ID: 1006600580

View in Genome Browser
Species Human (GRCh38)
Location 6:35222796-35222818
Sequence GTGCTGCATTTCCCCACACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 165}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006600571_1006600580 10 Left 1006600571 6:35222763-35222785 CCCAAATCCTCCCCACCAACACA 0: 1
1: 0
2: 3
3: 38
4: 324
Right 1006600580 6:35222796-35222818 GTGCTGCATTTCCCCACACCAGG 0: 1
1: 0
2: 0
3: 15
4: 165
1006600573_1006600580 3 Left 1006600573 6:35222770-35222792 CCTCCCCACCAACACATGCTCAC 0: 1
1: 1
2: 8
3: 73
4: 599
Right 1006600580 6:35222796-35222818 GTGCTGCATTTCCCCACACCAGG 0: 1
1: 0
2: 0
3: 15
4: 165
1006600570_1006600580 11 Left 1006600570 6:35222762-35222784 CCCCAAATCCTCCCCACCAACAC 0: 1
1: 0
2: 3
3: 36
4: 462
Right 1006600580 6:35222796-35222818 GTGCTGCATTTCCCCACACCAGG 0: 1
1: 0
2: 0
3: 15
4: 165
1006600577_1006600580 -2 Left 1006600577 6:35222775-35222797 CCACCAACACATGCTCACCTGGT 0: 1
1: 0
2: 1
3: 22
4: 191
Right 1006600580 6:35222796-35222818 GTGCTGCATTTCCCCACACCAGG 0: 1
1: 0
2: 0
3: 15
4: 165
1006600574_1006600580 0 Left 1006600574 6:35222773-35222795 CCCCACCAACACATGCTCACCTG 0: 1
1: 0
2: 2
3: 69
4: 403
Right 1006600580 6:35222796-35222818 GTGCTGCATTTCCCCACACCAGG 0: 1
1: 0
2: 0
3: 15
4: 165
1006600572_1006600580 9 Left 1006600572 6:35222764-35222786 CCAAATCCTCCCCACCAACACAT 0: 1
1: 0
2: 2
3: 39
4: 309
Right 1006600580 6:35222796-35222818 GTGCTGCATTTCCCCACACCAGG 0: 1
1: 0
2: 0
3: 15
4: 165
1006600575_1006600580 -1 Left 1006600575 6:35222774-35222796 CCCACCAACACATGCTCACCTGG 0: 1
1: 0
2: 0
3: 19
4: 204
Right 1006600580 6:35222796-35222818 GTGCTGCATTTCCCCACACCAGG 0: 1
1: 0
2: 0
3: 15
4: 165
1006600578_1006600580 -5 Left 1006600578 6:35222778-35222800 CCAACACATGCTCACCTGGTGCT 0: 1
1: 0
2: 1
3: 10
4: 227
Right 1006600580 6:35222796-35222818 GTGCTGCATTTCCCCACACCAGG 0: 1
1: 0
2: 0
3: 15
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006600580 Original CRISPR GTGCTGCATTTCCCCACACC AGG Intronic
900295165 1:1945348-1945370 CTGCTGCACTTCCCCAGCCCGGG - Intronic
900726205 1:4217994-4218016 GTGCTGCAATCCCCCTCTCCTGG + Intergenic
901377161 1:8847768-8847790 GGGCTGCCCTTCCCCAGACCAGG + Intergenic
902684053 1:18064327-18064349 CAGCTGCATTTCCCCAGAGCAGG + Intergenic
902858795 1:19229381-19229403 GTGCTGCCTTTGCCCTCACTTGG - Intronic
902889265 1:19430027-19430049 CTGCTCCATTTCCCCAGCCCAGG + Intronic
903442747 1:23400789-23400811 CTGCTGCATTTCCTCACTCCAGG + Intronic
906129805 1:43449363-43449385 GTGCTGCAGGACCCCTCACCTGG - Intronic
906411430 1:45582546-45582568 AAGCTGCAATTCCTCACACCTGG - Intergenic
906555340 1:46706999-46707021 GTGCTGAACTGCCCCACTCCTGG + Intronic
909037408 1:70609665-70609687 CTGCTGCACTTCACCACACCTGG + Intergenic
915066769 1:153231452-153231474 GAGCAGCACTTCCCCAAACCAGG + Intergenic
915271969 1:154759788-154759810 TTGCTGCATTACACCAAACCTGG - Intronic
