ID: 1006604153

View in Genome Browser
Species Human (GRCh38)
Location 6:35244192-35244214
Sequence CAGTGTCCCCTCTGGGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 1, 2: 6, 3: 38, 4: 390}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006604153_1006604160 7 Left 1006604153 6:35244192-35244214 CCAATTTCCCAGAGGGGACACTG 0: 1
1: 1
2: 6
3: 38
4: 390
Right 1006604160 6:35244222-35244244 ATTTTCTCCAAACCAGTAATGGG 0: 1
1: 0
2: 3
3: 32
4: 253
1006604153_1006604159 6 Left 1006604153 6:35244192-35244214 CCAATTTCCCAGAGGGGACACTG 0: 1
1: 1
2: 6
3: 38
4: 390
Right 1006604159 6:35244221-35244243 CATTTTCTCCAAACCAGTAATGG 0: 1
1: 0
2: 0
3: 12
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006604153 Original CRISPR CAGTGTCCCCTCTGGGAAAT TGG (reversed) Intronic
900597838 1:3490579-3490601 CAGTGTGCCCGCTGGGGAAAAGG + Exonic
900914335 1:5624303-5624325 CAGTGACCCCCCTGAGAGATGGG + Intergenic
901061468 1:6473876-6473898 AATTGTCCCTTCTGGAAAATGGG - Intronic
901162665 1:7191966-7191988 CAACATCCCATCTGGGAAATGGG + Intronic
901773493 1:11543268-11543290 CACTTTCCTCTCTGAGAAATGGG - Intergenic
902645698 1:17796476-17796498 CAGTTTCACCTCTGGTAAGTGGG - Intronic
902766992 1:18623551-18623573 AACTGCTCCCTCTGGGAAATGGG + Intergenic
902786144 1:18733899-18733921 CAGTTTTTCATCTGGGAAATGGG + Intronic
902817234 1:18923258-18923280 CAAGGGCCCCTCTGGGGAATGGG - Intronic
902824363 1:18962814-18962836 CAGTTTCCCCTCTGTAAAACGGG + Intergenic
902892173 1:19452326-19452348 CATTGCCCCCACTGGGACATAGG + Intronic
903008955 1:20317220-20317242 CAGTGTCCCCACATGGAAAGTGG + Intronic
903341234 1:22655783-22655805 CTGTGGCCACTCTGGGAAGTAGG + Intronic
903666930 1:25013761-25013783 CAGTTTCTCATCTGTGAAATGGG + Intergenic
903680425 1:25092853-25092875 CAGTTTCCCCTCTGGGCCAAGGG + Intergenic
903739659 1:25551428-25551450 CAGTTTCCTCTCTGTAAAATGGG + Intronic
903891418 1:26572840-26572862 CAGTTTCCCTGCTGAGAAATAGG - Intronic
904276606 1:29388903-29388925 CAGTTTCCCATCTGTAAAATGGG + Intergenic
905404250 1:37722616-37722638 CAGTTTCTCATCTGAGAAATGGG - Intronic
905481463 1:38264878-38264900 TAGTCTCCTCACTGGGAAATAGG - Intergenic
907113958 1:51952239-51952261 CTGTTTCCCATCTGTGAAATGGG - Intronic
907307392 1:53520893-53520915 CAGTTCCCCATCTGTGAAATGGG + Intronic
907385736 1:54124390-54124412 CAGTTTCCCCTCTACAAAATGGG + Intergenic
908939340 1:69412415-69412437 CAGTTTCCTCACTGGGAAATTGG + Intergenic
910118362 1:83757430-83757452 CAGTTGCCCCTATGGGAAATCGG - Intergenic
910210358 1:84786015-84786037 CAGTGACCCTTGTGGAAAATGGG + Intergenic
910470899 1:87551793-87551815 AAGTGTCTCATCTGTGAAATGGG + Intergenic
911847139 1:102768575-102768597 CAGTGTCTCCTCTGACAACTAGG + Intergenic
914992774 1:152513171-152513193 CAGGATCTCCTCTGGGAAAATGG - Intronic
916015503 1:160746115-160746137 CAGTGTCTCCTGTGTGTAATTGG - Intronic
916198785 1:162250188-162250210 AACTGTCCCCTCGGGAAAATGGG - Intronic
917599539 1:176560468-176560490 CTGTCTCCGCTATGGGAAATAGG - Intronic
919503397 1:198367133-198367155 CATTGTCACCTTTGGAAAATGGG + Intergenic
920284191 1:204868081-204868103 CACTTTCCACGCTGGGAAATGGG + Intronic
920434060 1:205936838-205936860 CAGGCTCTCCTCTGGGAAGTTGG - Intronic
920950840 1:210570437-210570459 CAGTGTAGCCCCTGGGAACTAGG + Intronic
922548567 1:226476806-226476828 TAGTGTCATCTCTGGGAAGTAGG - Intergenic
923678865 1:236102866-236102888 CAGTTTCCCCTCTTGGCACTAGG + Intergenic
923823982 1:237478702-237478724 CAGTTTCCCAGCTGTGAAATGGG - Intronic
924684722 1:246276982-246277004 CAGTTTCCCATCTGCAAAATGGG + Intronic
1062854088 10:770587-770609 CAGAGGCACCTCTGGGAAGTGGG + Intergenic
1062982439 10:1736849-1736871 CACTGTCCCCTCTGGGCAAGAGG + Intronic
1063865067 10:10355159-10355181 TAGTTTCCCATCTGAGAAATGGG + Intergenic
1064066028 10:12182180-12182202 CAGTGTCCCCCCAGGGGAAAAGG - Intronic
1064382641 10:14860489-14860511 CAGAGTCCCCTCTGAGGAAGTGG + Intronic
