ID: 1006603055

View in Genome Browser
Species Human (GRCh38)
Location 6:35238480-35238502
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006603047_1006603055 17 Left 1006603047 6:35238440-35238462 CCCCTCGAAAGGCTGTACTGGTC 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1006603055 6:35238480-35238502 CTAGTTAGGAGGACTGAAGCTGG No data
1006603049_1006603055 15 Left 1006603049 6:35238442-35238464 CCTCGAAAGGCTGTACTGGTCAA 0: 1
1: 0
2: 1
3: 1
4: 43
Right 1006603055 6:35238480-35238502 CTAGTTAGGAGGACTGAAGCTGG No data
1006603048_1006603055 16 Left 1006603048 6:35238441-35238463 CCCTCGAAAGGCTGTACTGGTCA 0: 1
1: 0
2: 1
3: 2
4: 63
Right 1006603055 6:35238480-35238502 CTAGTTAGGAGGACTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr