCAGGGTGAGGCTGG - Intronic
1136271193 16:29149183-29149205 CAAAGAGGCCAGCGTGAGGAAGG + Intergenic
1138265727 16:55658071-55658093 AAGGGAGGTCAGAGGGAGGAAGG + Intronic
1139258208 16:65563754-65563776 AAGGGTGATGAGGGTGAGGAGGG - Intergenic
1141233958 16:82198028-82198050 CAGGGAGGTCAGCGGGACGGTGG + Intergenic
1142431119 16:90027939-90027961 CAGGGTGGTAGGAGTGTGGAAGG + Intronic
1142847958 17:2691144-2691166 CAGGATGGGAAGCGTGGGGAGGG + Intronic
1143646631 17:8234608-8234630 CAGGGTGGCCAGAGTGGGGAAGG + Exonic
1143670226 17:8391830-8391852 CAGGCTGGGCTGGGTGAGGAAGG - Exonic
1144199329 17:12925256-12925278 CAGTTGGGTCAGTGTGAGGAAGG + Intronic
1145056650 17:19707658-19707680 CAGGGTGGTCAGCAGGCAGAGGG - Intronic
1145883643 17:28368682-28368704 CAGGGTGGTGGGCATTAGGAGGG + Intronic
1146531327 17:33609944-33609966 CAGGCTGCTCACCGGGAGGAGGG - Intronic
1147167621 17:38601868-38601890 AGGGGTGGTCAGAGGGAGGAAGG + Intronic
1148359912 17:47003278-47003300 CAGAGTGGTCAGGGTCAGGGTGG - Intronic
1148786144 17:50147202-50147224 CATGGTGGGCAGCCCGAGGAGGG - Intronic
1149067403 17:52496550-52496572 CAGGCTTGTCAGCTTAAGGATGG + Intergenic
1149535846 17:57432683-57432705 CAGTGAGGTCAGTGTGAGGAGGG - Intronic
1149652384 17:58284077-58284099 GAGGGTGGACAGGGTGAGGCTGG + Intergenic
1150431342 17:65120224-65120246 CAGGGTGGTCAGTGGGATGGAGG + Intergenic
1150459238 17:65333401-65333423 CAGGGTGGTGAGAGTCATGAGGG - Intergenic
1151194926 17:72424636-72424658 CAGGGCGGCCAGTGGGAGGAGGG - Intergenic
1151827169 17:76529944-76529966 CAGTGTGGTCAGCAGCAGGAAGG + Intronic
1152498913 17:80695153-80695175 CATGGTGGTAAGAGTGAGGCGGG + Intronic
1152572006 17:81125040-81125062 CAGGGTGAGCAGGGTGAGCAGGG + Intronic
1152725143 17:81941451-81941473 CAGGGTGGCCAGCATGGCGAAGG + Exonic
1152884550 17:82841934-82841956 CAGGGTGGTCAGCTGTATGATGG + Intronic
1157405738 18:47421360-47421382 CTGGGAGGTCAGGGTCAGGAAGG + Intergenic
1159489896 18:69118693-69118715 GAGGGTGGACAGTGAGAGGAGGG - Intergenic
1161065136 19:2233809-2233831 CACGGTGGTCAGCGTGCAGCGGG - Exonic
1161332885 19:3696715-3696737 CAGGGAGGGCAGAGTGCGGAGGG + Intronic
1161973913 19:7598359-7598381 GAGGCTGGTCAGACTGAGGAAGG + Intronic
1162043018 19:7981802-7981824 CTGGGTGGTGAGGATGAGGAAGG + Intronic
1162760790 19:12887090-12887112 CAGGGCGGTCAGTGTGCTGATGG + Exonic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163370225 19:16897350-16897372 GAGGGTGGTCAGTGTGGTGAGGG - Intronic
1163413563 19:17172061-17172083 CAGCGTGTTCAGCATGAGGCAGG + Intronic
1163438871 19:17311532-17311554 CAGGGGCCTCAGGGTGAGGAGGG - Intronic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1163683317 19:18696236-18696258 CCGGCTGGTCAGGGTGAGGCAGG + Intronic
