ID: 1006589182

View in Genome Browser
Species Human (GRCh38)
Location 6:35141572-35141594
Sequence AAGCCGAGCCACACCCAGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006589176_1006589182 23 Left 1006589176 6:35141526-35141548 CCAGAGCATGCATGGGGCTTTTC 0: 1
1: 0
2: 1
3: 19
4: 118
Right 1006589182 6:35141572-35141594 AAGCCGAGCCACACCCAGGAGGG 0: 1
1: 0
2: 0
3: 21
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006589182 Original CRISPR AAGCCGAGCCACACCCAGGA GGG Exonic
900231799 1:1562774-1562796 AAGCCGTGCCCCACACAGGGTGG + Intronic
900881559 1:5385381-5385403 CAGCAGAGCCACAGCCAGGCCGG - Intergenic
901006388 1:6173685-6173707 GAGCCCAGCGAGACCCAGGAGGG + Intronic
901237871 1:7677213-7677235 TACCCGAGCCCCACCCAGGAAGG + Intronic
902612549 1:17605692-17605714 GAGCCGTGGCACACCGAGGATGG + Intronic
903816439 1:26067463-26067485 AAGTCGAGCCTGATCCAGGATGG - Exonic
904760569 1:32801161-32801183 AAGACGAGAGACACACAGGAAGG + Intronic
905321471 1:37120329-37120351 AATCTCAGCCACACCAAGGAGGG - Intergenic
906366674 1:45216022-45216044 AGGCCCACCCACATCCAGGAGGG - Intronic
907604943 1:55806943-55806965 CAGCTGATCCACACCCATGAAGG + Intergenic
916128152 1:161589433-161589455 AAGCTGAGCCAGGCCCAGAATGG - Intronic
916138070 1:161671263-161671285 AAGCCGAGCCAGGCCCAGAATGG - Intronic
919130276 1:193442139-193442161 AAGTCAAGCCACACCCAGAGGGG - Intergenic
919303839 1:195804499-195804521 AAGGTGAGGCACACCAAGGAAGG - Intergenic
919888472 1:201952541-201952563 ATGCCCAGCCACACTGAGGAGGG - Intergenic
920039226 1:203085102-203085124 CTGCTCAGCCACACCCAGGATGG + Intronic
921086292 1:211796433-211796455 AAGCTGAGGGACACCAAGGATGG + Intronic
922671305 1:227510299-227510321 AAGCCGACTCTCACCCAGGGTGG - Intergenic
923151858 1:231240935-231240957 AAGCAGAGGCCAACCCAGGACGG + Intronic
923861089 1:237892771-237892793 AACCCCAGACCCACCCAGGATGG - Intergenic
924439661 1:244075529-244075551 AAGGCAAGCCTCCCCCAGGAGGG - Intergenic
924632337 1:245752719-245752741 AATTAGAGCCACAGCCAGGAAGG + Intronic
1066049173 10:31619173-31619195 CAGCCCAGCCCCACCCATGAGGG - Intergenic
1070467322 10:76736650-76736672 AAGCCATGACACACCCAGGAAGG + Intergenic
1071497299 10:86177991-86178013 AAGCCGAGACACAGCCTTGAGGG + Intronic
1074190158 10:111128599-111128621 TAGCAGAGGCTCACCCAGGATGG + Intergenic
1074767091 10:116707415-116707437 AGGCCCAGCCCCAGCCAGGAAGG + Intronic
1075345327 10:121677973-121677995 GAGGGGAGCCACAACCAGGATGG + Intergenic
1076233025 10:128837923-128837945 AAGCCGAATCAAATCCAGGAGGG + Intergenic
1076727889 10:132421829-132421851 CCCCCCAGCCACACCCAGGAAGG - Intergenic
1076923456 10:133467509-133467531 GAGCAGGGCCACACCCATGAGGG + Intergenic
1077069037 11:659421-659443 AAACCTAGACACACCCCGGATGG + Intronic
1077108755 11:853039-853061 ACCCACAGCCACACCCAGGACGG - Intronic
1079184251 11:18221740-18221762 AGGTGCAGCCACACCCAGGAGGG + Intronic
1079375631 11:19889189-19889211 AAGCCCGGACTCACCCAGGAGGG - Intronic
1082110918 11:48272814-48272836 AAGCCCAGACCCACCCAGCAAGG + Intergenic
1082822845 11:57556251-57556273 GAGCCGAATCACACCCAGGCAGG - Intronic
1083185289 11:61014027-61014049 CAGCCCTCCCACACCCAGGATGG - Intronic
1083822986 11:65182979-65183001 TAGCCGAGTCCCACCCAGGATGG - Intronic
1084275727 11:68050079-68050101 CAGCCGTCCCACCCCCAGGAAGG - Intronic
1084326633 11:68404080-68404102 CAGCCCAGGCAGACCCAGGAGGG - Intronic
1084779062 11:71396892-71396914 AGGCCCACCCACATCCAGGAGGG - Intergenic
1086345550 11:85892136-85892158 AAGCAGAGCCAGACACAGCAGGG + Intronic
1089065060 11:115656439-115656461 AAGCCTAGAGACTCCCAGGAGGG - Intergenic
1090771396 11:129922710-129922732 AAGCCGAGCAAAACCCTGCAGGG - Intronic
1093954709 12:25202504-25202526 AAGGTGAGCCTTACCCAGGAGGG + Intronic
1094042412 12:26132001-26132023 AAGCAGAGCTTCACCAAGGAAGG - Intronic
1095982147 12:47979861-47979883 AAGCCCACCCACAGCCAGGTGGG - Intronic
1096559531 12:52425606-52425628 AAGCCAAGGAACACCGAGGATGG + Intronic
1097189644 12:57213218-57213240 GAGGTGGGCCACACCCAGGAAGG + Exonic
1097721839 12:63030059-63030081 AAGCCGAGGACCAGCCAGGAGGG - Intergenic
1102217072 12:111169226-111169248 AAGCCCAGCAACACCAAGGATGG + Intronic
1103583509 12:121934085-121934107 AAGTGGAGAAACACCCAGGAAGG + Intronic
1104738463 12:131154575-131154597 GGGCTGAGCCACAGCCAGGAGGG - Intergenic
1104749784 12:131231136-131231158 AATCCCAGCCAAGCCCAGGAAGG + Intergenic
1105209819 13:18250928-18250950 GACCCGAGGCACAGCCAGGAAGG + Intergenic
1105978538 13:25495169-25495191 AAGCCCAGCCCCACCCTGGAAGG - Intronic
1113507996 13:110830505-110830527 AAGCCGAGGCACAGCTGGGATGG + Intergenic
1115456234 14:33606795-33606817 AAGACAAGCCACAGACAGGAAGG + Intronic
1117501620 14:56358055-56358077 AAGAGGAGCCACAGCCAGGATGG - Intergenic
1119423744 14:74523105-74523127 ACCCCGAGCCCTACCCAGGATGG + Intronic
1119446955 14:74673019-74673041 GAGCCCAGCCACATCCATGAGGG - Intronic
1120789015 14:88562527-88562549 AGGCAGAACCAAACCCAGGAGGG + Intergenic
1121125942 14:91406841-91406863 AAGGGGAGCCACACTCAGCATGG - Intronic
1123697914 15:22892331-22892353 AAGCCAAGCCACCCCCAGCGTGG + Intronic
1129775796 15:78235481-78235503 AAGCCAAGGAACACCCAGGATGG - Intronic
1132542212 16:515847-515869 AAGGCGAGGCTCACACAGGAGGG + Intronic
1133325184 16:4937624-4937646 AAGCCCTGCCACCCCCAGGTTGG + Intronic