1065600830 10:27366873-27366895 CAGTGTGGGCCCTGGGAAATAGG + Intergenic
1065975904 10:30842213-30842235 CATTCTCTCCTCTGTGAAATGGG - Intronic
1068305287 10:55200041-55200063 CATTGTCCCCACTGGGGAACTGG + Intronic
1069861520 10:71474580-71474602 CAGTTTCCTCTCTGGTAAAATGG + Intronic
1070313996 10:75294120-75294142 CAGCGTCTCCTTTGGGAAGTGGG + Intergenic
1070704200 10:78625705-78625727 CAGTTTCCCATCTGAGAAATGGG - Intergenic
1071427279 10:85571588-85571610 ACATGTCCCCACTGGGAAATTGG - Intergenic
1072065077 10:91860471-91860493 CAGTGTCACATCTGGGAACTTGG - Intronic
1075004992 10:118823708-118823730 CTGTGTCCTCCCTGGGAATTTGG - Intergenic
1076242158 10:128916746-128916768 GAGTTCCCCCTCTGGGCAATGGG + Intergenic
1076875231 10:133212658-133212680 CCGTGTCCCCTCTGGGTCAGGGG - Intronic
1077367679 11:2167692-2167714 CAGTTTCCCCACTGGGATTTGGG + Intronic
1077483017 11:2825359-2825381 CAGTGTCCTTCCAGGGAAATGGG + Intronic
1077999588 11:7482991-7483013 CAGAATCCCTTCTGGGATATTGG - Intergenic
1078320142 11:10327149-10327171 CAGTTTCTCCTCTGAAAAATAGG + Intronic
1079089155 11:17468743-17468765 CAGGGTCCACACTGGAAAATGGG + Intronic
1081584163 11:44372706-44372728 CAGTTTCCCATCTGGAAAAATGG + Intergenic
1081706077 11:45182523-45182545 CAGTGTGCTATCTGGAAAATGGG - Intronic
1082077022 11:47981801-47981823 CAGTTCCCCATCTGTGAAATGGG - Intronic
1082128905 11:48463676-48463698 CAGTTTCCTCTTTGGTAAATGGG + Intergenic
1082248497 11:49953704-49953726 CAGTTTCCTCTTTGGTAAATGGG - Intergenic
1082562449 11:54634652-54634674 CAGTTTCCTCTTTGGTAAATGGG + Intergenic
1082802174 11:57423180-57423202 CAGTTTCTCCTCTGTGTAATGGG + Intronic
1082815516 11:57505862-57505884 CATTATCTCATCTGGGAAATGGG + Intronic
1083248510 11:61449290-61449312 CAGTGAACCCTCTGGGAATGAGG + Intronic
1083608063 11:63990846-63990868 CAGAGGCCCCTGGGGGAAATGGG + Intronic
1083896568 11:65622993-65623015 CTGTGTCCCCTCTGAGAAATGGG - Intronic
1084275791 11:68050343-68050365 CAGTTTCCCCTCTGTAAAGTGGG + Intronic
1084350286 11:68592973-68592995 CAGTGTTCCCTCTGGGTATCAGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1084463952 11:69311330-69311352 CTGTGTCCCTGCTGTGAAATGGG - Intronic
1084647993 11:70471808-70471830 CAGCGTCTCCTCTGGGAGCTGGG - Intronic
1084817233 11:71655562-71655584 CAGTCTCCTCTTTGGGAAAGTGG + Intergenic
1085157075 11:74305418-74305440 CAGTTTCCTCTCTGTGGAATGGG - Intronic
1085442814 11:76579154-76579176 CAGTCTCCCCTTTGGGAGAGAGG + Intergenic
1085600836 11:77854783-77854805 CAGAGTCCCCACTGGGACAGTGG - Intronic
1085783029 11:79426417-79426439 CTGTTGCCCCTCTGGAAAATGGG + Intronic
1086106828 11:83156585-83156607 CAGCTGCCCCTCTGGGAACTGGG - Intergenic
1088081169 11:105916293-105916315 CACTGTCCCATCTGCAAAATGGG + Intronic
1088216725 11:107518722-107518744 AAGTGTCCCTTATAGGAAATGGG - Intronic
1089598538 11:119598389-119598411 CAGTTTCCCCTTTGGTAAAATGG - Intergenic
1090413866 11:126527541-126527563 CATTTTCCCATCTGGAAAATGGG - Intronic
1090622770 11:128576118-128576140 CAGTTTCCTCTCTGGGCAAAGGG - Intronic
1090831491 11:130423796-130423818 CAGTGTCCCCTGTGTGAACCCGG - Intronic
1090953356 11:131493658-131493680 CACTGCCCCATCTGTGAAATGGG - Intronic
1091314279 11:134600315-134600337 AAGTCTCCCCTGTGGGAAAGGGG - Intergenic
1091407260 12:216948-216970 CAGTTTCCCGTCTGTAAAATGGG - Intergenic
1091843236 12:3635239-3635261 CACTGTCCCCTCTGGGGGACAGG + Intronic
1092182152 12:6453238-6453260 CAGTGTGCCCCCTTGGAAATCGG - Exonic
1093197154 12:16142929-16142951 AAGGTTCACCTCTGGGAAATGGG + Intergenic
1094390207 12:29940660-29940682 CATTGCCCCCTCTGGGCACTAGG - Intergenic
1095785139 12:46101668-46101690 CATTGCCCCCTCTGGTGAATGGG - Intergenic
1095977317 12:47948675-47948697 CAGTGTCCCTTCTAGGCACTGGG - Intergenic
1096359542 12:50972005-50972027 CACTGTCCTCTTTGGAAAATAGG + Intergenic
1097749648 12:63337642-63337664 CAGGTTCCCCTCTGGGACAATGG + Intergenic
1100306076 12:93351462-93351484 AAGTATCCCTTATGGGAAATGGG + Intergenic
1100588290 12:95999638-95999660 GAGTCTCACCTCTGGGAATTTGG + Intergenic
1101421713 12:104556223-104556245 CAGTTTCTCCTCTGTAAAATGGG - Intronic
1101513708 12:105415361-105415383 CAGTTTCCTCTCTGTAAAATGGG + Intergenic
1101737156 12:107471714-107471736 CAGTGTCCTCTCTATGAAACAGG + Intronic
1102146358 12:110657956-110657978 CAGCGTCCTCTCGGGGAAAGTGG + Intronic
1102306320 12:111807379-111807401 AAGTGTACCCACTGGGAAGTGGG - Intronic
1102458739 12:113087274-113087296 CAGTGTCCCCTCTGTGAAATGGG - Intronic
1102727039 12:115074871-115074893 CAGCAGGCCCTCTGGGAAATAGG + Intergenic
1102859891 12:116326635-116326657 CAGGGTCTCCTCTGAAAAATGGG - Intergenic
1103001494 12:117388598-117388620 CAGTGTCACCTCTGTAAAATGGG - Intronic
1103173458 12:118842477-118842499 CAGTGTCTAATCTGGAAAATAGG + Intergenic
1103196497 12:119048165-119048187 CAGTGTCCCCACTGTAAAATAGG - Intronic
1103209397 12:119155438-119155460 CAGGGTGCCCTGTGGGATATTGG - Intronic
1103912226 12:124358885-124358907 CATTTTCCCGTCTGTGAAATGGG - Intronic
1103938315 12:124488415-124488437 CAGTTTCTCCTCTTTGAAATGGG + Intronic
1103981865 12:124741977-124741999 CAGTTTCCCCTCTGTGGAATAGG + Intergenic
1104370030 12:128216250-128216272 CAGGTTCCCCTCTGTGAAATGGG + Intergenic
1104728770 12:131093843-131093865 CAGTTTCCCCGCTGTGACATGGG + Intronic
1106363437 13:29053438-29053460 CAGTGTCCCCTTGGGCAAATAGG + Intronic
1107001709 13:35553910-35553932 CAGTGACACCTCTGAGAAACTGG + Intronic
1108795950 13:54031417-54031439 CAGTATCTCCTCTGGGAATTGGG - Intergenic
1110138347 13:72097181-72097203 CAGTGTCTCCTCTGTGAATCAGG - Intergenic
1110424834 13:75355114-75355136 CAGTGTCCACACTGGGAATGTGG + Intronic
1111977646 13:94983572-94983594 CAGTGTAAGCTCTGTGAAATCGG - Intergenic
1112050329 13:95639157-95639179 CAGTTTCTACTCTGTGAAATGGG - Intronic
1113467409 13:110521954-110521976 TAGTGACCCATCTAGGAAATAGG - Intergenic
1114615969 14:24068662-24068684 AAGTGTCCTCTCTGGGAAGAGGG - Exonic
1115343535 14:32318118-32318140 TTTTTTCCCCTCTGGGAAATGGG - Intergenic
1117674607 14:58142975-58142997 GAGTGTACCATCTTGGAAATGGG + Intronic
1118455571 14:65943223-65943245 CAGTTTCCCATCTGGAAAATGGG + Intergenic
1118732679 14:68679471-68679493 CAGTTTCCCATCTGTAAAATGGG + Intronic
1119470098 14:74891199-74891221 CAGTGTTCCCTCTTGGGATTGGG + Intronic
1119622237 14:76139610-76139632 CAGTTTCCCATCTGTAAAATGGG + Intergenic
1119853012 14:77879452-77879474 CACTGTCCCCTCTGGCCAAAAGG - Intronic
1119918658 14:78426102-78426124 CAATGAGCTCTCTGGGAAATGGG - Intronic
1119976876 14:79034493-79034515 CGTTGTACCATCTGGGAAATAGG + Intronic
1120519997 14:85516088-85516110 CAGTGTCCTCTCTTTAAAATAGG + Intergenic
1120707685 14:87761439-87761461 CAGTGTCCCCACTGGGGCACTGG + Intergenic
1121713361 14:96055369-96055391 CAGTGTCCCCTCTGGGGCAGAGG - Intronic
1122191171 14:100044879-100044901 CACTGTCCCCAGTGGGAAAGTGG - Intronic
1122338004 14:101006509-101006531 CTGTTTCCCATCTGTGAAATGGG + Intergenic
1122604189 14:102937606-102937628 CAGTTTCCCCTGTGCGGAATGGG - Intronic
1202861184 14_GL000225v1_random:82525-82547 CAGTGCCCCCTTTGGGCAGTGGG - Intergenic
1123708019 15:22964614-22964636 CCATGTTCCCTCTGGGAAAAAGG + Intronic
1125087160 15:35743689-35743711 CAGTGTCTCCTTTGTAAAATAGG + Intergenic
1126252985 15:46590230-46590252 CAATGTCCCATCTGGGACCTAGG + Intergenic
1126477609 15:49082244-49082266 CACTGTTCCCTCTGGGCACTAGG - Intergenic
1126744477 15:51812248-51812270 CAGTCTTCCCTTAGGGAAATTGG - Exonic
1128340769 15:66821242-66821264 CAGCTTCCACCCTGGGAAATGGG + Intergenic
1128603449 15:69016549-69016571 CTGTGCTCCCTGTGGGAAATGGG + Intronic
1128835360 15:70804926-70804948 AAGTATCCCTTATGGGAAATGGG - Intergenic
1129264357 15:74386027-74386049 CAGTTGCCCATCTGAGAAATAGG - Intergenic
1129524799 15:76206867-76206889 CAGTTTGTCCTCTAGGAAATGGG + Intronic
1129606810 15:77028973-77028995 CAGTTTCCTCTCTGTGACATGGG - Intronic
1129738286 15:77977643-77977665 CAGTGTCCCCTCTCTGCAAAGGG - Intergenic
