ID: 1006605068

View in Genome Browser
Species Human (GRCh38)
Location 6:35250234-35250256
Sequence TGAGGTCCACACTGACTCCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 221}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006605068_1006605071 -4 Left 1006605068 6:35250234-35250256 CCATGGAGTCAGTGTGGACCTCA 0: 1
1: 0
2: 2
3: 25
4: 221
Right 1006605071 6:35250253-35250275 CTCATGATTATAGAGGCCAATGG 0: 1
1: 0
2: 0
3: 16
4: 173
1006605068_1006605072 2 Left 1006605068 6:35250234-35250256 CCATGGAGTCAGTGTGGACCTCA 0: 1
1: 0
2: 2
3: 25
4: 221
Right 1006605072 6:35250259-35250281 ATTATAGAGGCCAATGGAACTGG 0: 1
1: 0
2: 0
3: 11
4: 192
1006605068_1006605074 27 Left 1006605068 6:35250234-35250256 CCATGGAGTCAGTGTGGACCTCA 0: 1
1: 0
2: 2
3: 25
4: 221
Right 1006605074 6:35250284-35250306 AGTGATTCTCTACCCCAAGTAGG 0: 1
1: 0
2: 0
3: 10
4: 69
1006605068_1006605075 28 Left 1006605068 6:35250234-35250256 CCATGGAGTCAGTGTGGACCTCA 0: 1
1: 0
2: 2
3: 25
4: 221
Right 1006605075 6:35250285-35250307 GTGATTCTCTACCCCAAGTAGGG 0: 1
1: 0
2: 1
3: 4
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006605068 Original CRISPR TGAGGTCCACACTGACTCCA TGG (reversed) Exonic
900798419 1:4723398-4723420 AGTGGTCCCCACTGTCTCCATGG - Intronic
901122643 1:6907828-6907850 TGAGGACCACAGTGGCTCCCAGG - Intronic
901701224 1:11045616-11045638 TGAGGTCCACTCTGAGGTCATGG - Intronic
902281891 1:15380843-15380865 TGCGTTCAACACTGACTGCAGGG - Intronic
905541579 1:38764456-38764478 ACATGTCCACACTTACTCCAGGG + Intergenic
908798612 1:67855737-67855759 TGTTGTCCCCACTCACTCCACGG - Intergenic
915399301 1:155610755-155610777 TCAAGTCCTCACTGTCTCCAGGG - Intronic
915416415 1:155746335-155746357 TCAAGTCCTCACTGTCTCCAGGG - Intergenic
915493922 1:156267654-156267676 TGAGGTCAGCTCTGAGTCCACGG + Exonic
917520262 1:175742551-175742573 TGAGGTCCCTTCTGACTTCATGG - Intronic
920997952 1:211013327-211013349 GGAGGTCAGCACTGACTCCAAGG - Intronic
921289918 1:213647944-213647966 TGGGGTCCAGGTTGACTCCAAGG - Intergenic
922243801 1:223775672-223775694 TGATGTCCCCTCTAACTCCATGG - Exonic
922724353 1:227915508-227915530 TGATGTCCTCACTGCCTCCATGG - Intergenic
922980663 1:229823741-229823763 TGGGGTCTGCACTAACTCCAGGG + Intergenic
923668048 1:236015899-236015921 TGATGTCCACACTCACTGAAGGG - Intronic
1062794089 10:329670-329692 TCAGGGCAGCACTGACTCCAAGG + Intronic
1062796963 10:351905-351927 TCAAGTCCACCCCGACTCCAGGG + Intronic
1062990466 10:1809895-1809917 TGAGGTCCAGTCTGAGGCCAAGG + Intergenic
1063422007 10:5920291-5920313 TGAGGTGCATACTGTCACCATGG + Intronic
1064298872 10:14104154-14104176 TGAGGTCTACACTGCCATCAAGG + Intronic