1164120703 19:22262426-22262448 CAGGGTGGTCAGCTTCAGACAGG + Intergenic
1164179315 19:22806138-22806160 CAGGGTGGTCAGCTTCAGACAGG - Intergenic
1165396520 19:35567178-35567200 CAGGGTGGACATGGTGGGGAGGG + Intergenic
1165999687 19:39870857-39870879 CAGAGGGGTCAGCGCCAGGATGG + Intronic
1166457159 19:42951434-42951456 CACGGTGGTGAGTGTGGGGAGGG + Intronic
1166467103 19:43042294-43042316 CATGGTGGTGAGTGTGGGGAGGG + Intronic
1166473237 19:43098377-43098399 CATGGTGGTGAGTGTGGGGAGGG + Intronic
1166705845 19:44907633-44907655 CATGGTGGGCAGGGTGAGGGGGG - Intronic
1166782471 19:45349676-45349698 CAGGGTGAGCAACGTGAGGGTGG + Intronic
1167618643 19:50549505-50549527 CAGGGTGGGCAGTGACAGGAGGG - Intronic
925154156 2:1637388-1637410 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154165 2:1637462-1637484 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154187 2:1637610-1637632 CAGAGTGGACAGCGTGCGGCAGG - Intronic
925154201 2:1637684-1637706 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925154217 2:1637759-1637781 CAGAGTGGACAGCGTGTGGCAGG - Intronic
925216437 2:2099989-2100011 GAGGATGGACAGGGTGAGGATGG - Intronic
925568108 2:5279046-5279068 CTGGGTGTTCAGCTTGAGAAAGG - Intergenic
925641600 2:5990586-5990608 CCGGGTGGTCAGAGTGAGGCTGG - Intergenic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
929836573 2:45406522-45406544 CAGGGTTTTCAGCAAGAGGATGG - Intronic
930368326 2:50471730-50471752 GAGGGTGGAGAGTGTGAGGATGG + Intronic
931058867 2:58503919-58503941 CAGGGTGAGCAGGGTGAGCAGGG + Intergenic
932667766 2:73710723-73710745 CAGGGTGGAGAGTGGGAGGAGGG + Intergenic
932688055 2:73890486-73890508 CACCGTGGTCAGCGTGCAGATGG - Intergenic
935310506 2:101778459-101778481 CAGGGTGGACAGCATGCAGAAGG + Intronic
937295570 2:120807902-120807924 CTGGGTGGGCAGGGTGGGGAGGG + Intronic
939190959 2:138916418-138916440 AAGGCAGGTCAGCGTGAGGCAGG - Intergenic
939801355 2:146714045-146714067 CGGGGTGGACAGTGAGAGGAGGG + Intergenic
942553423 2:177145418-177145440 GATGGTGGTCAACTTGAGGATGG - Intergenic
946247100 2:218394139-218394161 CATGCTGGTGAACGTGAGGATGG - Exonic
946483579 2:220079345-220079367 CAGGGTGGTAGGCATGGGGAGGG + Intergenic
946563567 2:220939829-220939851 CAGGTTTTTCAGCTTGAGGATGG - Intergenic
948178496 2:235962098-235962120 AAGTGAGGTCATCGTGAGGATGG + Intronic
948375181 2:237516354-237516376 CCAGGAGGTCAGTGTGAGGAAGG + Intronic
948569601 2:238909557-238909579 CGGGGTGGTGAGTGTGAGAAAGG + Intronic
1169084985 20:2820970-2820992 CAGGGTCGTCAGGGAGGGGAAGG + Intergenic
1170585067 20:17728325-17728347 CAGGGAGGTAAGTGTGAGGGTGG - Intronic
