ID: 1006589727

View in Genome Browser
Species Human (GRCh38)
Location 6:35145651-35145673
Sequence ACGTGCGGTTCTGTATCATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 34}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006589727 Original CRISPR ACGTGCGGTTCTGTATCATA AGG (reversed) Intronic
907639448 1:56171344-56171366 ATGCTCTGTTCTGTATCATAGGG - Intergenic
923659902 1:235949039-235949061 ACTTGATGTTCTGTATGATAAGG - Intergenic
1090752205 11:129756864-129756886 ACGTGCAGTTTTGTTACATAGGG - Intergenic
1093517572 12:20007908-20007930 ATGTGCTGTACTGTATTATATGG - Intergenic
1093899166 12:24610104-24610126 AAGTGGGGTGCTGGATCATATGG + Intergenic
1107539878 13:41378725-41378747 AGGTACGTTTCTGTATGATAAGG + Intergenic
1115081570 14:29458576-29458598 ACGTGCTATTTTGTATCTTATGG - Intergenic
1121967882 14:98327110-98327132 AACTGCTTTTCTGTATCATATGG - Intergenic
1124789456 15:32713690-32713712 ACGTGCAGTGCAGTATCAAAAGG - Intergenic
1127721344 15:61703032-61703054 GCGTGCAGTTCTGTCTCATGTGG - Intergenic
1127934550 15:63624318-63624340 ATGTGCTGTTCTGTAACAGAAGG + Exonic
1129284342 15:74512210-74512232 AAATGAGGTTCAGTATCATATGG - Intergenic
1141276115 16:82589705-82589727 ACGTGCGGGTTTGTTACATAAGG + Intergenic
1142723171 17:1791264-1791286 ACGTGTGGTTCTGTCTCAGTGGG - Intronic
1159027388 18:63196671-63196693 CCGTGCGGCCCTTTATCATACGG + Intronic
1167109662 19:47451934-47451956 ATGTGTGGTTCTGGATCAAATGG + Intronic
931784368 2:65606046-65606068 AAGTGAGATTCTGGATCATAAGG - Intergenic
934127568 2:88913268-88913290 ACCAGTGGTTCTGTATCATGGGG - Intergenic
939111414 2:138012675-138012697 ACGAGCAGTTTTGTATCATCAGG - Intronic
1176266132 20:64210316-64210338 ACGTGCGGTTCTGGTTCTGAGGG + Intronic
960815887 3:121672150-121672172 ACGTGGGTTGCTGGATCATATGG + Intronic
986215318 5:5714039-5714061 ACGTGAGTTTCTCAATCATAAGG + Intergenic
988316274 5:29633675-29633697 ACCTGCAGTTCTTTAGCATATGG + Intergenic
1006589727 6:35145651-35145673 ACGTGCGGTTCTGTATCATAAGG - Intronic
1009371699 6:62911966-62911988 AAGTGGGGTTGTGGATCATATGG - Intergenic
1012684994 6:102235482-102235504 ATGTGCAGTTCTGTATAAAAGGG - Intergenic
1016756503 6:147693425-147693447 ACGTGGGGCTCTGCAGCATACGG - Intronic
1033171042 7:139084583-139084605 TCCTCCAGTTCTGTATCATATGG - Intronic
1052893756 9:33728149-33728171 ACGTGCAGTTTTGTTACATAGGG - Intergenic
1057979706 9:99648309-99648331 ACGTGAGGTTCTGTATAAGCAGG + Intergenic
1188569861 X:31571593-31571615 ATGTGCAGTACTGTAGCATATGG - Intronic
1193644798 X:84054694-84054716 ACGTGCAGTTTTGTTACATAGGG + Intergenic
1199837886 X:151611864-151611886 ACGTGCAGGTTTGTTTCATATGG + Intronic
1200826952 Y:7656524-7656546 ACGTGCAGGTTTGTAACATAGGG + Intergenic
1202107029 Y:21383014-21383036 ACGTGCAGGTTTGTAACATAGGG + Exonic