1064709347 10:18107790-18107812 TCAGGTTCAGAATGACTCCAAGG - Intergenic
1066404867 10:35108813-35108835 AGAGGTCCACAGGGACTGCATGG - Intergenic
1066463763 10:35635161-35635183 AGAGGTCAACTCTGAGTCCAGGG - Intergenic
1068673452 10:59745832-59745854 TGAAGTCAACTCTGACTCCAGGG + Intergenic
1069836548 10:71312812-71312834 TGAGGTCCACCCAGGATCCAGGG - Intergenic
1070615867 10:77968792-77968814 TGTGGCACACACTGACACCAGGG + Intergenic
1072803623 10:98410440-98410462 TGAGCTCCTCAATGTCTCCAGGG + Intronic
1073011461 10:100363081-100363103 TGCAGTTCACCCTGACTCCAGGG - Exonic
1073110459 10:101060644-101060666 TCAGGTCGACACTTATTCCAAGG + Intergenic
1074436190 10:113436394-113436416 TGAGGCCCACACTGTCTGAAGGG - Intergenic
1075004058 10:118818020-118818042 AGAGATCCAAGCTGACTCCAGGG - Intergenic
1075529618 10:123218429-123218451 TGAGGTCTCCACTGACACCTTGG + Intergenic
1075953005 10:126498222-126498244 GCAGTCCCACACTGACTCCAAGG - Intronic
1076562896 10:131378472-131378494 TGAGCTCCAGCCTGAGTCCATGG - Intergenic
1077165900 11:1138236-1138258 CGAGCTCCACGCTGAATCCACGG - Intergenic
1077354860 11:2110894-2110916 TGAGGTCCAGGCTCACTCTAGGG - Intergenic
1077535252 11:3120859-3120881 TGAGTTCCACTCTGAGTCCTGGG - Intronic
1077602343 11:3582230-3582252 GGAGCTCCACACTGACACTAAGG - Intergenic
1081724540 11:45318842-45318864 TGAGGTCAAGTCTGACTCCCTGG + Intergenic
1081791948 11:45794391-45794413 TGAGGTCCAGACACACTCCCTGG + Intergenic
1083406430 11:62460450-62460472 TGATGTCCACACTGCCTCTTGGG - Intronic
1084013656 11:66366364-66366386 TGGGGCTCACATTGACTCCAAGG - Intronic
1088885283 11:114001228-114001250 GGAGGACCACACAGACTCCTGGG + Intergenic
1091890159 12:4047184-4047206 TGAGATCAACCCTAACTCCAGGG - Intergenic
1092428486 12:8391582-8391604 GGAGCTCCACACTGACACTAAGG - Intergenic
1092429571 12:8397734-8397756 GGAGCTCCACACTGACACTAAGG - Intergenic
1095967309 12:47877721-47877743 TGAGGTCCACACATCCTGCAGGG - Intronic
1095985018 12:47993722-47993744 TGAGCTCCACAGTGTCTCCCTGG + Intronic
1096233332 12:49909672-49909694 GGGGGTGCTCACTGACTCCAGGG - Intergenic
1097716481 12:62971720-62971742 TCAAGTCCAAACTGAGTCCAAGG - Intergenic
1100198387 12:92272746-92272768 TGAGGGCAATAATGACTCCAAGG - Intergenic
1101817345 12:108155508-108155530 AGAGGTCAACACTGACTGAAAGG + Intronic
1103242815 12:119429087-119429109 TGAGAACGACTCTGACTCCACGG - Intronic
1104743342 12:131194585-131194607 TGATGTCCACACTGGCCCCAAGG + Intergenic
1104790981 12:131482096-131482118 TGATGTCCACACTGGCCCCAAGG - Intergenic
1105547151 13:21359287-21359309 TATGGTCCACACGGCCTCCAAGG + Intergenic
1107069710 13:36256741-36256763 TGAGGTCCACAGAGAGGCCAGGG - Intronic
1108455869 13:50612816-50612838 TGAGGTACTCACTAACTCCCAGG + Intronic
