ID: 1006606479

View in Genome Browser
Species Human (GRCh38)
Location 6:35260700-35260722
Sequence ACTGAGGTCCAGACTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 8, 3: 53, 4: 443}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006606479_1006606485 5 Left 1006606479 6:35260700-35260722 CCCTCCTCAGTCTGGACCTCAGT 0: 1
1: 0
2: 8
3: 53
4: 443
Right 1006606485 6:35260728-35260750 ATCATGACTGTGATGAGGTTGGG No data
1006606479_1006606483 0 Left 1006606479 6:35260700-35260722 CCCTCCTCAGTCTGGACCTCAGT 0: 1
1: 0
2: 8
3: 53
4: 443
Right 1006606483 6:35260723-35260745 TTCTCATCATGACTGTGATGAGG 0: 1
1: 0
2: 3
3: 12
4: 182
1006606479_1006606484 4 Left 1006606479 6:35260700-35260722 CCCTCCTCAGTCTGGACCTCAGT 0: 1
1: 0
2: 8
3: 53
4: 443
Right 1006606484 6:35260727-35260749 CATCATGACTGTGATGAGGTTGG 0: 1
1: 0
2: 0
3: 15
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006606479 Original CRISPR ACTGAGGTCCAGACTGAGGA GGG (reversed) Intronic
900507760 1:3038254-3038276 ACTGATGTGCAGACGGAGGTAGG - Intergenic
900619088 1:3578790-3578812 GCTGGGGACCAGGCTGAGGAGGG - Intronic
901781890 1:11599587-11599609 AATGAGGTCCAGAGAGGGGAAGG - Intergenic
902293030 1:15447393-15447415 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
902778173 1:18687821-18687843 ACCGAAGCCCAGACTGGGGAAGG - Intronic
902936377 1:19767761-19767783 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
903014731 1:20354461-20354483 ACTGAGGCCCAGACGGGGGCAGG - Intronic
903240284 1:21978233-21978255 ACTGAGGTCCAGAGGGCGAAAGG + Intronic
903244033 1:22002867-22002889 ACTGAGGTCCAGAGGGCGAAAGG + Intronic
903357163 1:22755234-22755256 ACTGAGGTCCGGAGCCAGGAAGG + Intronic
903483955 1:23675904-23675926 ACTGAGGTCCAGAGAAGGGAGGG - Intergenic
903658048 1:24960803-24960825 ACTGAGGCCCAGAGAGAGGAAGG + Intronic
903747209 1:25595656-25595678 ACTGAGGTCTAGAGTGGGCAAGG + Intergenic
904050710 1:27636537-27636559 ACTGAACCCCAGATTGAGGAGGG - Intergenic
904276534 1:29388384-29388406 ACTGAGGAGCAGACAGAGAAGGG + Intergenic
904338105 1:29810905-29810927 ACTGAGGCCCAGATTGGGGCAGG + Intergenic
904361592 1:29976729-29976751 ACTGAGGTTCAGAGAGGGGAAGG - Intergenic
904373097 1:30063079-30063101 GCTCAGGCCCAGACTGATGATGG - Intergenic
904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG + Intergenic
904461704 1:30684608-30684630 ACTGAGGCCCAGATTGAGGCAGG - Intergenic
904561755 1:31402918-31402940 ACTGAGGCCAAGACCGAAGAAGG - Intergenic
904851541 1:33463245-33463267 ACTGAGGCCCAGACAGAAGAAGG - Intergenic
905042766 1:34973884-34973906 ACAGAAGTCCAGACTCAAGAAGG + Intergenic
905242912 1:36592701-36592723 ACGGAGGTCCAGACAGAAGATGG + Intergenic
906323031 1:44828340-44828362 CCGTAGGTCCAGGCTGAGGATGG + Exonic
906478106 1:46183500-46183522 TCTGAGGCCTAGATTGAGGAGGG - Intronic
906517073 1:46445898-46445920 ACTCAGGTCCAGAGAGATGAAGG - Intergenic
906692481 1:47801686-47801708 TCTGAAGTCCAGAGGGAGGAGGG - Intronic
907272245 1:53297970-53297992 ACTGAGGCCCAGAATGGGAAGGG - Intronic
907320794 1:53601007-53601029 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
907651207 1:56296424-56296446 ATTGAGGCTCAGATTGAGGAAGG - Intergenic
907823190 1:57990635-57990657 CCAGAGGTCCAGACTGAGGACGG + Intronic
907968005 1:59352226-59352248 AACAAGGTGCAGACTGAGGAAGG + Intronic
908360053 1:63359993-63360015 GCTGAGGTTCAGAAGGAGGAGGG - Intergenic
910074156 1:83257749-83257771 TCTGAGCTTCAGACTTAGGAAGG + Intergenic
912701508 1:111881716-111881738 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
912779069 1:112527045-112527067 ACAGAGGTCCAGATTTTGGATGG - Intronic
912883514 1:113444280-113444302 ACAGAGGTGCAGAGAGAGGATGG + Intronic
913089221 1:115465302-115465324 ACTGAGGCCCAGAGTGGGGAAGG + Intergenic
914286977 1:146236204-146236226 ACTGAGATCCAGACTGTGCCAGG - Intergenic
914548010 1:148686946-148686968 ACTGAGATCCAGACTGTGCCAGG - Intergenic
