ID: 1006598212

View in Genome Browser
Species Human (GRCh38)
Location 6:35208951-35208973
Sequence CAGTGGAGAGAGAAGGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006598203_1006598212 2 Left 1006598203 6:35208926-35208948 CCAAAAGGATGGACCCCTCTCCC No data
Right 1006598212 6:35208951-35208973 CAGTGGAGAGAGAAGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006598212 Original CRISPR CAGTGGAGAGAGAAGGGAGC AGG Intergenic
No off target data available for this crispr