1130013434 15:80170038-80170060 CAGTGTCCCCTCTGAAAAATGGG - Intronic
1131069037 15:89452877-89452899 GAGTGAGCCCTCTTGGAAATGGG - Intergenic
1133447060 16:5870589-5870611 AACTGTTCCATCTGGGAAATGGG - Intergenic
1134412238 16:14012666-14012688 CATTTTCTCATCTGGGAAATGGG - Intergenic
1134455542 16:14392757-14392779 CATTTTCCCCTCTCTGAAATGGG - Intergenic
1134694306 16:16211909-16211931 CAGTTTTCCCTCTGTAAAATGGG - Intronic
1134977528 16:18582721-18582743 CAGTTTTCCCTCTGTAAAATGGG + Intergenic
1136156039 16:28382888-28382910 CAGTTTCTCCACTGGGAAAAAGG + Intronic
1136207047 16:28732400-28732422 CAGTTTCTCCACTGGGAAAAAGG - Intronic
1136519103 16:30785016-30785038 CTCTGTCTCCTCTGGGAAACTGG - Intronic
1138138781 16:54548292-54548314 CAGTGTCCTCTCTAGAAAAGAGG + Intergenic
1138441344 16:57036824-57036846 CGGTTTCCCCTCTGTAAAATGGG + Intronic
1138731684 16:59202121-59202143 CAGTTTCTCATCTGTGAAATGGG - Intergenic
1138941111 16:61791598-61791620 TACTGTGGCCTCTGGGAAATTGG - Intronic
1139300727 16:65943128-65943150 CAGTGTCCCATCTTTAAAATAGG + Intergenic
1139356101 16:66367799-66367821 AAGTGTCTCATCTGTGAAATGGG + Intronic
1139635273 16:68254875-68254897 CAGTGTCCCCTCCGGGTCACTGG + Intronic
1139884713 16:70200249-70200271 CAGGGTCCCATCTGTAAAATGGG - Intergenic
1141127132 16:81408766-81408788 CTGTGTCCCCTCTGTGACCTTGG - Intergenic
1141353211 16:83318044-83318066 CAGTTTTCCCTCTGTGAAGTAGG + Intronic
1141533254 16:84661305-84661327 CCTTGCCCCATCTGGGAAATGGG - Intronic
1141661896 16:85445931-85445953 CAGTGCCCCATCTGTGAAATGGG + Intergenic
1142575398 17:903750-903772 CAGTGTTCTATCTGGAAAATGGG - Intronic
1142741854 17:1936229-1936251 CAGTGTCCACTCTGGCAAGGTGG - Exonic
1142808295 17:2383238-2383260 CAGTCTCCCCTGTGGGGACTGGG + Intergenic
1143001219 17:3796459-3796481 CCGTCTCCCCTCTGGGACATGGG + Intronic
1143028403 17:3954010-3954032 CAGTTTCCCTTCTGTGAAGTGGG - Intronic
1143030510 17:3964573-3964595 CAGTTTCCCCTCTGCAGAATGGG - Intergenic
1144807637 17:17978298-17978320 CAATGTCCCGTCTGTGGAATGGG + Intronic
1145012730 17:19378828-19378850 CAGTGTCCCCTCTGCGGGCTGGG - Intronic
1145980653 17:29009430-29009452 CAGAGTCCCTGCTGGGAAGTAGG + Intronic
1147167413 17:38600918-38600940 CTTTCACCCCTCTGGGAAATCGG + Intronic
1147245221 17:39115789-39115811 CAGTTTCCCCACTGAGAAAATGG - Intronic
1147248905 17:39140737-39140759 CCCTGACCCCACTGGGAAATAGG - Intronic
1147568427 17:41552038-41552060 CAGTTTCCCATCTGGGAAGCTGG + Intergenic
1148074973 17:44930284-44930306 CAGTGCCCCATCTGACAAATGGG + Intronic
1148123789 17:45226576-45226598 CAGTTTCCCATTTGTGAAATAGG + Intronic
1148804952 17:50259343-50259365 CAGTCTTCTCTCTGTGAAATGGG - Intergenic
1149010872 17:51854916-51854938 CATTTTCTCCTCTGTGAAATTGG - Intronic
1149138007 17:53393592-53393614 CAGCTTTCCCTCTGGGAATTTGG - Intergenic
1151956741 17:77383880-77383902 CAGTTTCCCATCTGTGCAATGGG + Intronic
1152325366 17:79632937-79632959 CAGTGTCCCCTGTGGAATACAGG - Intergenic
1152389281 17:79993108-79993130 CAGTTTCCCCTCTGCACAATGGG - Intronic
1155244735 18:23896599-23896621 CTATTTCCCCTCAGGGAAATAGG - Intronic
1157671249 18:49530685-49530707 AAGTGTCCCTTATGGGAAATGGG + Intergenic
1158041061 18:53094275-53094297 CAGTGTCCCAACTGGGAAGAAGG + Intronic
1158051480 18:53226033-53226055 CAGTGTTCTCTCTGTAAAATTGG - Intronic
1158410311 18:57199366-57199388 CAGTTTCCTCTCTTGGAAAATGG + Intergenic
1159627044 18:70707299-70707321 CAGTCTCCCCTGTGGTGAATTGG + Intergenic
1160162180 18:76481601-76481623 CAGTGTCCTCTCGGGTAAAAGGG + Intronic
1160276654 18:77443543-77443565 CAGTGTATACTGTGGGAAATGGG - Intergenic
1160370541 18:78369088-78369110 CAGTGTCCCATCTGTAAAGTGGG + Intergenic
1160691227 19:461368-461390 CAGTTTCCCCACTAGGAAATAGG - Intergenic
1160691261 19:461489-461511 CAGTTTCCCCACTAAGAAATAGG - Intergenic
1161101664 19:2424686-2424708 GGGTGTCCCCTCTGGAAAACCGG - Intronic
1161201224 19:3015873-3015895 AAGCTTCCCATCTGGGAAATGGG + Intronic