915916403 1:159943410-159943432 GCTGATGACCAGGCTGAGGACGG + Exonic
916203535 1:162294263-162294285 ACTGCAGTGCAGTCTGAGGAAGG + Intronic
916881138 1:169020310-169020332 ACTGATGTCCATTCTCAGGAGGG + Intergenic
919408706 1:197216724-197216746 AATGAGGTCAAAACTGAAGAGGG + Intergenic
919762253 1:201105657-201105679 ACTGAGGCCCAGAGAGAGCAAGG - Intronic
922501489 1:226100031-226100053 ACTGACTTCCACACTGAGGGAGG + Intergenic
922680785 1:227593549-227593571 ACTAATGCCCAGTCTGAGGAGGG + Intronic
922690141 1:227682555-227682577 ACTAATGCCCAGTCTGAGGAGGG - Intergenic
922779841 1:228243221-228243243 AGTGAGGTGCAGGCTGAGGCAGG + Exonic
922779970 1:228244334-228244356 AATGAGGTGCAGGCTGAGGCGGG + Exonic
922780095 1:228245451-228245473 AATGAGGTGCAGGCTGAGGCGGG + Exonic
922780216 1:228246566-228246588 AATGAGGTGCGGACTGAGGCAGG + Exonic
923566378 1:235079658-235079680 ACTCAGGCCCAGACTGGGGCAGG - Intergenic
924676564 1:246184472-246184494 TCTGAGGTACAGATTGAGGATGG - Intronic
1063607002 10:7531402-7531424 ACTGAGAACCAGACGGTGGATGG + Intergenic
1065082422 10:22141313-22141335 AGTGGGGTCCAAACTGGGGATGG - Intergenic
1067470691 10:46535775-46535797 GCTCAGGTCCAGACTGATGGAGG - Intergenic
1067477485 10:46576493-46576515 ACTGAACTCTAGACAGAGGAAGG + Intergenic
1067617255 10:47765291-47765313 ACTGAACTCTAGACAGAGGAAGG - Intergenic
1069716177 10:70522890-70522912 ACTGAGGCCCAGAGAGGGGAAGG + Intronic
1069800974 10:71081239-71081261 ACTGAGGCCCAGAGAGGGGACGG + Intergenic
1069875608 10:71561217-71561239 ACTGAGGGCCAGAGTGAAAACGG - Intronic
1070430995 10:76337487-76337509 AAAGTGGTCCAGGCTGAGGAAGG + Intronic
1070778797 10:79125813-79125835 ACTGAGGCCCAGAGATAGGAGGG + Intronic
1072189247 10:93066875-93066897 ACTGAGGCCCAGAGTGAAGAGGG - Intronic
1073079966 10:100853503-100853525 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1073481519 10:103788950-103788972 GCTGAGGTCCAGCCTGGGGCGGG + Intronic
1074249172 10:111726712-111726734 ACTGAGGCTCAGAGTGAAGAAGG - Intergenic
1074688321 10:115980060-115980082 ACTGAGGCCCAGATTAGGGAAGG - Intergenic
1075055512 10:119215510-119215532 AGTGAGGAAGAGACTGAGGAAGG + Intronic
1075184694 10:120245225-120245247 AATGAAGGCCAGGCTGAGGAGGG + Intergenic
1075653271 10:124144033-124144055 ACAGAGGTTCACTCTGAGGAGGG - Intergenic
1076524789 10:131105524-131105546 ACTGGAGTCCAGCCTGAGCATGG - Intronic
1076742905 10:132496837-132496859 ACAGGTGTCCAGACAGAGGAAGG - Intergenic
1076751446 10:132545457-132545479 AATGGGGTCCAGGCGGAGGAGGG + Intronic
1078867288 11:15309783-15309805 GCTTAGGTCCAGAGTCAGGATGG + Intergenic
1080459169 11:32438494-32438516 ACTGAGGCCCAGACAGCCGAAGG + Intergenic
1080680492 11:34470970-34470992 ACTGAGGTCCACCCTGACTACGG + Exonic
1080746924 11:35116493-35116515 ACTGAGGCCCAGAGGGATGAAGG - Intergenic
1081166814 11:39817799-39817821 TCTGAGCTCCAGAATTAGGAAGG - Intergenic
1081636059 11:44723049-44723071 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1082997277 11:59264032-59264054 ACTGAGGCCCACACAGATGAAGG - Intergenic
1082999870 11:59281430-59281452 ACTTAGTTCCAGAGGGAGGAAGG + Intergenic
1083254144 11:61486085-61486107 ACTGAGGTCCAAAGAGATGAAGG + Intronic
1083272457 11:61579335-61579357 ACCTAGGTCCAGACAGATGAGGG + Intronic
1083297680 11:61723984-61724006 ACTGAGGTACAGAGAGATGATGG + Intronic
1083795935 11:65016720-65016742 ACTGAGGTCCAGTGTGTGGGAGG + Intronic
1083945138 11:65919265-65919287 GCGGCGGTCCAGACTGGGGAGGG + Exonic
1084033604 11:66494937-66494959 ACTGAGGACCAGACAGCCGAGGG - Intronic
1084105330 11:66976891-66976913 ACTGAGGCCCAGAGTGGGGAAGG + Exonic
1084264810 11:67999406-67999428 ACTGAGGCCCAGAGGGCGGAAGG + Intronic
1084325543 11:68397721-68397743 TCTGAGGTCCAGCCTGAGTTGGG + Intronic
1084351350 11:68602200-68602222 ACTGAGGTCTAGAGGGAAGAAGG + Intronic
1085270023 11:75264777-75264799 ACTGAGGCCCAGAGTGGGGAAGG + Exonic
1085280321 11:75325794-75325816 AGTGAGGTCCAGAGAGAGGCTGG - Intronic