1136365643 16:29807935-29807957 AAGGGGAGCCACTCCCAGGGCGG + Intronic
1137359315 16:47798283-47798305 TAGCAGATGCACACCCAGGAAGG - Intergenic
1138335819 16:56252077-56252099 AAGTAGGGCCACACCAAGGAAGG + Intronic
1138492540 16:57384681-57384703 ATGCTGCGCCACACCCAGCAGGG - Exonic
1140235751 16:73157113-73157135 AAGTCTAGCCACCCACAGGAGGG + Intergenic
1140903448 16:79391392-79391414 AAGCAGAGCCACAGATAGGAGGG + Intergenic
1143844831 17:9766242-9766264 AAGACCAGCCACTTCCAGGAAGG + Intergenic
1144134936 17:12284694-12284716 AAGCCGAGAAACACCCAGATTGG - Intergenic
1148941977 17:51222689-51222711 ACGCCCAGCGACACCCAGGTAGG + Intronic
1153159504 18:2187801-2187823 AAGCCAAGAGTCACCCAGGAGGG + Intergenic
1153285968 18:3453961-3453983 AAGCTGAGCCACAACTAGGAGGG + Intronic
1153931981 18:9886987-9887009 AAGCCCAGCCAGCCCAAGGAGGG + Exonic
1153932059 18:9887302-9887324 AAGCCCAGCCAGCCCAAGGAGGG + Exonic
1160457285 18:79011140-79011162 CAGCCCAGCCACACCCATGCAGG - Intergenic
1160587178 18:79919222-79919244 AAGCTGGGGCACACCCAGCATGG + Exonic
1161249936 19:3275242-3275264 CAGCCCAGCCCCACCCAGCAGGG + Intronic
1161898286 19:7099114-7099136 AAGCCGAGCCATGGCCAGGACGG + Intergenic
1162491620 19:10995796-10995818 AAGGGGAGCCTCACCCGGGAGGG + Intronic
1163692080 19:18743577-18743599 AATCAGGGCCACCCCCAGGACGG + Intronic
1164699595 19:30275191-30275213 GAGCCTAACCACACTCAGGATGG - Intronic
1165916751 19:39265359-39265381 AAACCGATCCAGACCCAGGTCGG + Intergenic
1166669489 19:44701376-44701398 GAGCCGAGCCCCAACCAGGAAGG + Exonic
1167508825 19:49885065-49885087 AAGGTGAGCCACAGCCAGGTGGG - Intronic
1167616932 19:50540007-50540029 AGACCGAGAAACACCCAGGAAGG - Intronic
925175149 2:1777979-1778001 ATGCCGAGCCACAACCAGTCCGG + Intergenic
926103545 2:10136341-10136363 AGGCCCACCCACACCCAGGAAGG - Intergenic
926697650 2:15782007-15782029 AAGCCCAGACACACCCAAGAGGG - Intergenic
927133824 2:20082270-20082292 TAGCGGAGCCACTCCCATGATGG - Intergenic
933790346 2:85879192-85879214 GAGCTGAGCCACAGCCAGAAAGG + Intronic
934764906 2:96875273-96875295 AACCCCATCCAAACCCAGGAAGG + Intergenic
938653642 2:133408913-133408935 AAGCCCAGCCACACACAGCAGGG + Intronic
940819759 2:158339794-158339816 AAGCTCAGTCACACCCAGGCTGG - Intronic
941740939 2:169034509-169034531 AAGCTGAGCCACAAGAAGGATGG + Intergenic
942752055 2:179299433-179299455 AAGCCTAGCGGCACACAGGAGGG + Intergenic
948103840 2:235396994-235397016 AAGCCCACCCACACACTGGAAGG + Intergenic
1171986583 20:31665292-31665314 GAGGCCAGCCCCACCCAGGAGGG - Exonic
1172359298 20:34301224-34301246 CAGCCGGGCCCCTCCCAGGAGGG - Intronic
1175001804 20:55637037-55637059 GAGTCCAGCCACACACAGGAGGG - Intergenic