1161333274 19:3698295-3698317 CAGCGTCCCGTCTGTGAAGTGGG - Intronic
1161428980 19:4219860-4219882 CAGTTTCCCTTCTGGAAAATGGG - Intronic
1161643024 19:5436148-5436170 CAGTTTTCCCTGTGTGAAATGGG - Intergenic
1162153219 19:8659962-8659984 CAGTCTCCCTTCTGTGAAACGGG - Intergenic
1162778849 19:12996297-12996319 CAGTGTCCCCTCTGCGCCCTCGG - Intronic
1162803306 19:13122974-13122996 CAGTCTCCCATCTAGAAAATGGG - Intronic
1162835322 19:13313190-13313212 CAGTTTCCCCTCTGTTAAAAAGG + Intronic
1162921123 19:13903793-13903815 CAGTTTCCCCTTTTGTAAATTGG - Intronic
1163098662 19:15080007-15080029 CATTTCCCCCCCTGGGAAATTGG - Intergenic
1163136434 19:15314741-15314763 CACTGTCCCCTGTGGTAAGTGGG - Intronic
1163286446 19:16351417-16351439 CAGTTTTCCCTCAGGAAAATGGG + Intergenic
1163371050 19:16901467-16901489 CAGTGTCCCTGCTGTAAAATAGG - Intronic
1163697647 19:18772074-18772096 CAGTCTCCCGTCTGTGGAATGGG - Intronic
1163773716 19:19205860-19205882 CAGTTTCTCATCTGTGAAATGGG + Intergenic
1164011007 19:21203472-21203494 CAGTTGCCTCTCTGGGTAATGGG + Intergenic
1164780169 19:30885352-30885374 CAGAGTCCCCTCTCTGATATGGG - Intergenic
1165737365 19:38185199-38185221 CCGTGTCCCCCATGGGAAACAGG + Intronic
1165780813 19:38433441-38433463 CAGTCTGCCCTCTGTGAAATGGG + Intergenic
1165803486 19:38566739-38566761 CAGTTTCCCCTCTGTAAAACGGG + Intronic
1165838055 19:38771221-38771243 CAGTTTCCTCACTGGGAAAATGG + Intronic
1165841510 19:38791476-38791498 CAGTTTCCTCACTGGGAAAATGG - Intronic
1166255822 19:41603790-41603812 CAGTTTCCCCTCAGTAAAATAGG - Intronic
1167052795 19:47089928-47089950 CAGTTTCTCCTCTGGGGCATCGG - Intronic
1167350525 19:48971181-48971203 TAGCGTCCCCTCTGAGAAATAGG - Intronic
1167516039 19:49923735-49923757 CAGTTTCCCCTCCGTAAAATGGG - Intronic
1168107497 19:54173565-54173587 CAGTTTCCCCTTTGTGAAATGGG + Exonic
1168386045 19:55963968-55963990 CAGTTTCTCATCTGTGAAATAGG - Intronic
925634241 2:5927204-5927226 CAGTGTTCCCTTTGGGAGACAGG - Intergenic
926064273 2:9824557-9824579 CAGTGTCCCCTCTGAGGAATGGG + Intergenic
928211376 2:29326402-29326424 CTGTGTCCCAGCTGGGAAGTAGG + Intronic
928317091 2:30254959-30254981 CAGTTTTCCATCTGTGAAATGGG + Intronic
929358412 2:41053880-41053902 CAGTTTCCCATCTGAAAAATAGG - Intergenic
929575621 2:43050087-43050109 CAGGGCCCCCTCTGGGAAAACGG - Intergenic
929814811 2:45222169-45222191 CAGTTTCTCATCTGTGAAATGGG - Intergenic
930308827 2:49712284-49712306 CAGTGTGCCCCCTTGGAGATGGG + Intergenic
930691793 2:54372463-54372485 CTGTGTCCCCTCTGCGAATCTGG + Intronic
932694678 2:73945497-73945519 GATTTTCCCCTCTGGAAAATGGG + Intronic
933851054 2:86366973-86366995 CGGTGTCCCCATTGTGAAATGGG + Intergenic
935188385 2:100755342-100755364 CAGTTTCCCCTCTATCAAATGGG - Intergenic
935922820 2:108033800-108033822 CAGTGTCTCATCTGGAACATGGG - Intergenic
936944619 2:117919212-117919234 CAGAGACCCGTCTGGGAAGTAGG - Exonic
937306236 2:120872722-120872744 CAGTGTCTCTTCTGTAAAATGGG + Intronic
937343287 2:121105523-121105545 CATTTTCTCATCTGGGAAATGGG - Intergenic
940737197 2:157466923-157466945 CAATGTCCCCTCAGGGAATCTGG + Intronic
940875604 2:158894231-158894253 CAGTGTCTCATCTGAGAAATTGG + Intergenic
941595318 2:167469282-167469304 CAGTTTCTCATCTGTGAAATGGG + Intergenic
941974837 2:171392084-171392106 CAGTGGCCCCTCTGGGATCAAGG - Exonic
946131296 2:217609054-217609076 CATTTTCCCGTCTGGAAAATAGG - Intronic
946169918 2:217888881-217888903 CAGTGTCACCTCTCAGGAATAGG - Intronic
1169400276 20:5273830-5273852 CACTTTCCCCTCTGAGGAATGGG + Intergenic
1170595203 20:17800207-17800229 CAGTGTCCAGTTAGGGAAATAGG + Intergenic
1172131750 20:32660570-32660592 CACTGTCTCCTCTGTAAAATAGG - Intergenic
1172210473 20:33194533-33194555 CAGTGTGCCATCTGTAAAATGGG + Intergenic
1172877199 20:38171816-38171838 AGTTGTCCCCTCTGTGAAATGGG + Intergenic
1173357261 20:42305747-42305769 CAGTTTCCCCTCTGTCAAACAGG - Intronic
1173599224 20:44280829-44280851 CATTTTTCCCTCTGGGAAATTGG - Intronic