1085309434 11:75507403-75507425 ACTGAGGCCCAGAGGGAGAAAGG + Intronic
1085386510 11:76161133-76161155 ACTGAGGTCCAGAAAGGGGCAGG + Intergenic
1086167864 11:83800237-83800259 ACTGAGGCCCAGAGAGATGAAGG - Intronic
1086402063 11:86469185-86469207 ACTGAGACCCAGACAGAGAAAGG - Intronic
1087056846 11:93945167-93945189 ACTGAGATCCAGACTGTGCCAGG + Intergenic
1087271262 11:96114422-96114444 ACTGAGGTTCTGAGTGGGGAGGG - Intronic
1088741375 11:112770119-112770141 CATGAGGGTCAGACTGAGGACGG + Intergenic
1088792528 11:113238576-113238598 ACTGAGGACGAGCCTTAGGAAGG + Intronic
1090948127 11:131449425-131449447 GCAGAGGTCCAGTTTGAGGAAGG + Intronic
1090954638 11:131503404-131503426 AGTGAGGTCCTCACCGAGGAGGG + Intronic
1091644653 12:2264456-2264478 ACTGAGGTCCAGGGAGATGATGG + Intronic
1091822041 12:3482789-3482811 ACTGAGGTCCACAATGAGCCTGG + Intronic
1092833194 12:12464623-12464645 AGTGGGGTCCATGCTGAGGAAGG + Intronic
1094096134 12:26706859-26706881 ACTGAGGCCCAGCCCAAGGAAGG - Intronic
1095580978 12:43797817-43797839 ACTTAGGTACAGACTGACGTGGG - Exonic
1096515688 12:52153944-52153966 ACTGAGGTCCAGAGAGAGGAAGG - Intergenic
1096838730 12:54368579-54368601 ACTGAGGTCCAGAGAGGGCAAGG + Intergenic
1096955095 12:55517831-55517853 AATAAGGTCCAGGCTGAGGTAGG + Intergenic
1096955113 12:55518017-55518039 AATAAGGTCCAGGCTGAGGTAGG + Intergenic
1097392090 12:59027247-59027269 ACTGAGGTTCAGAGTGGTGAAGG + Intergenic
1097711680 12:62924199-62924221 ACTGAGGCCCAGAGTGGGGGGGG + Intronic
1097804650 12:63952139-63952161 AGTGAGGTGCAGAGTGGGGAGGG - Intronic
1099953795 12:89332995-89333017 ACTGAGGTCAAGAGAGATGAGGG + Intergenic
1101926193 12:108973243-108973265 ACTGAGGGCCAGAGAGGGGAGGG + Intronic
1102339119 12:112108221-112108243 ACTGAGGTCCGGAGTGGGGAAGG - Intronic
1103037002 12:117664690-117664712 ACTGAGACCCAGATAGAGGAAGG + Intronic
1103984033 12:124755268-124755290 ACTGAGGTCCAGATGGACGTGGG - Intergenic
1105593233 13:21812867-21812889 ACTGAGGGCCAGGGTGGGGAAGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106307133 13:28522686-28522708 ATTGAGGACCAGGCTGAGAAGGG - Intergenic
1106422962 13:29598742-29598764 ACTGAGGCACAGAGTGAGCAGGG - Intergenic
1107093950 13:36514894-36514916 TCCGAGGGGCAGACTGAGGAAGG + Intergenic
1107557914 13:41534029-41534051 CCTGAGCTCCAGCCTGAGCAGGG - Intergenic
1108108252 13:47036871-47036893 AATGAGACCTAGACTGAGGAAGG + Intergenic
1109255482 13:60075637-60075659 AGTGAGGTTCACACTGAGAAAGG - Intronic
1110273371 13:73616101-73616123 ACTCAGGTCCAGTCCAAGGAGGG + Intergenic
1111716730 13:91887751-91887773 ACTGATGTCCAGGCTGGAGATGG - Intronic
1112055183 13:95684200-95684222 AGTGAAGTTCAGGCTGAGGAGGG + Intronic
1113272761 13:108692853-108692875 GCTGATGTCCACACTGTGGATGG + Intronic
1113960133 13:114121606-114121628 ACAGAGGTTCAGGCTGAGGGAGG - Intronic
1114551334 14:23534355-23534377 AATGTGGCCCAGACAGAGGATGG - Exonic
1114705671 14:24724325-24724347 ACTGAGGTCCACCTTCAGGATGG + Intergenic
1115202261 14:30867600-30867622 ACTGATGTCCAGATTGATTAAGG - Intergenic
1115466070 14:33715648-33715670 ACTGAGGCCCAGACTTGTGATGG - Intronic
1116235889 14:42279185-42279207 AGTGAGCTCCAGGCTGGGGACGG - Intergenic
1116687716 14:48062384-48062406 ACTGCAGTCCAGACTGTTGATGG + Intergenic
1118329150 14:64802286-64802308 ATTGTGGTCCAAACTCAGGAAGG - Exonic
1118994774 14:70825848-70825870 ACTGAGGTCCAGGCTGGGCGAGG - Intergenic
1119978972 14:79058204-79058226 GCTGAGGTTCAAACTGAGGTTGG + Intronic
1120179191 14:81325839-81325861 ACAGAGGGGCAGACTGAGAAGGG + Intronic
1120795736 14:88631115-88631137 TCTGAGGTGCAGTCTTAGGAGGG + Intronic
1121625895 14:95385197-95385219 ACTGGGGGCCAGAGTGAGGAAGG + Intergenic
1122067172 14:99181807-99181829 CCTGAAGTCCAGAGTGGGGAAGG - Intronic
1122150242 14:99721754-99721776 ACTGAGGTCCAGAAGGAGAAGGG - Intronic
1122409813 14:101520128-101520150 ACTGAGGTCAAGATGGAGCAGGG - Intergenic