1175657371 20:60782739-60782761 CAGTCCAGGCACACCCAGGATGG - Intergenic
1176296440 21:5075855-5075877 ATGACAAGCCAGACCCAGGATGG - Intergenic
1176369185 21:6052315-6052337 AGGCCACGCCACACCCAGGCTGG - Intergenic
1177399866 21:20588463-20588485 ATGCAGACACACACCCAGGAGGG + Intergenic
1179552971 21:42154964-42154986 AATCAGAGCCAGACACAGGAGGG - Intergenic
1179754334 21:43486226-43486248 AGGCCACGCCACACCCAGGCTGG + Intergenic
1179860609 21:44186266-44186288 ATGACAAGCCAGACCCAGGATGG + Intergenic
1180023740 21:45146513-45146535 ACGCCAAGCCACTCCCAGGGAGG - Intronic
1180766443 22:18348472-18348494 GACCCGAGGCACAGCCAGGAAGG - Intergenic
1180779872 22:18513906-18513928 GACCCGAGGCACAGCCAGGAAGG + Intergenic
1180812586 22:18771227-18771249 GACCCGAGGCACAGCCAGGAAGG + Intergenic
1181090819 22:20471305-20471327 AGGCAGACCCACACCCAGGTGGG - Intronic
1181198745 22:21205475-21205497 GACCCGAGGCACAGCCAGGAAGG + Intergenic
1181400992 22:22650324-22650346 GACCCGAGGCACAGCCAGGAAGG - Intergenic
1181648527 22:24246558-24246580 GACCCGAGGCACAGCCAGGAAGG + Intergenic
1181702969 22:24631416-24631438 GATCCGAGGCACAGCCAGGAAGG - Intergenic
1183178098 22:36239021-36239043 TGGCCGGGCCACACCCAGGCTGG - Intronic
1184280279 22:43433575-43433597 AGGCCTAGCAACCCCCAGGAAGG + Intronic
1203228060 22_KI270731v1_random:89362-89384 GACCCGAGGCACAGCCAGGAAGG - Intergenic
949876394 3:8628689-8628711 AAGCCAAGGAACACCAAGGACGG + Intronic
950463030 3:13136490-13136512 AAGACAAACCACACCCAGCAAGG + Intergenic
954148603 3:48646551-48646573 ACACAGAGCCACACACAGGAGGG - Intronic
955685377 3:61543998-61544020 AAGATGATCCACACACAGGATGG + Intergenic
960511644 3:118556316-118556338 GAGCACAGCCACACCCAGAATGG + Intergenic
960668846 3:120137448-120137470 AAGCCCAGCCAGACTCAGGTGGG - Intergenic
961380276 3:126492329-126492351 CAGCCGAGGCACACGCAGGAAGG + Intronic
961603543 3:128077592-128077614 TAGCTGAGCCTCACCCAGGATGG + Intronic
961740070 3:129027510-129027532 AAGCCCTGCAGCACCCAGGAGGG - Intronic
965324228 3:167282023-167282045 ATGCCCAGCCACACCAAAGATGG - Intronic
967850829 3:194081482-194081504 AAGCCTATCCTTACCCAGGATGG - Intergenic
968090659 3:195896355-195896377 AGGCTGAGCCAGACCCTGGAAGG + Intronic
968468886 4:767732-767754 AAGCCCATCAACTCCCAGGACGG + Exonic
968596628 4:1489389-1489411 AAGCAGAGACACAGCCTGGACGG - Intergenic
968920474 4:3519677-3519699 AAGCCCAGCCCCACACACGAGGG + Intronic
969442136 4:7223728-7223750 AAGCCCAGCCCTTCCCAGGAAGG - Intronic
971381861 4:26106539-26106561 CATCCGAGCCACAATCAGGAAGG - Intergenic
973922704 4:55704902-55704924 AAGGGGAGCCACATCCAAGAAGG - Intergenic
977238361 4:94536171-94536193 AAGCAGAGACACTCGCAGGAAGG + Intronic
978407884 4:108399020-108399042 ATCCCAAGCCACAGCCAGGAAGG + Intergenic
980099235 4:128524587-128524609 CAGCCAAGACAAACCCAGGACGG - Intergenic
981682638 4:147417624-147417646 AAGCTGAGCCTCACCCAAAATGG + Intergenic
983317040 4:166145702-166145724 AAGAAGAGACACTCCCAGGAGGG + Intergenic
992972371 5:82075023-82075045 AAGCTGTGCAACACCCAGGAGGG - Intronic
993888915 5:93448795-93448817 AAGCCCACCCACACCAGGGAGGG + Intergenic
997367216 5:133333711-133333733 AAGCAGAGTCACACCCAGCGAGG + Intronic
997718802 5:136061975-136061997 AGCCCCAGCCTCACCCAGGATGG - Intronic
997737447 5:136224474-136224496 AGGGCGAGGCACACCCAGCATGG - Intronic
1000037666 5:157461057-157461079 AAGTGGAGCCACACCAAGGAAGG - Intronic
1000047246 5:157531834-157531856 AAGCCAAGGAACACCAAGGATGG + Intronic
1003571863 6:7261320-7261342 AAGCAAAACCACACACAGGACGG + Intergenic
1005402335 6:25447793-25447815 AAGCCAAGCCACCCCCAGTCTGG - Intronic
1006102293 6:31693104-31693126 AAGCAGGGCCACACCCCGGCGGG + Exonic
1006589182 6:35141572-35141594 AAGCCGAGCCACACCCAGGAGGG + Exonic
1007607815 6:43129190-43129212 ATCCCGAGCCACACACTGGAAGG - Exonic
1018615600 6:165683707-165683729 AGGCTGAGCCTCACACAGGAGGG + Intronic
1021261975 7:18469753-18469775 AAGCTGAGCTACATGCAGGAAGG - Intronic
1026469490 7:70682796-70682818 TGGCGGAGCCACACCCAAGATGG + Intronic
1029460365 7:100690881-100690903 CAGCCAAGACACAGCCAGGATGG - Intergenic
1029991588 7:104967410-104967432 AAGCAGAGCCCCAGCCAGTAGGG + Intergenic
1032736135 7:134694280-134694302 AAGCCACACCACACACAGGAGGG + Intergenic
1034405855 7:150902047-150902069 AAGAAGAGGCACATCCAGGAAGG + Intergenic
1034470887 7:151253814-151253836 CAGCAGAGCCACACCCTGGAAGG - Intronic
1035774411 8:2176904-2176926 ATGCCCAGCCTCACCAAGGAGGG - Intergenic
1036121271 8:6020388-6020410 ACGCAGAGCCTCACCCAGGAAGG + Intergenic
1039045655 8:33446908-33446930 AAAGAGAGGCACACCCAGGAGGG - Intronic
1041462733 8:58129725-58129747 AGGCAGAGCCACACCCATGCAGG + Intronic
1049106900 8:140619647-140619669 AAGAAGAGCCACACACATGAGGG + Intronic
1050348619 9:4718175-4718197 AAGCCAATACACACACAGGAAGG + Intronic
1055011326 9:71569253-71569275 AAGCCAAGGGACACCAAGGATGG + Intergenic
1055034797 9:71806977-71806999 AAGTGGAGCCACATCCAGGAAGG - Intronic
1056072294 9:83000155-83000177 AATACGAGCCATACCCAGGGTGG + Exonic
1057885740 9:98828219-98828241 CAGCTGGGTCACACCCAGGAAGG - Intronic
1060398999 9:123336758-123336780 GAGTGGAGCCACACCCAAGAGGG - Intergenic
1061898071 9:133658768-133658790 AAGCCAGGCCACACCCAGTGAGG - Exonic
1199252566 X:145680296-145680318 AGGCCAAGCAAAACCCAGGAGGG - Intergenic