1170931550 20:20773406-20773428 CAGGGTGGAGAGAGTGGGGAAGG - Intergenic
1174215286 20:48911780-48911802 CAGGGAGGTCAGGGAGAGGGAGG - Intergenic
1175914235 20:62418379-62418401 CAGTGTGGTCCCTGTGAGGAGGG + Intronic
1176243679 20:64086860-64086882 CAGGGTGGTGAGCCTGTGGAAGG + Intronic
1177213579 21:18100421-18100443 CTGGGTGGTTAGCATGGGGAAGG + Intronic
1177599475 21:23291371-23291393 CCAGGTGTTCAGAGTGAGGAAGG + Intergenic
1178408899 21:32347767-32347789 CAGGGTGGGGTGCCTGAGGATGG + Exonic
1179091069 21:38266278-38266300 CAGGGTGGGAAGCTAGAGGAGGG - Intronic
1179596545 21:42446430-42446452 CAGGGGGGTCTGAGTGAGGCTGG - Intronic
1180200659 21:46222178-46222200 CAGGCGGGTCACGGTGAGGAAGG - Intronic
1180469414 22:15641845-15641867 CAGGGTGGGGAGCGGGAGGGAGG - Intergenic
1180979123 22:19870451-19870473 AAGGGTGGTCAGGGTGCGGCAGG + Intergenic
1181494488 22:23280308-23280330 CAGGCTGGTGGGAGTGAGGAGGG - Intronic
1181778730 22:25178170-25178192 GAGGATGGTCAGCTGGAGGACGG - Intronic
1182142040 22:27967788-27967810 GAGGCTGGCCAGGGTGAGGAGGG - Intergenic
1183348608 22:37321588-37321610 GAGGGTGGACAGTGGGAGGACGG + Intergenic
1183683981 22:39350995-39351017 ACGGGTGGTCAGGGAGAGGATGG + Intronic
1184555979 22:45233314-45233336 CAGGGTGGGCAGACTGAGGCAGG + Intronic
1184822619 22:46921230-46921252 GAGGGTGGAGAGCGGGAGGAGGG - Intronic
950577303 3:13839948-13839970 CGGGCTGATCAGCGTTAGGAAGG - Intronic
953123644 3:40070700-40070722 CAGGGTGGTAAGGGGGTGGATGG - Intronic
953712954 3:45290464-45290486 CTGGGTAGTGAGAGTGAGGAAGG + Intergenic
954028747 3:47803270-47803292 GGGGGTGGTCGTCGTGAGGAGGG + Intronic
954287613 3:49629979-49630001 CAGGGTGGGCGGCGTGGAGAAGG + Intronic
954296460 3:49677049-49677071 GAGGGTGGTCAGCAAGAAGATGG + Intronic
954746258 3:52789240-52789262 CTGGGTTGGCAGCGTGAGGGTGG + Intronic
954787996 3:53109069-53109091 CAGGGTGATGAGGGTGAGGTTGG - Intronic
955238506 3:57160592-57160614 CTGGGTGGGGAGTGTGAGGATGG - Intronic
955837538 3:63073103-63073125 CATGGTGGGCAGGGTGAAGAAGG + Intergenic
956847338 3:73195671-73195693 CAGGGTGGGGAGTGGGAGGAAGG - Intergenic
957693154 3:83597694-83597716 AAGGGTGGTGAGTGGGAGGAGGG + Intergenic
958729638 3:97948022-97948044 CAGGGTCATCTGCGTGGGGAAGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961488243 3:127232510-127232532 CAGGGAGGTCAGCAGGAGGATGG - Intergenic
961829908 3:129618122-129618144 GAGGGTGGTCAGGCAGAGGAGGG + Intergenic
963410612 3:144922352-144922374 CAGGCTTTTCAGCTTGAGGATGG + Intergenic
966856763 3:184199512-184199534 TGGGGTGATCATCGTGAGGATGG - Intronic
966862059 3:184236118-184236140 CAGGGAGGGCGGCGTGAGGCCGG - Intronic