917665754 1:177223784-177223806 GTGATGCATTTCCCCACTGCTGG - Intronic
919867370 1:201792518-201792540 GTGCTGCCTTTCCCCATCCAGGG - Intronic
920659233 1:207901374-207901396 GTGCTGCAGTTCCCCTTAGCAGG - Intronic
921558360 1:216626571-216626593 GTGCTGCATTTCACTGCCCCAGG - Intronic
922706725 1:227794251-227794273 GTGCTGCAGCTCCACACCCCAGG - Intergenic
1073466829 10:103699146-103699168 GTGCTGAATGTCCACAGACCCGG + Intronic
1073870680 10:107860401-107860423 GTGCAGCATTTCCCAACAGCAGG + Intergenic
1075741596 10:124699543-124699565 CTTCTCCATTTCCCCACCCCGGG + Intronic
1076647154 10:131961326-131961348 GTGCTGCCTTTACTCACATCTGG - Intergenic
1079082920 11:17426638-17426660 GTGTTGCAATTTCCCACACTGGG + Intronic
1079350365 11:19686662-19686684 ATGCTGCTTTTTCCCACACTGGG - Intronic
1080777858 11:35402775-35402797 GTGGTGTCTTTCCCGACACCAGG - Intronic
1082934229 11:58639773-58639795 GTGCTGCCTCTCCCCATACAGGG - Intergenic
1084377183 11:68785416-68785438 GAGGTGCATGTCACCACACCTGG - Intronic
1085289441 11:75387223-75387245 CTGCTGTATTTCCCCCCAGCAGG + Intergenic
1086378845 11:86230138-86230160 GTGCGCCATGTCCCCACCCCAGG - Intergenic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1092282030 12:7105014-7105036 GAGCTGCATCTCCCTCCACCAGG + Intronic
1092282939 12:7110813-7110835 GTGCTGGATTACCCCAAACAGGG - Intergenic
1092842492 12:12556427-12556449 GTGGTGCATGCCACCACACCCGG - Intronic
1093687414 12:22072376-22072398 GTCTTGCATTTCCCTACACAGGG + Intronic
1094463091 12:30719225-30719247 ATGCTGCATTTCTCCTCCCCAGG - Intronic
1095833149 12:46608982-46609004 GTCCTGCCTTTCCCCAGCCCTGG - Intergenic
1099119622 12:78672153-78672175 GGCCTGGATTTCCCCAGACCTGG + Intergenic
1101190465 12:102327123-102327145 GTGCTCCCTCTCCCCAGACCTGG - Intergenic
1101988014 12:109462384-109462406 GTATTGCATTTCCCCCCACTTGG - Intronic
1102141175 12:110616395-110616417 GTGCTGCATGCCACCACGCCCGG + Intronic
1102703249 12:114858545-114858567 TTCCTCCAGTTCCCCACACCTGG - Intergenic
1103070110 12:117934309-117934331 GTGCTTCATTTCTCTACTCCTGG - Intronic
1103469635 12:121169767-121169789 GAGGTGCATGCCCCCACACCTGG - Intronic
1103728780 12:123012523-123012545 CTGCCCCTTTTCCCCACACCTGG - Intronic
1103839252 12:123849531-123849553 GTGGGCCATTTCCCTACACCGGG + Intronic
1104974203 12:132545100-132545122 GTGCCGCACTGCCCCACACTGGG - Intronic
1108910229 13:55540651-55540673 GTGCTGCATTTGCACATGCCTGG + Intergenic
1114653849 14:24304107-24304129 CTGCTGCACTTCTCCACTCCTGG + Exonic
1114722525 14:24897560-24897582 GTGCTGCATTGAACCCCACCTGG + Intronic
1118317309 14:64733063-64733085 GTGCTGGTGCTCCCCACACCAGG + Intronic
1120100654 14:80441397-80441419 CTGGTGCATGTCACCACACCTGG - Intergenic
1121967561 14:98324528-98324550 ATGCTGCACTTCCCATCACCAGG - Intergenic
1122574725 14:102734678-102734700 GTGCTCTAGTTCCCCACAGCTGG + Intergenic
1126116921 15:45216687-45216709 GTGGTGCATACCACCACACCTGG + Intergenic
1126340352 15:47634703-47634725 GTGCTACAATTGCCCCCACCAGG - Intronic
