ID: 1006593752

View in Genome Browser
Species Human (GRCh38)
Location 6:35177648-35177670
Sequence TGGGACCTTAAAAGAGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006593752_1006593757 13 Left 1006593752 6:35177648-35177670 CCTTGATCTCTTTTAAGGTCCCA No data
Right 1006593757 6:35177684-35177706 GAGATCTAACAATTACTGCCTGG No data
1006593752_1006593758 14 Left 1006593752 6:35177648-35177670 CCTTGATCTCTTTTAAGGTCCCA No data
Right 1006593758 6:35177685-35177707 AGATCTAACAATTACTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006593752 Original CRISPR TGGGACCTTAAAAGAGATCA AGG (reversed) Intergenic
No off target data available for this crispr