1122638439 14:103141922-103141944 GCTGAGGTCCCGGCTGAGGGAGG - Intergenic
1122976029 14:105171105-105171127 CCTGGGGACCAGGCTGAGGACGG + Intergenic
1126810814 15:52402075-52402097 ACTGAGGCCTAGACTGAAGGTGG + Intronic
1127916082 15:63456478-63456500 CCTGAGGCCCAGAAAGAGGAAGG - Intergenic
1128048915 15:64645126-64645148 ACTGTACTCCAGCCTGAGGAAGG - Intronic
1128161677 15:65426797-65426819 ACTGAGGCCCAGAGAGAGGATGG - Intergenic
1128302529 15:66575513-66575535 ACTGAGGTCCAGAAAGGGCAAGG + Intergenic
1128382386 15:67122556-67122578 ACTGAGGTCCAGAGAGGTGAGGG + Intronic
1129207414 15:74045265-74045287 AGGGAGGTCCTGAGTGAGGAAGG + Exonic
1129250558 15:74306611-74306633 ACTGAGGTCCAGACAGGGAAGGG - Intronic
1129523549 15:76200401-76200423 ACTGAGGCCCAGAGAGGGGATGG + Intronic
1129659068 15:77543065-77543087 ACTGAGGCCCAGAGAGAGGCAGG - Intergenic
1129686864 15:77691288-77691310 ACTGAGGTCCAGAGAGGAGAAGG + Intronic
1129703928 15:77783885-77783907 ACTGAGGTGCAAACGGAGAAAGG - Intronic
1130018096 15:80202672-80202694 ACAGAGGAATAGACTGAGGAGGG + Intergenic
1130556792 15:84928427-84928449 ACTGAGGAACTGACTGGGGAAGG - Intronic
1130995802 15:88903328-88903350 ACTGAGAGCCAGAGAGAGGAAGG - Intronic
1133926935 16:10200862-10200884 ACTGAGGAGCAGCCAGAGGAGGG + Intergenic
1135166325 16:20142190-20142212 CCTGACTGCCAGACTGAGGAAGG + Intergenic
1136141754 16:28292900-28292922 GCGGGGGCCCAGACTGAGGAGGG - Exonic
1137021619 16:35433314-35433336 ACTGAGGTCCAGAAAGAGGAAGG - Intergenic
1137405252 16:48184121-48184143 ACTGAGGCCCAGACAAGGGAAGG - Intronic
1137518321 16:49169854-49169876 ACTGAAGACCAGACTAAAGAGGG + Intergenic
1137876580 16:52002424-52002446 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1138288197 16:55825735-55825757 ACTGAGGCCCAGACAGGGAAGGG - Intronic
1139356341 16:66369048-66369070 ACTGAGGTGCAGGCTGCAGAGGG - Intronic
1139526276 16:67518677-67518699 ACTGAGTTCCAGAGGGAGCAAGG - Intronic
1140457338 16:75112978-75113000 ACCGTGGTCAAGGCTGAGGATGG + Intronic
1140616073 16:76665841-76665863 ACTGAGCTGCAGACTGCAGAAGG - Intergenic
1142112663 16:88340614-88340636 GCTGAGGCCCAGAGGGAGGAAGG + Intergenic
1143022825 17:3925559-3925581 ACTGAGGTCTGGACTAAGGGAGG - Intronic
1143082257 17:4390256-4390278 ACTGAGGTCCAGGGAGAGGGAGG + Intergenic
1143579727 17:7818471-7818493 GCTGAGGTCCAGACTGAGCTAGG + Intronic
1143668144 17:8376606-8376628 AAAGAGCTGCAGACTGAGGAAGG + Intronic
1144761285 17:17709032-17709054 ACTGAGGCCCAGAGAGTGGAAGG + Intronic
1145786571 17:27597623-27597645 ACTGAGGTTCAGAGAGAGGGAGG + Intronic
1146012060 17:29203975-29203997 AATGAGGTACAGACTGACGTGGG - Intergenic
1146264515 17:31443485-31443507 ACTGATGTCTAGAGTGAGGTAGG + Intronic
1146287099 17:31581408-31581430 GGTGAGAGCCAGACTGAGGAGGG - Intergenic
1146589632 17:34117561-34117583 CCTGGGGTCCAGACTGGGAAGGG + Intronic
1146640607 17:34538015-34538037 ACTGAGGTCCAGACTTACCTGGG + Intergenic
1147832429 17:43306189-43306211 ACTGAGGTCCAGACAGATTAGGG - Intergenic
1147898412 17:43767557-43767579 ACTGAGGTTCAGAATGATTAAGG - Exonic
1148204371 17:45770708-45770730 ACCAAGGTCCAGAGGGAGGAAGG + Intergenic
1148652322 17:49259199-49259221 ACTGAGGCCCAGAATGGGGAAGG + Intergenic
1148887936 17:50787043-50787065 CCTGGGATCCAGACTGTGGAGGG - Intergenic
1149321238 17:55483538-55483560 ACTGAGGTCCAGACTGCCTTCGG + Intergenic
1150129314 17:62658475-62658497 ACTGAAGTCCAGAAAGGGGACGG - Intronic
1151340330 17:73466874-73466896 ACTGAGGTCCAGAGAGGGGAAGG + Intronic
1151514339 17:74582503-74582525 TCTGAGGAGCAGACTAAGGAGGG + Intronic
1151652817 17:75480707-75480729 AATGAGGACCACACTCAGGAAGG - Intronic
1151877025 17:76872692-76872714 GCTGAGCTCCAGACCCAGGAGGG - Exonic
1152258984 17:79256391-79256413 GCTGAAGCCCAGAGTGAGGATGG + Intronic
1152430414 17:80245766-80245788 CCTGTTGTCCTGACTGAGGAGGG - Intronic
1152905260 17:82966684-82966706 ACTGAGGTCCGGTCTGAGGCTGG - Intronic
1153021255 18:631230-631252 ACTGAGGTCCAGAAAGACCAAGG - Intronic