1128388516 15:67167136-67167158 GTGCTGCTCCTCCCCAGACCGGG - Intronic
1128613902 15:69094567-69094589 GGACTGCATTTCCCCAGGCCAGG - Intergenic
1132067174 15:98741589-98741611 GTGCTGCATTTCTGCACGTCGGG + Intronic
1132132457 15:99295272-99295294 GTATTGCTTTTCCCTACACCTGG + Intronic
1132457514 16:32354-32376 GTGCCCCATTTCCCCACCTCAGG + Intergenic
1133978782 16:10618772-10618794 GAGCTGCACTTTCCCACATCAGG - Intergenic
1140797559 16:78453962-78453984 GATCTGGATTTCACCACACCTGG + Intronic
1141647461 16:85375330-85375352 CTCCTGCATTGCCCCTCACCTGG - Intergenic
1142943990 17:3409473-3409495 CTGGTGCATGTCACCACACCTGG - Intergenic
1145786026 17:27594450-27594472 GTCCTGCATCTCCACCCACCTGG + Intronic
1148749341 17:49935604-49935626 ATGCTGCAATCCCCCACCCCCGG - Intergenic
1149630364 17:58116819-58116841 ATGCTCCATCTCCCCAGACCTGG + Intergenic
1151330206 17:73401993-73402015 GTGCTGTGTTTCACCACCCCCGG - Exonic
1152662267 17:81548020-81548042 GTGGTGCATTACCCCACCCTTGG + Intronic
1152961531 18:83163-83185 GTGCCCCATTTCCCCACCTCAGG + Intergenic
1153922647 18:9805111-9805133 CAGCTGCATGTCACCACACCTGG - Intronic
1155225520 18:23726155-23726177 GTGCTGCATTTCCCGGCTCTGGG - Intronic
1158893859 18:61895363-61895385 TTGCTGCCTTTCCCCACTGCTGG + Intergenic
1161328746 19:3676201-3676223 GTGCTGCCTGTCCCCAAACAGGG - Intronic
1161954562 19:7486076-7486098 GAGCTGCATCCCCCCATACCTGG + Intronic
1163550493 19:17964057-17964079 GTGCTGCATTCCCCAGCACCAGG + Intronic
1163886155 19:19966480-19966502 CTGCTGCCTTTCCCCACCCAGGG + Intergenic
1163888314 19:19988998-19989020 CTGCTGCCTTTCCCCACCCAAGG - Intergenic
925428474 2:3770967-3770989 GTGCAGCAGTTTTCCACACCAGG + Intronic
925770132 2:7274133-7274155 GTCCAGCATTTCCTCACACGTGG - Intergenic
927038845 2:19207586-19207608 GTGCTTCATTTCGCCAGACCTGG + Intergenic
929079245 2:38106139-38106161 GTGGTGCATTTCCCCGCAGGCGG + Intronic
929188515 2:39120133-39120155 CTGCGGCATTCCCACACACCCGG + Intronic
931926274 2:67075946-67075968 TTGCTGCCTTTCCCCCCAACAGG - Intergenic
944311401 2:198237556-198237578 ATGCTGCATTTCATCACAACTGG + Intronic
945201234 2:207283643-207283665 CTGCTGCATCTCCTGACACCAGG - Intergenic
945660817 2:212683078-212683100 GTGCAGCAGCTCCCCACACATGG - Intergenic
946375127 2:219303193-219303215 GTGTGCCATGTCCCCACACCTGG + Intronic
947787029 2:232832324-232832346 CTACTGCATTTGCCCTCACCTGG - Intronic
947924748 2:233911488-233911510 GGGCTGCATTTCTCCCCACCAGG + Intergenic
948353162 2:237357391-237357413 ATGCTAATTTTCCCCACACCAGG - Exonic
948581070 2:238987360-238987382 GTCCTGCCTGTCCCCTCACCAGG - Intergenic
1169957750 20:11124601-11124623 GTGCTTCATCACCTCACACCTGG - Intergenic
1170690553 20:18611692-18611714 GTGATGCATGTGCCCACAGCAGG + Intronic
1171322925 20:24262297-24262319 GTGCTGGGTTTCCCCTCACTGGG - Intergenic
1173785180 20:45787886-45787908 GTGCAGCATTTCTTTACACCTGG + Exonic
1174939972 20:54915777-54915799 TTGCTACCTTTCCTCACACCTGG - Intergenic