968287470 3:197517388-197517410 TGGGGGGGTCAGCCTGAGGAGGG - Intronic
968287880 3:197518837-197518859 GAGGGGGGTCGGCCTGAGGAGGG - Intronic
968287893 3:197518890-197518912 CGGGGAGGTCAGCCTGAGGGGGG - Intronic
968812570 4:2806623-2806645 GAGGGTGGTGAGGGTGAGGTGGG - Intronic
969439520 4:7208912-7208934 GGGGGTGGGCAGCGTGTGGAGGG + Intronic
970267162 4:14301001-14301023 AAGGGTGGATAGTGTGAGGAAGG + Intergenic
970444844 4:16115018-16115040 CAGGCTGGTCTGCGAGAGGCAGG + Intergenic
971237353 4:24854763-24854785 CAGGGAGGTGAGCATGAGGTGGG - Intronic
974062974 4:57052316-57052338 CAGGGGTGTCAGTCTGAGGAAGG + Intronic
977651562 4:99475820-99475842 CAGGGTGGAGAGTGGGAGGAAGG - Intergenic
978769743 4:112442464-112442486 GAGGGTGGACAGTGGGAGGAGGG + Exonic
981444787 4:144823131-144823153 GAGGGTGGAGAGCGAGAGGAGGG - Intergenic
981878291 4:149576294-149576316 CAGGGTGGAGAGTGGGAGGAGGG - Intergenic
982517045 4:156366015-156366037 CAGGGTTGTTACCTTGAGGAAGG + Intergenic
983522074 4:168719721-168719743 GAGGGTGGAGAGCGGGAGGAGGG - Intronic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985644704 5:1079423-1079445 CAGGATGGTCCCCGTGGGGATGG + Exonic
985870950 5:2556467-2556489 CATGGTGGTGAGAGTGAGCAGGG + Intergenic
986788545 5:11138533-11138555 CAGGTTGGGCAGGGAGAGGATGG - Intronic
987167823 5:15219547-15219569 TAGTGTGGTCAGAGTAAGGAAGG + Intergenic
987561029 5:19520172-19520194 TAGGGTGGTGAGAGTGAAGATGG - Intronic
989661125 5:43798446-43798468 CAGAGGGGGCAGCTTGAGGAGGG + Intergenic
989667015 5:43866445-43866467 CAGGGTGGTCAGGGAGAACAGGG + Intergenic
990761156 5:59131001-59131023 CAGGGCTGTTAGCCTGAGGAAGG + Intronic
990893540 5:60673110-60673132 CAGGTTGGTCAGGGTGATCAAGG - Intronic
991004179 5:61811677-61811699 CAGGGTGGCAAGCCAGAGGAGGG + Intergenic
991227827 5:64293023-64293045 CAGAGTAGACAGGGTGAGGAGGG - Intronic
994842613 5:104946086-104946108 GAGGGTGGACAGTGGGAGGAGGG - Intergenic
994896449 5:105710154-105710176 CAGGATGTTGATCGTGAGGAAGG - Intergenic
995453731 5:112330882-112330904 GAGTGTGGACAGGGTGAGGAGGG + Intronic
995633074 5:114155029-114155051 GAGGGTGGAGAGTGTGAGGAGGG - Intergenic
996779493 5:127170661-127170683 CAGGGTGATCAGCCTGGTGAGGG - Intergenic
1000338717 5:160260800-160260822 CAGGGTTGGCTGAGTGAGGAGGG - Intronic
1001116372 5:168944201-168944223 AAGGGTTGTCAGCGATAGGAGGG - Intronic
1001426896 5:171628796-171628818 CAGGGCTGTCAGTGTGGGGAGGG - Intergenic
1001880379 5:175238835-175238857 GAGGGAGGTGAGCGTGAGGGTGG - Intergenic
1002400503 5:178989203-178989225 GAGGGTGGTGAGGGTGGGGAGGG - Intronic
1002400516 5:178989230-178989252 CAGGGTGGTGAGGGTGGGGAGGG - Intronic