1153273640 18:3347635-3347657 ACTGAGGTCTAGAGAGAAGAGGG + Intergenic
1153355777 18:4133825-4133847 AGTGAGGTCCTGCGTGAGGATGG + Intronic
1154316802 18:13310630-13310652 GCTAAGGTCAAGACTGAGGGAGG - Intronic
1155706712 18:28824362-28824384 ACAGAGGAACAGACTCAGGATGG - Intergenic
1157190893 18:45580769-45580791 GCTGAGATTCAGACTGAGGCTGG + Intronic
1157295002 18:46435905-46435927 TCAGAGGTCAGGACTGAGGAGGG + Intronic
1157462971 18:47918066-47918088 ACTGAGGGCCAGGCAGGGGAAGG + Intronic
1157683206 18:49622971-49622993 ACTGAGGTTCTGAGAGAGGATGG - Intergenic
1158144623 18:54298325-54298347 CCTGATGTCCAGACAGAGGAGGG - Intronic
1158547438 18:58408174-58408196 GCAGAAGTCCAGACTGAGGGAGG - Intergenic
1160254867 18:77239699-77239721 AATGAGGAGCAGAGTGAGGAAGG - Intergenic
1160702277 19:513389-513411 ACTGAGGCCCAGAGGCAGGAGGG - Intronic
1161395875 19:4044568-4044590 AGTGAGGTCCAGGCTGGGGTTGG - Exonic
1161535755 19:4817709-4817731 GCTGCGGTGCAGGCTGAGGAAGG + Exonic
1162018446 19:7857917-7857939 ACTGAGAGCCAGAGTGGGGAAGG + Intronic
1162156090 19:8678937-8678959 ACTGAAGACCAGACTGAAGGAGG + Intergenic
1162328893 19:10014860-10014882 ACTAAGGTGCAGACTGTGAAAGG + Intronic
1162494766 19:11017567-11017589 ACAGAGGTCCAAACGGAGGCAGG - Intronic
1163221581 19:15925277-15925299 ACTGAGGTCCAGAGAGATTAGGG - Intronic
1164909318 19:31992809-31992831 GGTGGGGTCCAGACTGAGGGAGG - Intergenic
1166080977 19:40444043-40444065 ACTGAGTTCAAGACCCAGGAGGG - Intronic
1166101204 19:40572398-40572420 ACTGAGGTCCACACAGAGGGAGG - Intronic
1166225310 19:41391487-41391509 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
1166234436 19:41445598-41445620 AATGAGGACCAGGCTGGGGATGG - Intergenic
1166354630 19:42219631-42219653 ACTGAGGCCCAGAGAGGGGAAGG - Intronic
1166668169 19:44694088-44694110 AATGAGGTGCAGAGAGAGGAAGG + Intergenic
1166797506 19:45436160-45436182 ACTGAGGCTCAGAGAGAGGATGG - Intronic
1166855548 19:45781232-45781254 ACTGAGGGCCAGACATATGAGGG + Intronic
1166856447 19:45784678-45784700 ACCGAGGCCCAGACAGGGGAAGG - Exonic
1167201463 19:48068265-48068287 ACTGAACTCCAGCCTGATGACGG + Intronic
1167248961 19:48390843-48390865 CCTCAGGTCCAGACTGCGGGAGG - Intronic
1167600426 19:50451530-50451552 ACTGAGGTCCTGAGGGAAGAGGG + Intronic
1167706854 19:51086294-51086316 GCTGAGGTCCGGGCTGGGGACGG - Intergenic
1167711744 19:51115856-51115878 CCTGGGGACCAGACTGAGGAGGG + Intergenic
1168074351 19:53971453-53971475 ACTGGGTTTCAGACTCAGGATGG - Intronic
1168115481 19:54219743-54219765 ACTGAGGCCCAGGCAGGGGAGGG + Intronic
1168121284 19:54253892-54253914 ACTGAGGCCCAGGCAGGGGAAGG + Intronic
1168132824 19:54332050-54332072 ACTGAGGCCCAGGCAGAGGAGGG + Intergenic
925702793 2:6655605-6655627 ACTGAGGCCCAGATAGAGGTTGG + Intergenic
925979299 2:9164191-9164213 CCTGGGGCCCAGCCTGAGGAGGG + Intergenic
926712648 2:15894290-15894312 GCTGAGGTGCAGACTGGGGAGGG - Intergenic
926920084 2:17931630-17931652 TCGGAGTTCCAGAATGAGGATGG + Exonic
927057409 2:19378569-19378591 ACTGATGTCCAGGCTAGGGATGG + Intergenic
927061349 2:19425257-19425279 ACTGTGTTCCAGACAGAAGAAGG - Intergenic
927137551 2:20107922-20107944 ACTGAGCTACAGAATGAGGAGGG - Intergenic
927879628 2:26681459-26681481 ACAGAGGCCCAGAGTGGGGAAGG - Intergenic
928125473 2:28612456-28612478 GCTGAGCCCCAGAGTGAGGAAGG - Intronic
928478453 2:31655444-31655466 ACTGACTTCCAGGCAGAGGATGG + Intergenic
930686333 2:54312472-54312494 ACTGAGGTACAGATGGAGGTAGG - Intergenic
932170001 2:69545959-69545981 ACTGAGCACCAGAAAGAGGAAGG + Intronic
932226347 2:70044079-70044101 TCTGAGAACCAGACTGAGGAAGG - Intergenic
932886694 2:75555130-75555152 ACTGAGCTCCCCACAGAGGATGG - Intronic
932922589 2:75934136-75934158 AATGAGGTTCAGAATGATGATGG - Intergenic
933330429 2:80886370-80886392 GATGAGCTCCAGACTGAGTAGGG + Intergenic
933748619 2:85588769-85588791 AGTGAGGACCAGGCAGAGGATGG - Intronic