1174268675 20:49350920-49350942 CAGTTTCCCATCTGGAAAAATGG + Intergenic
1174349687 20:49958044-49958066 CAGGGTACCCTTTGGGAAACAGG + Intergenic
1175112944 20:56661682-56661704 CAGTGCCTCATCTGTGAAATGGG - Intergenic
1175257787 20:57657430-57657452 CAGTTTCTCCTCTGGAAAGTGGG + Intronic
1175788792 20:61728593-61728615 CAGTTTCCTCTTTGGGAAAATGG + Intronic
1177359010 21:20045269-20045291 CAGTGTCCACTCAGGGCTATGGG - Intergenic
1179730884 21:43366829-43366851 GAGTGTCCTCGCTGGGAAATGGG + Intergenic
1180157283 21:45983759-45983781 CAGTTTCCCACCTGTGAAATGGG + Intronic
1181040019 22:20187726-20187748 CAGTTTACCCTCTGGGAAGAGGG - Intergenic
1181371464 22:22421564-22421586 CACTAAGCCCTCTGGGAAATTGG + Intergenic
1181462873 22:23095624-23095646 CAGTGTCCCCTGTGGCAAGAGGG + Exonic
1182115003 22:27751324-27751346 CAGTTTCCCCACTGGGAAATAGG + Intronic
1182423222 22:30258413-30258435 CAGTTTCCCCTCTGTACAATGGG - Intergenic
1182659765 22:31917031-31917053 CAGTTTCTCCTCTGAGAAGTGGG - Intergenic
1182981428 22:34675044-34675066 CAGTGTACCCTTTGGGAACCAGG - Intergenic
1183210540 22:36448615-36448637 CAGTGTCCTGTCTGTGAAACAGG + Intergenic
1183690183 22:39383809-39383831 CAGTTTCCCTTCTGTTAAATGGG - Exonic
1184019735 22:41813011-41813033 CAGTTTCCCATCTGTAAAATGGG + Intronic
1184208129 22:43018126-43018148 CTGTGTCCCCTCCGTGATATGGG + Intergenic
1184520884 22:44993322-44993344 CAGTGTCCCCTCCGGTAAAAGGG + Intronic
1185293619 22:50041532-50041554 CAGTGCAGCCTCTGGGAACTGGG - Intronic
950093469 3:10313922-10313944 CAGTGTCCATTTGGGGAAATGGG - Intronic
950668533 3:14511649-14511671 CAGTTTCCCCCCTGTAAAATGGG + Intronic
950672236 3:14534248-14534270 CATTTTCCCCTCTGTAAAATGGG + Intronic
951913258 3:27773377-27773399 CAGTGTCCACTGTGGGAAACTGG - Intergenic
952596316 3:35022986-35023008 CAATTTACCCTCTGGAAAATGGG - Intergenic
952838210 3:37622438-37622460 CAGTTTATTCTCTGGGAAATAGG + Intronic
953329894 3:42043785-42043807 CTGTGCCCCCTCTGGGGAGTTGG - Intronic
953408260 3:42671170-42671192 CAGTGTCCCCTTTTGGGAAGAGG - Intergenic
953676319 3:45005774-45005796 CACTGTCCCCCCTATGAAATGGG + Intronic
953780646 3:45867234-45867256 CAGTTTCCCCTTTGGTAAATGGG + Intronic
954649826 3:52154300-52154322 CAGTCTCCCCGCTGGGACACTGG - Intronic
955374525 3:58383946-58383968 CTGTTTCCCCTCTCTGAAATAGG - Intronic
956002841 3:64747493-64747515 CAGTTTCCTCTCTGGGAGGTAGG - Intergenic
956195501 3:66650075-66650097 CAATGTCCCCTGTGGGAAGCTGG - Intergenic
956489715 3:69757878-69757900 CAGTGTTGCCTGTGGAAAATGGG + Intronic
957643025 3:82883669-82883691 CAGTGTACCCTTTGTGAACTTGG + Intergenic
961777736 3:129301674-129301696 CAGTGTCCACTCTAGTAAATTGG - Intronic
961817813 3:129560294-129560316 CAGTCTCCCCTCTGTGCAGTGGG - Intronic
962208494 3:133455817-133455839 CAGTGCCCCGGCTGAGAAATTGG - Intronic
963541484 3:146595573-146595595 GAGTCTCCCCTCTGGGGACTAGG - Intronic
963716556 3:148810699-148810721 CTGTGTCCCCTCTGAGAAGAGGG + Intronic
963888904 3:150611795-150611817 CAGTGCCTCGTCCGGGAAATCGG - Intronic
964333893 3:155634426-155634448 CAGTGAGGCCTCTGGGAAAATGG - Intronic
964949239 3:162267353-162267375 AAGTGTTCCCTCTGGGATTTAGG + Intergenic
965514883 3:169610537-169610559 CAGTATCCCATCTGTAAAATAGG - Intronic
966495767 3:180578525-180578547 AAGTATCCCTTATGGGAAATGGG - Intergenic
966542530 3:181107741-181107763 CAGTTTCCCATCTGTAAAATGGG + Intergenic
968533287 4:1107420-1107442 CACTGTCATCTCTGGGAAACAGG + Intronic
969243744 4:5919093-5919115 CAATGTCCCACCTGGGAAAGAGG - Intronic
969344488 4:6562706-6562728 CAGTTTCTCTTCTGTGAAATGGG - Intronic
969350925 4:6597407-6597429 CAGTTTCCCCTCTGTAAAGTGGG - Intronic
969447093 4:7251623-7251645 CAGTGTCCCTTTGGGTAAATGGG + Intronic
969627241 4:8312224-8312246 CAGTGACCCTTCTGGGAAGAGGG - Intergenic
971803124 4:31318369-31318391 CAGTGTGCCCTCTTGGCCATAGG - Intergenic
973710117 4:53621525-53621547 CAGTGTCCACACTGGGTATTTGG - Intronic
974702728 4:65472396-65472418 CAGTGTCCCCACTGGGGAACTGG - Intronic