1002779866 6:357717-357739 CAGGGTGGTCAACCTGAGCACGG + Intergenic
1004287901 6:14339613-14339635 CAGGTGGGTCAGGGGGAGGAGGG - Intergenic
1004365812 6:15011653-15011675 GAGGGTGGTGAGTGAGAGGAGGG + Intergenic
1004828551 6:19451120-19451142 CAGGGTGGTGGGTGGGAGGAGGG - Intergenic
1006258668 6:32850989-32851011 CAGGGTGATCAGGGTGACCATGG + Exonic
1006582694 6:35085995-35086017 CAGGGTGGTCAGCGTGAGGAGGG + Intronic
1006937845 6:37730746-37730768 CGGGGTGTTCAGCATGAGCATGG + Intergenic
1007085407 6:39140957-39140979 GAGGGGGGTGAGTGTGAGGAGGG + Intergenic
1007645345 6:43375941-43375963 CATGGTGGTCACCCTGAGGATGG + Intergenic
1008699423 6:54080955-54080977 CTGTGAGGTCAGGGTGAGGATGG - Intronic
1012404243 6:98876798-98876820 AAGGGTGGTGAGGGAGAGGACGG + Intronic
1013839788 6:114377746-114377768 AAGTCTGGTCAGAGTGAGGAAGG + Intergenic
1014069282 6:117162279-117162301 CAGAGTGGGCAGCGTGGAGACGG - Intergenic
1015281548 6:131440197-131440219 CTGGAAGGTCAGCGGGAGGATGG + Intergenic
1016675763 6:146766118-146766140 CAGGGTGGTAGGGGTGAGGGGGG + Intronic
1016894876 6:149041792-149041814 AAGGGTGGTCAGCATGGAGAGGG - Intronic
1017492758 6:154958781-154958803 CAGGGTGGGCAGCAGGATGAAGG - Intronic
1017816301 6:158018947-158018969 CATGGTGATGACCGTGAGGATGG + Intronic
1018726749 6:166618513-166618535 GAGGGAGGTCAGCGTGGGCAGGG + Intronic
1018839334 6:167507450-167507472 CAGGGGGGTCAGACAGAGGACGG - Intergenic
1018851270 6:167641710-167641732 CAAGGTGGTGAGGGTGATGATGG - Intergenic
1019419582 7:944835-944857 CAGGGTGGGTAGAGTGGGGATGG - Intronic
1019447095 7:1076902-1076924 CGGGGTGGTCAGCGAGGGGCTGG + Intronic
1019473982 7:1235413-1235435 CAGGATGGTCAGCGCCAGGCCGG + Intronic
1019907137 7:4073280-4073302 CAGAGTGGTGGGCGTGAGGTGGG - Intronic
1019912157 7:4107111-4107133 CAGGGTGGGGAGGGTGGGGAGGG + Intronic
1023274460 7:38503009-38503031 CAGGGCAGGCAGCGTGATGATGG + Intronic
1025976734 7:66376568-66376590 CAGAGGGGCCAGCGTGAGGCAGG + Intronic
1026037036 7:66837301-66837323 GAGGGAGGCCAGCGTGAGGGTGG - Intergenic
1026731416 7:72914912-72914934 CAGGTGGGTCAGGGTGGGGAGGG - Intronic
1026847684 7:73706903-73706925 CAGGGTGGACTGCCTCAGGAAGG - Intronic
1027112624 7:75452911-75452933 CAGGTGGGTCAGGGTGGGGAGGG + Intronic
1030170610 7:106599156-106599178 CAGGGTAGGCAGGGAGAGGAAGG - Intergenic
1032012653 7:128356954-128356976 CAGAGTGGTCAGGGAGTGGAGGG + Intronic
1032087777 7:128892805-128892827 CAGGCTGGTCAGGGTGAGCTGGG + Intronic
1034423721 7:151002126-151002148 CAGGGAGGCCAGAGTGAGGAGGG + Intronic
1034590107 7:152131488-152131510 CAGGCTGCAGAGCGTGAGGATGG + Intergenic
1035774537 8:2177991-2178013 GAGGGTGGTGGGCGGGAGGAGGG + Intergenic