933919100 2:87026753-87026775 TCTGAGGTCCAGACTCACCATGG + Intergenic
933987540 2:87604336-87604358 ACTAAGGCCCAGCCTGAGAATGG - Intergenic
934003894 2:87743154-87743176 TCTGAGGTCCAGACTCACCATGG - Intergenic
934613525 2:95757576-95757598 CTTGAGGTTCAGGCTGAGGATGG + Intergenic
934647371 2:96066839-96066861 CTTGAGGTTCAGGCTGAGGATGG - Intergenic
934840743 2:97622659-97622681 CTTGAGGTTCAGGCTGAGGATGG - Intergenic
935896434 2:107742785-107742807 GCTGAGGTGGAGACTGAGGTGGG + Intergenic
936306299 2:111346472-111346494 ACTAAGGCCCAGCCTGAGAATGG + Intergenic
937060103 2:118974645-118974667 TCAGAGGTCCAGACTCTGGAGGG - Intronic
937065034 2:119011453-119011475 ACTGAGGAACAGCCTGGGGAAGG + Intergenic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
937447473 2:121971074-121971096 CCTGAGTGCAAGACTGAGGAAGG - Intergenic
939518819 2:143203732-143203754 ACTGAGCTCCAAAATGAAGAGGG - Intronic
941072593 2:160971150-160971172 ACTGAGGTCCAGAGAGAACAAGG - Intergenic
941860292 2:170272352-170272374 CCAGTGGTCCAGACTGATGAGGG - Intronic
941885831 2:170526178-170526200 ACTGAGGTTCAGAGAGAGGAAGG - Intronic
944587993 2:201189699-201189721 ACTGAAGTTCAAACTGAGGCTGG + Intronic
944863225 2:203835199-203835221 ACTGAGGTCCAGGATGAGGATGG - Intergenic
946065746 2:216985862-216985884 ACTGAGGCCCAGAGTGGGGAAGG + Intergenic
946337301 2:219046617-219046639 GCTGACTTCCACACTGAGGAAGG - Intergenic
947111227 2:226721538-226721560 ACTCAAGTCCAGACTGAGGCTGG + Intergenic
947675785 2:231978648-231978670 AATGGGTTCCAGAGTGAGGATGG - Intronic
948234908 2:236380154-236380176 AGTGAGGCCCAGTCTCAGGAAGG - Intronic
948546168 2:238730351-238730373 TCTGAGGTCCCTACTGAGGAGGG - Intergenic
948740139 2:240041112-240041134 AGGGAGGTCCTGACTGTGGATGG + Intergenic
1168897400 20:1333283-1333305 ACTGAGGTCCAGAAAGGGCAGGG - Intronic
1168955293 20:1830268-1830290 ACTGAGGCCCAGAGAGGGGAAGG - Intergenic
1169155571 20:3327078-3327100 AGAGATGACCAGACTGAGGAAGG + Intronic
1170464048 20:16606807-16606829 TCAGAGATCCAGACTGAGGGAGG + Intergenic
1170799914 20:19582610-19582632 AGTAAGGTCCAGACAGGGGAAGG - Intronic
1170854392 20:20037324-20037346 AGAAAGGTCCAGACTGATGATGG - Exonic
1171296499 20:24021674-24021696 ACTGTGGTGCTGACTGAGGAAGG + Intergenic
1171950980 20:31421752-31421774 ACAGAGGACCAGACAGAAGAAGG + Intergenic
1172183005 20:33015005-33015027 ACGGAGGCCCAGAGTCAGGAAGG + Intronic
1172356038 20:34280733-34280755 ACTGACTTCCAGGCTAAGGAAGG + Exonic
1172484793 20:35291726-35291748 ACTGAGGTCCAGAGAGGGAAGGG - Intronic
1172763756 20:37339854-37339876 CCTGAGTTCCAGATTCAGGAAGG + Intergenic
1172867923 20:38113875-38113897 GCTGAGGTCCAGCATGGGGAAGG + Intronic
1173225884 20:41162269-41162291 ACTGAGGTCCAAAGAAAGGAAGG + Intronic
1173538193 20:43831770-43831792 AGTGAGGTCCAGAATAGGGAAGG - Intergenic
1173721356 20:45260859-45260881 ACTGAGGCCCAGAGAAAGGAAGG - Intergenic
1173956914 20:47040411-47040433 ACTGAGGCTCAGACTGTGGAAGG - Intronic
1174066055 20:47866847-47866869 ACTGAGGTGGAGGCTGAGCAGGG - Intergenic
1175506682 20:59490939-59490961 ACTGAGGTGGAGAATGTGGATGG + Intergenic
1178180805 21:30159231-30159253 AGTGAGGTCTAGATTGAGGTGGG + Intergenic
1178231346 21:30788364-30788386 ACTGTGGTCCACACTCCGGAAGG - Intergenic
1179793206 21:43767660-43767682 ACTGAGGCACAGACTGTGCATGG - Intergenic
1180024565 21:45152556-45152578 ACTGAGGGACAGAATGAGGCTGG + Intronic
1181730614 22:24843618-24843640 ACTGAGGTCCAGAGAGGAGACGG + Intronic
1181754837 22:25016518-25016540 TCTGAGGCCCAGACTAAGGCAGG + Intronic
1182680472 22:32075454-32075476 ACTGAGGTCCAGACAGGGGAAGG + Intronic
1183069678 22:35387333-35387355 ACTGAGGTACAGAGAGATGAAGG - Intronic
1183090642 22:35519673-35519695 ACTGAGGCCCAGCCAGGGGAAGG + Intergenic
1183485562 22:38086110-38086132 ACTGAGGAACAGACTGAGTGAGG + Intronic
1183947191 22:41333105-41333127 ACTGAGGCACAGAGTGGGGAGGG + Intronic
1184230831 22:43157463-43157485 ACTGAGGTCCAGGGAGGGGAGGG + Intronic