1108640371 13:52377942-52377964 GCATGTCCACTCTGACTCCACGG - Exonic
1110584515 13:77172695-77172717 AGAAGTCCAGAATGACTCCAAGG + Intronic
1111713226 13:91844431-91844453 TGAGGTTCAGCCTGATTCCAGGG + Intronic
1114888603 14:26887588-26887610 TCAGATCAACACTGCCTCCATGG + Intergenic
1117392908 14:55279576-55279598 TGAGGTTCACACATACTCCAAGG - Intronic
1119847467 14:77841071-77841093 TGACTTCCACAGTGACTGCAGGG + Intronic
1121243664 14:92447613-92447635 TGCCGTCCACACTGAGGCCAGGG + Intronic
1121557450 14:94849159-94849181 TGAGGACCTCCCTGAGTCCAGGG + Intergenic
1123799901 15:23808792-23808814 TGAGCACCACACAGACACCAGGG - Intergenic
1124502320 15:30239887-30239909 TGAGGTCCTTTCTGACTACAGGG - Intergenic
1124741243 15:32298764-32298786 TGAGGTCCTTTCTGACTACAGGG + Intergenic
1128126504 15:65197165-65197187 TGGGGTTCACACTGGCTCGACGG + Exonic
1129411926 15:75355003-75355025 TGAGGTCCCCTCTGGTTCCAAGG - Exonic
1132393555 15:101456340-101456362 TGACGCCCACCCTGACTCCTGGG + Intronic
1132694150 16:1194632-1194654 TGAGGGCCACTCAGACTCCCAGG - Intronic
1132816476 16:1830553-1830575 TGTGGTGAACACTGACCCCAGGG - Intronic
1133989338 16:10692451-10692473 TGAGTTCCCCACACACTCCAGGG + Intronic
1134692410 16:16199511-16199533 AGAGGTCCACTGTGACCCCAGGG - Intronic
1134979436 16:18595165-18595187 AGAGGTCCACTGTGACCCCAGGG + Intergenic
1137585837 16:49663786-49663808 TGGGGTGCACCCTGACTCCTAGG - Intronic
1138145136 16:54602345-54602367 TGTGGTGAACACTGACTACAGGG + Intergenic
1142699499 17:1650444-1650466 TCAGGTCTCCACTGAGTCCAGGG + Intergenic
1142918196 17:3161066-3161088 GTAGGGCCACACTGCCTCCAGGG - Intergenic
1143020123 17:3913199-3913221 TCAGCTCCACTCTGCCTCCAGGG + Intronic
1145185202 17:20787873-20787895 TGCAGTTCACCCTGACTCCAGGG - Intergenic
1146054620 17:29574885-29574907 TGAGCTCCGCACTGGCTCCAGGG + Exonic
1146151355 17:30475391-30475413 TGTGGTCCCCACTGCCACCATGG - Intergenic
1149665743 17:58363789-58363811 TCAGGTCCCCACTGCCTTCAAGG + Intronic
1151952670 17:77363842-77363864 TGAGGGCCACACGGACCCCCTGG - Intronic
1152542691 17:80984272-80984294 TGAGATCCCAGCTGACTCCAGGG + Intergenic
1153524193 18:5979293-5979315 TGAGGTCCAGTGTGTCTCCAAGG + Intronic
1153889405 18:9498809-9498831 TGATGTCCAATCTGACTGCAAGG - Intronic
1154339091 18:13488447-13488469 TGAGATCTACACTGACTTCAGGG + Intronic
1155167001 18:23239740-23239762 TGACATCCCCACTCACTCCAAGG - Intronic
1155636587 18:27963365-27963387 TGAAGTCCCCAATGTCTCCAGGG + Exonic
1157912053 18:51625480-51625502 TGAGATCGGCACTGGCTCCAAGG + Intergenic
1161866503 19:6836514-6836536 TGAGCTCCACAATGTCTCCAGGG - Exonic
1162590316 19:11587134-11587156 GGTGGTCCACACTGTCTCCAAGG + Intronic