1176266461 20:64212068-64212090 GTGCTGAAGTGCCCCACTCCTGG + Exonic
1176365879 21:6032487-6032509 GGGCTGCCTTTCCCCAGAGCAGG + Intergenic
1177249161 21:18569627-18569649 CTCTTGCTTTTCCCCACACCTGG + Intergenic
1179757637 21:43506058-43506080 GGGCTGCCTTTCCCCAGAGCAGG - Intergenic
1180638735 22:17281205-17281227 ATGCAGCCCTTCCCCACACCCGG + Intergenic
1183897363 22:40980053-40980075 GCTCTGCATGTCCCCACAGCGGG - Intergenic
1184120048 22:42444242-42444264 GGGCTGGAGTTCCCCACAGCTGG - Intergenic
954734172 3:52691547-52691569 ATGCTGCTTTTCCCCACATTTGG - Exonic
955325903 3:58009137-58009159 TTGTTGCATTTCTCTACACCTGG + Intronic
956097874 3:65736564-65736586 GTGCTGCCCTTACCCACCCCAGG - Intronic
956452296 3:69386387-69386409 GAGCTGCATTTCAGCACACTTGG + Intronic
958432820 3:94062409-94062431 GTCATGCTTTTCCCCAGACCTGG - Intronic
958461233 3:94399074-94399096 GTGTTACTTTTCCCCACTCCTGG - Intergenic
959620389 3:108393408-108393430 GTGCTGCATCTGCCCACAGGGGG + Intronic
960712243 3:120543564-120543586 GTGCTGAATTTCCCCAATGCTGG + Intergenic
962187787 3:133278403-133278425 GTGCTGCATTGCTTCACAACAGG + Intronic
968900465 4:3429107-3429129 GTGCTCCACCTCCCCTCACCTGG - Intronic
969217187 4:5731829-5731851 GTGCTGTATTGCCCAACACTGGG + Intronic
970083741 4:12321309-12321331 ATGCTGCATTTGCCAAAACCAGG + Intergenic
970987251 4:22172866-22172888 ATGATTCATTTCCCCTCACCTGG + Intergenic
971257544 4:25029076-25029098 GTACTGCCTCTCCCCACACAGGG - Intronic
971493266 4:27236990-27237012 GGGGTGCCTTTCCCCATACCAGG - Intergenic
972033450 4:34492088-34492110 GAGGTGCATGCCCCCACACCTGG - Intergenic
977595323 4:98873232-98873254 GTCCTGCATGTCTCCACACATGG - Intronic
980744683 4:136999375-136999397 GTGCTGCCCTTCCCCAGCCCAGG + Intergenic
980787440 4:137572981-137573003 ATGCTGCCTTTCCCCAACCCAGG + Intergenic
981034658 4:140156886-140156908 GTTCTTCCTTTCCCCACATCTGG - Intergenic
981050368 4:140303738-140303760 GAGCTCCATTTCCCTATACCTGG - Intronic
982291198 4:153784495-153784517 GTGAAGCCTTTCCCAACACCGGG + Intronic
982542797 4:156695594-156695616 GTCCTGCATTTCCCAACCACAGG + Intergenic
984423475 4:179554123-179554145 CTCTTGCTTTTCCCCACACCAGG + Intergenic
984942873 4:184949923-184949945 GTGATGCATTCCCTCACTCCTGG - Intergenic
987247670 5:16064769-16064791 GTGCAGCCTATCCCCACACACGG + Intergenic
988676214 5:33435619-33435641 GTGATGCAATTACCTACACCTGG - Intergenic
988896480 5:35679687-35679709 GGGCTGCTCTTCCCCACTCCAGG + Intronic
998437540 5:142125089-142125111 GTGCTGGGATTACCCACACCCGG + Intronic
1006600580 6:35222796-35222818 GTGCTGCATTTCCCCACACCAGG + Intronic
1006981733 6:38153188-38153210 GTGCTGCCATTCGCCACATCTGG - Exonic
1007239226 6:40413295-40413317 CTGCTGTATGTCCCCACACCAGG + Intronic
1007583160 6:42971531-42971553 GTGCTCCACTTCCCCAAACCAGG - Intronic
1012750294 6:103152816-103152838 GTGCTCCATTCCCCCACCTCTGG - Intergenic
1012910631 6:105113634-105113656 GTGCTGCACTTCCCTACTCTTGG - Intronic