974978499 4:68922498-68922520 AAGTATCCCTTATGGGAAATGGG - Intergenic
976637677 4:87303418-87303440 CAGTGTGACCTCTGGGAAATGGG + Intergenic
977622131 4:99149542-99149564 CATTGGCCCCTCTGGTAAGTTGG + Intronic
977930896 4:102747600-102747622 CAGTTTCTCCTCTGTCAAATAGG + Intronic
978527134 4:109678497-109678519 CACCGCCCCATCTGGGAAATGGG - Intronic
978850977 4:113336008-113336030 GAGTGCCCCCTCTGGGAAGACGG - Exonic
978988241 4:115043689-115043711 CAGTGTCTCATCTGTAAAATGGG + Intronic
979567625 4:122173331-122173353 CAGAGTCCCCACTGGTAAAAAGG - Intronic
981871207 4:149487793-149487815 CAGTGCCTCTTCTGGGAGATGGG + Intergenic
982643789 4:157996571-157996593 CAGTTTCCCCTCTGGGTCAAGGG + Intergenic
985032181 4:185800492-185800514 CAGTCTCCCCTCTGTGAGCTGGG + Intronic
986467214 5:8037706-8037728 AAGTGTCTCTTATGGGAAATGGG + Intergenic
986738220 5:10683005-10683027 CATTGATCCCTCTGGAAAATAGG - Intronic
987301841 5:16604314-16604336 CAATATCCCCTCTGCCAAATGGG + Intronic
989265946 5:39474390-39474412 CAGTTTCCCCTCTCTAAAATGGG - Intergenic
989655769 5:43745841-43745863 CAGCTGCCCCTCTGGGAAGTGGG - Intergenic
991503709 5:67303078-67303100 CTGTTTCCCCTCTGGGATTTTGG - Intergenic
992447288 5:76845484-76845506 AAGTATCCCTTATGGGAAATGGG - Intergenic
995221180 5:109650018-109650040 CAGTGTCCCATCTTGGAAAATGG - Intergenic
995850182 5:116536677-116536699 CAGTGTCCTCTGTGGAAGATCGG - Intronic
996416857 5:123220118-123220140 CATTGTCTCCTTTGGGAAAGAGG - Intergenic
996486206 5:124038252-124038274 AAATGCCCCCTTTGGGAAATAGG + Intergenic
996775036 5:127123352-127123374 AAGTTTCCCCTCAGGGAAAGAGG + Intergenic
997057327 5:130460057-130460079 CAGAGTCCCCACTGTGACATGGG + Intergenic
997259762 5:132456837-132456859 CAGCCTCCTCTCTGTGAAATGGG - Intronic
997345592 5:133189723-133189745 CAGTGGCCTCACAGGGAAATGGG - Intergenic
997794504 5:136795138-136795160 CAGGGTCACCTCTGGAAGATGGG + Intergenic
998166218 5:139845841-139845863 CAGTTTCCTTGCTGGGAAATGGG - Intergenic
998515234 5:142747732-142747754 AAGTTTCCCCTCTGTAAAATGGG + Intergenic
998690012 5:144577143-144577165 CAGTGTCCTGTCTAGGAACTGGG - Intergenic
999182454 5:149679738-149679760 CAGTCTCCCTTCTGGGAAGAAGG + Intergenic
1000071752 5:157746451-157746473 CACTGTCCTCTCTGTGAATTTGG - Intronic
1001039173 5:168320504-168320526 CAGTTTCCCGTCTGTGAAATGGG + Intronic
1001072521 5:168599315-168599337 CATTTTGCCATCTGGGAAATGGG + Intergenic
1001773796 5:174314005-174314027 CAGTTTTACCTCTGTGAAATGGG + Intergenic
1001947155 5:175788986-175789008 CAGTTTCCTCTCTGTAAAATGGG - Intergenic
1001970188 5:175949215-175949237 CAGTGTCCCATCTGCACAATAGG - Intronic
1002247250 5:177894549-177894571 CAGTGTCCCATCTGCACAATAGG + Intergenic
1003015334 6:2463123-2463145 CAGTATCCCTCCTGGGAAATGGG + Intergenic
1003079731 6:3012256-3012278 CAGTTTGCTCTCTGGTAAATTGG + Intronic
1004234941 6:13866798-13866820 CAGTTTCCCATCTGCAAAATGGG + Intergenic
1004718950 6:18248167-18248189 CAGTTTCCCATCTGTAAAATGGG - Intronic
1005290641 6:24375364-24375386 CAGTGTCACATCTGGGTAAGTGG + Intergenic
1006196801 6:32248301-32248323 AAGTATTCCCTCTTGGAAATGGG - Intergenic
1006348249 6:33500992-33501014 CAGTTTCTGCTCTGTGAAATGGG - Intergenic
1006604153 6:35244192-35244214 CAGTGTCCCCTCTGGGAAATTGG - Intronic
1006717042 6:36127302-36127324 CAGTGTCCTCCTTGTGAAATGGG - Intergenic
1006804486 6:36779233-36779255 CAGTTTCCCCTCTGGAACATGGG + Intronic
1007260163 6:40557752-40557774 CTGTGTCTCCTCTGTTAAATGGG + Intronic
1011753257 6:90474323-90474345 CAGTTTCCCCTTTGGAAAAAGGG + Intergenic
1017230099 6:152064344-152064366 CAGTATCCCCTCTGCCCAATGGG + Intronic
1018907969 6:168086184-168086206 CAGTGTCCACACTGGGAATGTGG - Intergenic
1019343360 7:518658-518680 CAGTGTCCTCTCCGGGGAAGGGG - Intronic
1019364698 7:627414-627436 CAGTGTCCCGTCTGTAAAATGGG - Intronic
1024022884 7:45387398-45387420 CAGTGGCCCATCTGCAAAATGGG + Intergenic
1024121528 7:46245961-46245983 GAATGTCCCCTGTAGGAAATGGG - Intergenic
