ID: 1006592835

View in Genome Browser
Species Human (GRCh38)
Location 6:35170827-35170849
Sequence CACACACCTGTACCATCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006592835_1006592838 -9 Left 1006592835 6:35170827-35170849 CCAGAGGATGGTACAGGTGTGTG No data
Right 1006592838 6:35170841-35170863 AGGTGTGTGGAGGAAGCAAGAGG No data
1006592835_1006592841 3 Left 1006592835 6:35170827-35170849 CCAGAGGATGGTACAGGTGTGTG No data
Right 1006592841 6:35170853-35170875 GAAGCAAGAGGAGAGGGACCTGG No data
1006592835_1006592844 28 Left 1006592835 6:35170827-35170849 CCAGAGGATGGTACAGGTGTGTG No data
Right 1006592844 6:35170878-35170900 TGACTGAGAAGGTTATAGTCAGG No data
1006592835_1006592839 -4 Left 1006592835 6:35170827-35170849 CCAGAGGATGGTACAGGTGTGTG No data
Right 1006592839 6:35170846-35170868 TGTGGAGGAAGCAAGAGGAGAGG No data
1006592835_1006592845 29 Left 1006592835 6:35170827-35170849 CCAGAGGATGGTACAGGTGTGTG No data
Right 1006592845 6:35170879-35170901 GACTGAGAAGGTTATAGTCAGGG No data
1006592835_1006592842 17 Left 1006592835 6:35170827-35170849 CCAGAGGATGGTACAGGTGTGTG No data
Right 1006592842 6:35170867-35170889 GGGACCTGGTCTGACTGAGAAGG No data
1006592835_1006592840 -3 Left 1006592835 6:35170827-35170849 CCAGAGGATGGTACAGGTGTGTG No data
Right 1006592840 6:35170847-35170869 GTGGAGGAAGCAAGAGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006592835 Original CRISPR CACACACCTGTACCATCCTC TGG (reversed) Intergenic
No off target data available for this crispr