1015144412 6:129969240-129969262 GAGCTGTATTTCCCCTCAGCAGG + Intergenic
1015457709 6:133446626-133446648 GTCCTGCATTTCCATAGACCTGG - Exonic
1018918756 6:168156093-168156115 TTGCTGCATCTCCCAACCCCCGG + Intergenic
1019781675 7:2944066-2944088 GTCCTCCATTCCCCCACACCTGG + Intronic
1019813408 7:3181927-3181949 GTGCTGCACTTTCCTACAGCAGG + Intergenic
1020633813 7:10672290-10672312 GTGCTGCCTTTCCCCTGCCCAGG + Intergenic
1022500583 7:30880235-30880257 GTGCTACATGTTCCCCCACCAGG + Intronic
1025027819 7:55532653-55532675 GAGCTGTATTTTTCCACACCAGG - Intronic
1026226111 7:68442826-68442848 GTGCTGCAATTTCCCACAGAGGG + Intergenic
1028027664 7:85866843-85866865 ATGATCCATTTCCCCTCACCGGG + Intergenic
1030309928 7:108058920-108058942 GTGCTGGGATTACCCACACCTGG + Intronic
1032197059 7:129795423-129795445 GCTCAGCATTTCCCCACACTGGG + Intergenic
1032364246 7:131284669-131284691 GTGCTGCCTTCCCTCTCACCAGG + Intronic
1032364363 7:131285344-131285366 GTGTCTCATTGCCCCACACCAGG - Intronic
1035057671 7:156046770-156046792 CACCTGCATTTCCCCACAGCTGG - Intergenic
1035100949 7:156396165-156396187 ATGCTGCATCCCCCCACCCCAGG + Intergenic
1042339525 8:67664511-67664533 CTGCTGCCTTCTCCCACACCTGG + Intronic
1042650058 8:71030586-71030608 GTACTTCATTTTCCCACAACTGG + Intergenic
1043745131 8:83865774-83865796 GAGGTACATTTCTCCACACCTGG - Intergenic
1047132222 8:122034255-122034277 GTGAAGCATTTCCTGACACCAGG + Intergenic
1048749826 8:137660182-137660204 GTGCTGCATTTCTACACACTTGG + Intergenic
1049251428 8:141591146-141591168 GTGCTCCATCTCCCCTCACCAGG - Intergenic
1052279435 9:26716161-26716183 CTCTTGCTTTTCCCCACACCAGG + Intergenic
1052471944 9:28909699-28909721 GTGATGCAGTTGCTCACACCAGG - Intergenic
1052551682 9:29958637-29958659 GTGCTCCAATTTCCCACACTTGG + Intergenic
1053426969 9:38016597-38016619 GCGTTCCATTTCCCCAGACCTGG + Intronic
1055817100 9:80219596-80219618 GTGGTGCCTCACCCCACACCTGG - Intergenic
1057792577 9:98133895-98133917 TTGACGCATTTTCCCACACCTGG + Intronic
1059622374 9:116021197-116021219 GTGCTGCTCTTCCCCAAACCAGG + Intergenic
1060375391 9:123112071-123112093 CTCCCGCCTTTCCCCACACCTGG + Intronic
1061360016 9:130135460-130135482 TTGCTACACTTCCCCACACATGG - Exonic
1062736620 9:138140955-138140977 GTGCCCCATTTCCCCACCTCAGG - Intergenic
1185643707 X:1601910-1601932 CTGCTGCATTCCCCCACACGGGG + Exonic
1189993195 X:46613764-46613786 GGGCTGCAACTCCCCACTCCAGG - Intronic
1190186964 X:48243776-48243798 GTGCTGCATTTCTCCATCCGGGG + Intronic
1190191057 X:48277699-48277721 GTGCTGCATTTCTCCATCCGGGG + Intergenic
1190200295 X:48355368-48355390 GTGCTGCATTTCTCCATCCGGGG + Intronic
1190655884 X:52611879-52611901 GTGCTGCATTTCTCCATCCGGGG + Intergenic
1191077857 X:56475108-56475130 ATGCTCCATTTCCCCATACCAGG - Intergenic
1194374969 X:93121164-93121186 ATTTTGCATTTTCCCACACCTGG - Intergenic
1197042588 X:121957494-121957516 GTGGTGCATGTCCTCACACTTGG + Intergenic
1197403942 X:126027620-126027642 GTGCTGCCCTTCCCCAACCCAGG + Intergenic