1024262734 7:47583966-47583988 CAGTGTCACCTCCTGTAAATGGG - Intergenic
1028213695 7:88106262-88106284 CAGTGGCTCCCCTGGGAATTTGG + Intronic
1029993118 7:104980099-104980121 AATTCTCCCCTCTGGAAAATGGG + Intergenic
1030072086 7:105706649-105706671 CAGCATCCCCTCTGGGGACTGGG + Intronic
1030484942 7:110153387-110153409 CACTGTCCCGTCTGGGAGACAGG - Intergenic
1031143801 7:117975178-117975200 CACTTTCCTCTCTGTGAAATAGG + Intergenic
1031602229 7:123724069-123724091 CAGTGTCTCCTCTTGGGAAGGGG - Intronic
1031992492 7:128207386-128207408 GAGAGTCCCCTGTGGGAACTGGG + Intergenic
1032590677 7:133189476-133189498 CAGTCTCCCATCTGTAAAATGGG - Intergenic
1038141255 8:24847910-24847932 CAGTGTGCAATATGGGAAATGGG - Intergenic
1039458883 8:37727087-37727109 CTGTGACCCCTCTGGGATCTAGG - Intergenic
1039762121 8:40589226-40589248 CAGTTTCCTCTCTGTTAAATCGG - Intronic
1041619016 8:59943493-59943515 CAGTTTCCCCACTTGGAAATTGG - Intergenic
1041848069 8:62354809-62354831 TTATGTCCCCTGTGGGAAATGGG - Intronic
1044465710 8:92501920-92501942 CAGTGTCTCATCTGTAAAATAGG - Intergenic
1045016654 8:98006627-98006649 CACTTTCCTCTCTGTGAAATGGG + Intronic
1045226179 8:100248161-100248183 CAGTTTCCCATCTGTAAAATAGG + Intronic
1047373520 8:124275506-124275528 CAGTCTTCCCTCTGGAAAATGGG - Intergenic
1047720420 8:127633854-127633876 CAGTTTCTCATCTGTGAAATGGG - Intergenic
1047916597 8:129590668-129590690 AAGTTTCTCCTCTGTGAAATGGG + Intergenic
1047961518 8:130015407-130015429 TAGGGTCCCGTCTGTGAAATGGG - Intronic
1048101557 8:131357761-131357783 AAGTATCCCTTATGGGAAATGGG - Intergenic
1048260113 8:132938099-132938121 CAGTTTCTCCTCTGTAAAATGGG + Intronic
1048293957 8:133200677-133200699 CAGTTTCCCATCTGTCAAATTGG + Intronic
1049843317 8:144787774-144787796 CAGTGTCCACTCTGGAGAAAGGG + Intergenic
1050087542 9:1981612-1981634 CAGTGTTCCCACTAGCAAATGGG + Intergenic
1056000960 9:82216045-82216067 CAGTTTCCTCCCTGGGAAAGGGG + Intergenic
1056199369 9:84259661-84259683 CAGTGTCAACTCTTGGAAAAAGG - Intergenic
1056940196 9:90949008-90949030 CAGTTACCCATCTGGGAAAATGG - Intergenic
1057184988 9:93052515-93052537 CAGTTTCCCATCTGTAAAATGGG + Intergenic
1057199351 9:93132114-93132136 CAGTTTCTCATCTGTGAAATGGG - Intronic
1058952277 9:109915080-109915102 AAGGCTCCACTCTGGGAAATGGG - Intronic
1058986600 9:110213734-110213756 AAGTTTCCCATCTGGAAAATGGG - Intergenic
1060259870 9:122065016-122065038 GAGTGTCACCACTGGGAATTTGG - Intronic
1061170924 9:128953718-128953740 CAGTTTCCCCACTGGTAAAATGG - Intronic
1061231793 9:129319763-129319785 CAGTGTCCCCATTGGGAAGGTGG - Intergenic
1061234016 9:129332006-129332028 CAGTTTCCCATCTGCAAAATGGG + Intergenic
1061374418 9:130215622-130215644 CAGTGCCTCATCTGTGAAATGGG + Intronic
1061565180 9:131434058-131434080 CAGTGTCCCCCCCTTGAAATAGG + Intronic
1061678341 9:132230687-132230709 CAGTGTCCCCTCTGGGACTTGGG + Intronic
1062467904 9:136689265-136689287 CAGTTTTCCCTCTGTAAAATGGG - Intergenic
1189643845 X:43104828-43104850 CATTTCCCCATCTGGGAAATGGG - Intergenic
1191861325 X:65668250-65668272 CCATGTCCCCTCTTGGACATTGG - Intronic
1192932762 X:75825416-75825438 CAATGTCTCATCTGAGAAATTGG + Intergenic
1195465634 X:105176270-105176292 CCTTTTTCCCTCTGGGAAATGGG - Intronic
1196138852 X:112238988-112239010 CAATCTCCCCACTGGGAAACAGG + Intergenic
1196414030 X:115452001-115452023 CAGTTTCCTCTTTGGGAAGTTGG + Intergenic
1196889313 X:120276834-120276856 CAGTGGCCCCTGTTGGACATAGG - Intronic
1196975010 X:121149714-121149736 CATTGTCTACTCTTGGAAATGGG + Intergenic
1198166754 X:134065017-134065039 AAGTTCTCCCTCTGGGAAATGGG + Intergenic
1198507344 X:137313826-137313848 CAGTTTCCCCTCTGAAAAAGTGG + Intergenic
1198587767 X:138141674-138141696 CTGTGTCACCACTGGGAAAAAGG + Intergenic
1198930957 X:141859753-141859775 CAGTGCCCTATCTGGGATATAGG - Intronic
1199451190 X:147980909-147980931 CAGTGTGCACTCTGGGAATGAGG + Intergenic
1199671098 X:150148924-150148946 CAGTGTTCCTGCTGGGAAACTGG + Intergenic