1163747563 19:19057349-19057371 TGGGGTCCACTCTGACCTCAGGG - Intronic
1165447777 19:35866183-35866205 TCAGGCTCACACTGACTCCTCGG - Exonic
1167635631 19:50653550-50653572 TGCGGTAGACACTTACTCCAGGG - Intronic
926266514 2:11327360-11327382 TGAGGTCCAGAGTAGCTCCATGG + Intronic
929052185 2:37847304-37847326 AGAAGTCAACAGTGACTCCAAGG - Intergenic
929557183 2:42932807-42932829 GGAGGACCACACTGACTCCAAGG - Intergenic
934690091 2:96351944-96351966 TGATGTCCAGACTCTCTCCACGG + Exonic
936590089 2:113795369-113795391 ATAGGTCCACAGTGCCTCCAGGG + Intergenic
937073265 2:119082120-119082142 TGAGGCCCACTCTGACTGCCCGG - Intergenic
937130989 2:119513010-119513032 TTAGGTCCACAGTGTTTCCAAGG - Intronic
937260457 2:120582905-120582927 TGAGGTACTTACTAACTCCAGGG - Intergenic
937533415 2:122857320-122857342 GTAGGCCCACACTGACTCCAGGG - Intergenic
939512313 2:143122619-143122641 TGAGGACCACAGAGACACCAGGG - Intronic
939728299 2:145751299-145751321 TGAGGTCCACAGTGTCTCCCAGG + Intergenic
941867861 2:170353361-170353383 TGATCTCCATACTGTCTCCATGG - Intronic
943578274 2:189654910-189654932 TGATGTCCAATCTGATTCCAAGG + Intergenic
944139121 2:196436035-196436057 TGAGGTCCTCACTGCCTACAAGG - Intronic
946389492 2:219406940-219406962 TGGGGTCCACTCAGACCCCAGGG - Intergenic
947883237 2:233540097-233540119 TGAGGTCCACTCTGTCGCCCAGG - Intronic
947909876 2:233793910-233793932 TCGGGTCCACACTTACTCCCAGG + Intronic
1169764455 20:9133766-9133788 TGCTGTCCACAGTGCCTCCATGG - Intronic
1169817474 20:9672953-9672975 TGAGGTCCCTTCTGACTCTAAGG + Intronic
1170404487 20:16021801-16021823 TGTTCTCCACTCTGACTCCAGGG + Intronic
1170612534 20:17926321-17926343 TGAGTTCTACACTGTCTCCCAGG + Intergenic
1171382431 20:24743732-24743754 TGTGGTCCACACAGAATCCCAGG - Intergenic
1171391380 20:24803601-24803623 TGGTGTCCACATGGACTCCAGGG + Intergenic
1171748987 20:29029017-29029039 GGAGGTCCAAAGTGAATCCATGG + Intergenic
1172151057 20:32790694-32790716 TGAGGTCCTCACTGTCACCCAGG + Intronic
1172280378 20:33703670-33703692 CGTGCTCCACACTGACTCCCAGG - Exonic
1172670480 20:36631634-36631656 TGAGATCCACAGTGATGCCAGGG - Intronic
1173861819 20:46288712-46288734 TGAAGTCAAGACTGACTTCAAGG - Intronic
1175684677 20:61019961-61019983 TGAGGGGCACCCTGACTCCATGG - Intergenic
1176806487 21:13488818-13488840 TGCGGTCTGCACTAACTCCAGGG + Intergenic
1178502683 21:33138989-33139011 TGAGGTGCACTCTGACTTCTTGG + Intergenic
1179903845 21:44409953-44409975 TGAGGTCAAAACTTACTACAAGG - Intronic
1179903849 21:44409994-44410016 TGAGGTCAAAACTTACTACAAGG - Intronic
1179903897 21:44410630-44410652 TGAGGTCAAAACTTACTACAAGG - Intronic
1179903916 21:44410917-44410939 TGAGGTCAAAACTTACTACAAGG - Intronic
1179945364 21:44670588-44670610 TCAGGTCCATGCTGAATCCATGG - Intronic
1181658741 22:24324133-24324155 TGAGGTACACACAGTTTCCAAGG - Intronic
1182611969 22:31555812-31555834 TGAGGTCCACAGTGAAACCAAGG + Intronic
1183228594 22:36566682-36566704 GGAGCTCCCCACTGCCTCCAGGG + Intronic
1183612297 22:38917362-38917384 TGAAGTCACCACTGACTCTATGG - Intergenic
1184278451 22:43424028-43424050 AGAGTTCTACACTGACCCCAAGG + Intronic
1184787241 22:46677850-46677872 TGCGCTCCACACTCGCTCCACGG + Exonic
949560358 3:5195880-5195902 TGAGTGCCACACTGCCTTCAAGG - Intronic
951867314 3:27322714-27322736 TGAAGTCCAAACTGATTCCCAGG - Intronic
952241122 3:31532559-31532581 TGAGCTCCGCCCGGACTCCAGGG + Intergenic
953606846 3:44417983-44418005 TGAGCTCCCCACTGACCCCACGG + Intergenic
954045257 3:47924490-47924512 GGAGGTCCAGGATGACTCCAAGG - Intronic
954446226 3:50548203-50548225 TGAGGTCCACAGGGTCTGCAGGG - Intergenic
954964319 3:54596996-54597018 TGTGGTCACCACTGTCTCCACGG + Intronic
957073190 3:75581297-75581319 GGAGCTCCACACTGACACTAAGG - Intergenic
960070033 3:113419150-113419172 TGAGGTCCACACCATCTGCAGGG - Intronic
961280893 3:125765483-125765505 GGAGCTCCACACTGACACTAAGG + Intergenic
962609889 3:137066318-137066340 TTAGGCCCACACAGACTCCTGGG + Intergenic
963143758 3:141971184-141971206 TGAGTTCCTCACTGTCTCCTTGG + Intronic
964580261 3:158226608-158226630 TTTTGTCCACAGTGACTCCATGG + Intronic
965379666 3:167972727-167972749 TGGTGTCCAAACTGACTCCGAGG + Intergenic
967016220 3:185484246-185484268 TGAGGTCCTGCCTGTCTCCAGGG + Exonic
967187657 3:186959231-186959253 TGAGTTGCACACTGAGTACATGG - Intronic
969369741 4:6724093-6724115 TGATGTCAACACTGACACCCAGG + Intergenic
969455617 4:7298152-7298174 TGCGGTGCACACAGCCTCCAAGG - Intronic
969737174 4:8999724-8999746 GGAGCTCCACACTGACACTAAGG + Intergenic
969796365 4:9531312-9531334 GGAGCTCCACACTGACACTAAGG + Intergenic
970597980 4:17617262-17617284 TGAGGTCCACACAGAACACAAGG - Intronic
972501250 4:39680038-39680060 TGTGGTCTCCACTGACACCATGG + Intergenic
975211212 4:71702154-71702176 TTAGGTCCAAACAAACTCCAGGG - Intergenic
976352181 4:84072669-84072691 TGAGATTCACTCTGACTTCATGG + Intergenic
976521171 4:86028855-86028877 TGAGCTCCACATTGACTTGATGG + Intronic
976691937 4:87877398-87877420 TGTGGTCTCCACTGACACCACGG - Intergenic
989196832 5:38724421-38724443 CTCAGTCCACACTGACTCCAAGG + Intergenic
990364801 5:55059548-55059570 TGTGTTCCACACTGTCTCCCGGG - Intergenic
992191318 5:74294728-74294750 ACAGGGCCACACTGCCTCCAAGG - Intergenic
997609984 5:135209150-135209172 TCATGTCCTCACTCACTCCATGG - Intronic
1000018341 5:157298056-157298078 TGAGCTCCACTCTGCTTCCACGG - Intronic
1002570205 5:180135851-180135873 TGAGATCCTCTCTGCCTCCACGG - Intronic
1002931959 6:1640951-1640973 TGAAGTCCAGAGTGACCCCATGG + Intronic
1003024660 6:2543453-2543475 TGAGATCCACACTGCCTGCTGGG - Intergenic
1003784405 6:9468203-9468225 TGGACTCCACAGTGACTCCAGGG + Intergenic
1005188080 6:23185037-23185059 TGATATCCACCCTCACTCCATGG + Intergenic
1006605068 6:35250234-35250256 TGAGGTCCACACTGACTCCATGG - Exonic
1006844100 6:37050711-37050733 TGAGGTCCCCCAGGACTCCACGG - Intergenic
1007058939 6:38918787-38918809 TCAGATACACACTGCCTCCAGGG + Intronic
1013354546 6:109335471-109335493 TGAGGTCCACTCTCACTCGGGGG - Intergenic
1013415617 6:109921803-109921825 TCAGGTGCACCCTGATTCCATGG - Intergenic
1014886851 6:126792746-126792768 TAAGGTCCAAACTGTCTCCATGG - Intergenic
1017703410 6:157097504-157097526 TTAGGTGCAAAATGACTCCAAGG + Intronic
1018071322 6:160167046-160167068 TGAGGTCCACACTGGCTGCTGGG + Intergenic
1018759867 6:166884528-166884550 TGGGGTCTGCACTAACTCCAAGG + Intronic
1018783971 6:167093710-167093732 TGAGGTCAACACTCACACCACGG - Intergenic
1019936440 7:4261331-4261353 GGAGGTCCACACTGAGACCCAGG - Intronic
1021578451 7:22127007-22127029 TGAAGTCCTCACTGATTCCCAGG + Intronic
1022861867 7:34376059-34376081 TGAAGTCCAGATTGACTCCAGGG + Intergenic
1024157178 7:46637920-46637942 TGAAATGCACACTGACTTCAGGG + Intergenic
1026741251 7:72980053-72980075 TGAGGTTCACACTTTCTTCAAGG + Intergenic
1026801089 7:73400400-73400422 TGAGGTTCACACTTTCTTCAAGG + Intergenic
1027102483 7:75385025-75385047 TGAGGTTCACACTTTCTTCAAGG - Intergenic
1027660358 7:80981290-80981312 TGGGGTCCACTATGTCTCCAAGG - Intergenic
1029075263 7:97929391-97929413 GGAGCTCCACACTGACACTAAGG - Intergenic
1029252127 7:99244509-99244531 TGAGGTGCAGCCTGACTCCCAGG + Intergenic
1032348618 7:131139741-131139763 TGAGGTCCACACAGACTTCCTGG - Intronic
1034426206 7:151015580-151015602 CGAGTTCCTCACTGACTCCCAGG + Intronic
1036137177 8:6173153-6173175 TAAGATCCACAGAGACTCCAAGG + Intergenic
1036242261 8:7090987-7091009 GGAGCTCCACACTGACACTAAGG + Intergenic
1036258531 8:7223025-7223047 GGAGCTCCACACTGACACTAAGG - Intergenic
1036259582 8:7229169-7229191 GGAGCTCCACACTGACACTAAGG - Intergenic
1036307037 8:7610355-7610377 GGAGCTCCACACTGACACTAAGG + Intergenic
1036308090 8:7616483-7616505 GGAGCTCCACACTGACACTAAGG + Intergenic
1036310586 8:7681621-7681643 GGAGCTCCACACTGACACTAAGG - Intergenic
1036311625 8:7687739-7687761 GGAGCTCCACACTGACACTAAGG - Intergenic
1036357884 8:8058342-8058364 GGAGCTCCACACTGACACTAAGG + Intergenic
1036358946 8:8064484-8064506 GGAGCTCCACACTGACACTAAGG + Intergenic
1036598562 8:10238224-10238246 TGAGTGCCTCACTGCCTCCATGG + Intronic
1036830475 8:12016143-12016165 GGAGCTCCACACTGACACTAAGG - Intergenic
1036892012 8:12602468-12602490 GGAGCTCCACACTGACACTAAGG - Intergenic
1036893065 8:12608604-12608626 GGAGCTCCACACTGACACTAAGG - Intergenic
1036899560 8:12660443-12660465 AGAGCTCCACACTGACACTAAGG - Intergenic
1036900625 8:12666590-12666612 GGAGCTCCACACTGACACTAAGG - Intergenic
1037053919 8:14412048-14412070 TGAGGTCAACACTGGCTTTATGG - Intronic
1037776011 8:21836034-21836056 TGGGGTCCACCCTCAATCCACGG - Intergenic
1039766521 8:40633991-40634013 TGAAGGACACACTGAGTCCAAGG + Intronic
1039888377 8:41668460-41668482 CAAGGTCCACACTCATTCCAGGG - Exonic
1040461361 8:47652203-47652225 TGAGGCCCACACTTTCTCAAAGG + Intronic
1040600631 8:48880280-48880302 TGAGGTCCACCTTGACTCCAGGG - Intergenic
1041363287 8:57073935-57073957 GGAGGTCTACTCTGACTCCCAGG - Intergenic
1041905381 8:63027234-63027256 TGAGGTCAACACTTCCTCCAGGG + Exonic
1042843596 8:73148610-73148632 GAAGGGCCACAGTGACTCCAGGG + Intergenic
1042936716 8:74066712-74066734 TTGGGTCCACCCTGCCTCCAGGG - Intergenic
1045830185 8:106449830-106449852 TGTGGCCCCTACTGACTCCAAGG - Intronic
1047353185 8:124095316-124095338 TAAGTTGAACACTGACTCCAGGG - Intronic
1047591270 8:126329959-126329981 TGTGTTTCACACTGACTCCCAGG - Intergenic
1048249096 8:132844033-132844055 TGAGATCCAATCTGACTCCAGGG - Intronic
1048923792 8:139252971-139252993 TGGGGTCCACACTGGCTGCCTGG - Intergenic
1049174630 8:141184292-141184314 TGAGCCCCTAACTGACTCCATGG - Intronic
1049766104 8:144355924-144355946 TGACAGCCACACTGGCTCCAGGG + Intronic
1053267605 9:36726431-36726453 TGAGGTCAGCACAGACTCCAGGG + Intergenic
1056192167 9:84194971-84194993 TGGGGTTCCCACTGGCTCCATGG + Intergenic
1056366138 9:85907313-85907335 TGACGCCCAGACTGACTCCTGGG + Intergenic
1060967750 9:127721165-127721187 GGAGGCTCCCACTGACTCCAGGG - Intronic
1060968325 9:127723991-127724013 TGGGATCCCCACTGCCTCCATGG + Intronic
1061438435 9:130581457-130581479 GGAGGTCCATACTATCTCCAAGG + Intronic
1062423289 9:136494274-136494296 TGGGGACCACGCTGCCTCCAGGG - Intergenic
1185713457 X:2322511-2322533 TGAACTCCAGCCTGACTCCAGGG + Intronic
1186341798 X:8653465-8653487 AGAGGTCCAGGATGACTCCAAGG - Intronic
1190393420 X:49955198-49955220 TGAGGTCGACACTGCCTACAAGG - Intronic
1193888250 X:87009629-87009651 GTAGGTGCACACTGACTCAATGG - Intergenic
1194268158 X:91779732-91779754 TGAGGTCCACACTTAGTGCGCGG + Intronic
1194540834 X:95170276-95170298 TGAGGATCACACTGACTCTGTGG + Intergenic
1195659229 X:107361922-107361944 TGAGGTGTAAACTGCCTCCATGG + Intergenic
1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG + Intronic
1201235122 Y:11901945-11901967 TGTAGTCCCCACTGACTGCATGG + Intergenic