1035781596 8:2232379-2232401 TAGGGGGGTCAGCATGCGGAGGG + Intergenic
1035938823 8:3873552-3873574 CAGGGTGGACGGTGGGAGGAGGG + Intronic
1036623347 8:10443862-10443884 CAGGGTGGCCAGAGAGAGAAAGG + Intergenic
1037604957 8:20430315-20430337 CTGAGGGGTTAGCGTGAGGACGG + Intergenic
1038459636 8:27705091-27705113 CAGGGTGGAAAGTGTGAGGGAGG - Intergenic
1040785848 8:51161128-51161150 CAGGTGGGACAGCCTGAGGAGGG + Intergenic
1041389845 8:57338589-57338611 AAGGGTGGACAGAGTTAGGAGGG - Intergenic
1041650231 8:60294990-60295012 CAAGGGGGTCAGGGTAAGGAGGG - Intergenic
1042041683 8:64598418-64598440 CAGATTGGTCAGCGTGAAGGAGG - Intronic
1047761958 8:127961067-127961089 TAGGGTGGTCAGGGGAAGGAAGG + Intergenic
1048083252 8:131151179-131151201 CAGGGTAGTGAGTCTGAGGATGG + Intergenic
1048340511 8:133534989-133535011 CAGTGTGGTCAGTGAAAGGAAGG + Intronic
1048876105 8:138837950-138837972 CAGGGTTGTCACCTTGAGGAGGG + Intronic
1050070780 9:1811068-1811090 GAGGGTGGAGAGCGGGAGGAGGG + Intergenic
1052789498 9:32861753-32861775 CAGGGTGGTAAGTGTTAAGAGGG - Intergenic
1054766254 9:69045002-69045024 CAGGGTGGTTAGCAGGAGGCTGG - Intronic
1054825196 9:69566309-69566331 CATGATGGTCAGCGTGGTGAAGG - Intronic
1055353362 9:75412380-75412402 CAGGGTGGGCAGAGTCAGGCAGG + Intergenic
1056587830 9:87939871-87939893 CAGGGTGGGGAGCGGGAGGGAGG + Intergenic
1056609037 9:88113074-88113096 CAGGGTGGGGAGCGGGAGGGAGG - Intergenic
1057545769 9:96019846-96019868 CAGGGTGGTGAGAGAGAGGAAGG + Intergenic
1057753500 9:97810755-97810777 CAAGGTGGTAAGAGTGAGAAGGG + Intergenic
1061826945 9:133264128-133264150 CATGGTTGTCAGGGTCAGGAGGG - Intronic
1061916901 9:133760084-133760106 CAGGGAGGGCTGCGTGAGGAGGG + Intergenic
1062270763 9:135707325-135707347 TAGGGTGGACAGCCTGAGGGTGG - Intronic
1186157067 X:6736851-6736873 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1186625746 X:11291629-11291651 CAAGGTGGTAAGGGAGAGGAAGG - Intronic
1189960209 X:46317102-46317124 GAAGGTGGTGAGCATGAGGAAGG + Intergenic
1190715235 X:53097256-53097278 CTGGGTGGTGAGGGTGAGGGTGG + Intergenic
1191630976 X:63321839-63321861 GAGGGTGGACGGCGGGAGGAGGG + Intergenic
1193698813 X:84739819-84739841 CAGGGTGGTTGGAGAGAGGAGGG - Intergenic
1193947611 X:87757401-87757423 GAGGGTGGAGAGCGGGAGGAGGG - Intergenic
1195320636 X:103719087-103719109 CTGGGTGGTCATGGTGAGCACGG + Exonic
1196200678 X:112882551-112882573 GAGGGTGGACAGTGGGAGGAGGG + Intergenic
1196332210 X:114485685-114485707 GAGGGTGGGCGGGGTGAGGAGGG - Intergenic
1198733232 X:139756818-139756840 CAGGGTGGAGAGTGAGAGGAGGG + Intronic
1200099984 X:153685508-153685530 CAGGGTGGCCGACGTGGGGAGGG + Intronic