1184495337 22:44837881-44837903 ACTGAGGTCCCCAAAGAGGAGGG - Intronic
1184504828 22:44894394-44894416 ACTGAGGTTCGGAGTGGGGAAGG + Intronic
949904585 3:8848347-8848369 GATGGGGTCCTGACTGAGGAAGG - Intronic
950106621 3:10392785-10392807 ACTGAGGTCCAGAGAGGAGAGGG - Intronic
950131475 3:10549871-10549893 ACTGAGGGGCCCACTGAGGAGGG + Intronic
950364841 3:12475512-12475534 ACTGAGGTCTAGAGAGAAGAAGG - Intergenic
950653700 3:14423672-14423694 ACTGAGGCCCAGGCAGAAGATGG - Intronic
950674894 3:14548771-14548793 ACTGAGGTCGAGAGAGGGGAAGG + Intergenic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
952194962 3:31065675-31065697 ACTGAGGTGCAGCCTGGGCATGG + Intergenic
952961820 3:38596856-38596878 ACTGAGGCCCAGAGACAGGAGGG - Intronic
953024452 3:39136840-39136862 ACTGAGGCCCAGACAGGGCAGGG - Intronic
953234155 3:41091572-41091594 ACTGAGGACCAGAGAAAGGAAGG - Intergenic
953866399 3:46586887-46586909 CCTGAGGACCAGATAGAGGAAGG + Intronic
954079732 3:48206671-48206693 ACTGAGGTCCAGAGCCAGGTGGG - Intergenic
954436122 3:50497269-50497291 ACTGAGGCCCAGGGGGAGGAGGG + Intronic
954747494 3:52795387-52795409 ACTGAGGTCCAGAGAGGGGCAGG - Intronic
956758166 3:72410755-72410777 TCTGTGGTTCAGACTGAGAAAGG - Intronic
961183638 3:124895896-124895918 ACTGAGGTCCAGAGGGTGGCAGG - Intronic
961362428 3:126376253-126376275 AGAGAGGTCCAGACCTAGGAAGG - Intergenic
961811663 3:129525463-129525485 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
962237114 3:133716066-133716088 ACTGAGGTGCAGTGTCAGGAGGG - Intergenic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
962825488 3:139096623-139096645 ACTGGGGCCCAGAAAGAGGAAGG - Intronic
964514086 3:157488349-157488371 ACTGAGGTTCAGACACATGAAGG - Intronic
966752999 3:183340462-183340484 TCTGAGGTCCCTACAGAGGAAGG + Intronic
966918516 3:184597769-184597791 ACTGAGGCCCAGGGAGAGGAGGG - Intronic
967263980 3:187673799-187673821 ATTGAGGTCCAGAGTGAGAAAGG - Intergenic
967577103 3:191107153-191107175 AGTGAGGGCCAGACTGATGAGGG + Intergenic
968360193 3:198141371-198141393 ACGGAGGTGCACACTGAGGCAGG - Intergenic
969167593 4:5330117-5330139 ACTGAGGCCCAGAGGGAAGAAGG - Intronic
969482032 4:7451792-7451814 AGTGAGGGCCAGACTGAAGCGGG + Intronic
969703432 4:8780031-8780053 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
969944194 4:10765945-10765967 ACTGAAGTCCCTAATGAGGAAGG - Intergenic
970547942 4:17148708-17148730 ACTGGGGTCCAGCCTGAAAATGG + Intergenic
971745098 4:30569084-30569106 ATAGAGGTCCAGATTGAAGAAGG - Intergenic
974982038 4:68968579-68968601 AATAAGGTCCAGGCTGAGGTGGG + Intergenic
974995628 4:69156009-69156031 AATAAGGTCCAGGCTGAGGTGGG - Intronic
975284938 4:72606477-72606499 AATGAAGTCCAGGCTGAGGGTGG + Intergenic
978247891 4:106597270-106597292 ACTAAGATCCAGGCTTAGGAAGG - Intergenic
978493708 4:109335783-109335805 ACTGAGGCCCAAACTAAGAATGG + Intergenic
981361058 4:143846157-143846179 ACCTGGGTCCAGACTGGGGATGG - Intergenic
981371795 4:143967159-143967181 ACCTGGGTCCAGACTGGGGATGG - Intergenic
981380883 4:144070357-144070379 ACCTGGGTCCAGACTGGGGATGG - Intergenic
981428143 4:144627528-144627550 AATGAAGGCTAGACTGAGGAAGG - Intergenic
985581444 5:697459-697481 ACGGAGGACCAGAGAGAGGATGG + Intergenic
985654262 5:1121814-1121836 ACTGTGCCCCAGACTCAGGAGGG + Intergenic
987109529 5:14672348-14672370 TGGGAGGGCCAGACTGAGGAAGG - Intronic
987560326 5:19511526-19511548 AATGAAGTCCAGGCTGAGGACGG + Intronic
991610255 5:68442390-68442412 ACTGAGCTCCTGGCTGAGGTGGG - Intergenic
991617578 5:68513198-68513220 ACTGAGGTCCAGATGGTGTATGG - Intergenic
992067072 5:73118993-73119015 ACTGAGGTCCAGGCTGACAGAGG - Intergenic
992317154 5:75567812-75567834 ACAGAGGAACAGCCTGAGGAAGG + Intronic
992801524 5:80300263-80300285 AGTCAGGTCCAGACACAGGATGG + Intergenic
993325510 5:86530549-86530571 ACTGAGGTCCAGATAGATGAAGG - Intergenic
993889821 5:93460226-93460248 TCTTAGGTACAGACTCAGGAAGG + Intergenic
