ID: 1006597517

View in Genome Browser
Species Human (GRCh38)
Location 6:35204150-35204172
Sequence AGAATGGTGTGAACCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2703
Summary {0: 18, 1: 377, 2: 450, 3: 646, 4: 1212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006597517_1006597521 3 Left 1006597517 6:35204150-35204172 CCTCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 1006597521 6:35204176-35204198 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
1006597517_1006597525 12 Left 1006597517 6:35204150-35204172 CCTCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 1006597525 6:35204185-35204207 TCCCGAGTAGCTGGGACTCCAGG 0: 174
1: 56759
2: 179427
3: 267765
4: 192302
1006597517_1006597523 4 Left 1006597517 6:35204150-35204172 CCTCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 1006597523 6:35204177-35204199 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006597517 Original CRISPR AGAATGGTGTGAACCCCAGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr