ID: 1006593961

View in Genome Browser
Species Human (GRCh38)
Location 6:35179251-35179273
Sequence GCCTAAACACCCTGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006593956_1006593961 -6 Left 1006593956 6:35179234-35179256 CCAACACTGTGGGGGAAGCCTAA No data
Right 1006593961 6:35179251-35179273 GCCTAAACACCCTGGGGAGAGGG No data
1006593949_1006593961 17 Left 1006593949 6:35179211-35179233 CCCAGACAGGCAGGCAAACAAAC No data
Right 1006593961 6:35179251-35179273 GCCTAAACACCCTGGGGAGAGGG No data
1006593946_1006593961 26 Left 1006593946 6:35179202-35179224 CCTCAGGGCCCCAGACAGGCAGG No data
Right 1006593961 6:35179251-35179273 GCCTAAACACCCTGGGGAGAGGG No data
1006593950_1006593961 16 Left 1006593950 6:35179212-35179234 CCAGACAGGCAGGCAAACAAACC No data
Right 1006593961 6:35179251-35179273 GCCTAAACACCCTGGGGAGAGGG No data
1006593948_1006593961 18 Left 1006593948 6:35179210-35179232 CCCCAGACAGGCAGGCAAACAAA No data
Right 1006593961 6:35179251-35179273 GCCTAAACACCCTGGGGAGAGGG No data
1006593955_1006593961 -5 Left 1006593955 6:35179233-35179255 CCCAACACTGTGGGGGAAGCCTA No data
Right 1006593961 6:35179251-35179273 GCCTAAACACCCTGGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006593961 Original CRISPR GCCTAAACACCCTGGGGAGA GGG Intergenic
No off target data available for this crispr