994397911 5:99241489-99241511 ACTGATGACCTGACTGATGATGG + Intergenic
995657394 5:114442483-114442505 ACTGAGGTTCAGCCTGGTGAAGG - Intronic
997366246 5:133327032-133327054 ACTGAGGCCCAGGGTGGGGAAGG + Intronic
997835635 5:137190833-137190855 ACTGAGGTCAAGATGGAGCAGGG + Intronic
997885835 5:137629301-137629323 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
998374220 5:141680710-141680732 ACTGAGGCCCAGAGAGGGGAAGG + Intronic
998427283 5:142039620-142039642 ACATAGGGCCAGGCTGAGGATGG - Intergenic
998501236 5:142634733-142634755 TCTGCAGTCCAAACTGAGGAGGG - Intronic
999202781 5:149828053-149828075 ACTGTGGCCCAGAGTGGGGAGGG + Intronic
999245154 5:150150293-150150315 ACTAAGGTCCAGAGAGGGGAAGG - Intronic
999246974 5:150160242-150160264 ACTGAGGCCCAGAGAGTGGAGGG + Intergenic
999710525 5:154314428-154314450 ACTGAGGTCTAGAATGAGGAGGG - Intronic
1000201315 5:159013591-159013613 CCTGAGATCCAGGCTGAGGCTGG + Intronic
1000423675 5:161065333-161065355 ACTGAGGTCAGGAGTGAGGTAGG + Intergenic
1001124863 5:169010350-169010372 ACTATGGCCCAGACTGAGGGTGG + Intronic
1001253754 5:170168124-170168146 ACTGAAGCCCAGAGAGAGGAAGG - Intergenic
1001396944 5:171424471-171424493 ACCGAGGCACAGAATGAGGAAGG + Intronic
1001405910 5:171477456-171477478 ACTGAGGTCCAGAGAAAAGAAGG - Intergenic
1001826126 5:174746474-174746496 ACTGAGGCCCAGATAGGGGAAGG + Intergenic
1001950086 5:175810259-175810281 ACTGAGACCCAGAGTGGGGAGGG + Intronic
1001991596 5:176120932-176120954 ACTCAGGTAGAGGCTGAGGAAGG + Intronic
1003676545 6:8209913-8209935 ACTGAGGTTCAGAGAGATGATGG - Intergenic
1003679224 6:8235597-8235619 CCTGAGGTACAGACAGAGCAGGG + Intergenic
1005898092 6:30195477-30195499 ACTGAGGTCCAGAGAGTGGGAGG - Intronic
1006361027 6:33587158-33587180 ACTGAGGCTCAGAAAGAGGAAGG - Intergenic
1006578333 6:35061892-35061914 TCTGACGGCCAGCCTGAGGAAGG - Intronic
1006599558 6:35216384-35216406 ACTGCGGTCCAGTCACAGGAAGG - Intronic
1006606479 6:35260700-35260722 ACTGAGGTCCAGACTGAGGAGGG - Intronic
1007391656 6:41552927-41552949 ACTGAGGCCCAGAGAGAAGACGG - Intronic
1010048764 6:71478834-71478856 ACTGATGTACAAAGTGAGGAAGG + Intergenic
1011722701 6:90175839-90175861 TCTGAGGGCCAGATAGAGGAGGG - Intronic
1012205628 6:96457337-96457359 ACTCAGGACCAGGCTGAAGATGG + Intergenic
1012224011 6:96685032-96685054 AATAAGGTCCAGACTGAGGTAGG + Intergenic
1013088515 6:106876987-106877009 AGTGAAGTCCAGACTGAGGAGGG - Intergenic
1016051659 6:139536436-139536458 ACTGAGGTCCAGAGGTGGGAAGG - Intergenic
1016873587 6:148842535-148842557 AATGAGGTCCAGCCTGTAGAAGG + Intronic
1017181313 6:151555170-151555192 ACTGAGGTCCAGGCTGGGCACGG - Intronic
1018127681 6:160697315-160697337 TCTGAGGTCCAGACTCACCATGG - Intergenic
1018846573 6:167561027-167561049 ACTGAGGCACAGAGGGAGGAAGG - Intergenic
1018936220 6:168275580-168275602 ACTGAGGGCCAGGCTGAGATGGG - Intergenic
1019259803 7:75260-75282 ACGGAGGTGCACACTGAGGCAGG + Intergenic
1019267383 7:125453-125475 ACTGAGGCCCAGAGGGAGAAGGG + Intergenic
1019887471 7:3918073-3918095 ACTGAGATCCAGTCTAAGAAAGG - Intronic
1020646921 7:10825717-10825739 ACTGAGCTACAGAATTAGGAAGG - Intergenic
1021061503 7:16118234-16118256 TCTGAGGTACAGACTGTGGAAGG + Intronic
1022043339 7:26601939-26601961 ACTGAGGCCCAAACCCAGGAGGG + Intergenic
1027164106 7:75822541-75822563 ACTGAGGTTCAGGCTGGGCATGG + Intronic
1029609070 7:101617025-101617047 ACTGAAGCCCAGAGAGAGGAAGG + Intronic
1030313317 7:108089597-108089619 GCTGAGCTCCAGGCTAAGGATGG - Intronic
1034228712 7:149502175-149502197 AGGGAGGTCCAGGGTGAGGAGGG - Intergenic
1035970216 8:4239493-4239515 TCTGAGGACCAGACTGGGGTGGG - Intronic
1036434583 8:8722031-8722053 ACTGAAGTCCAGAGAGAGGAAGG - Intergenic
1036559083 8:9886188-9886210 ACTGAGCTCCAGGATGAGCATGG - Intergenic
1037705359 8:21312437-21312459 ACTGGGATCCAGTCTGGGGATGG + Intergenic
1038266199 8:26041452-26041474 ACTGAGTTCCAGGTTCAGGAGGG + Intronic
1038416560 8:27400703-27400725 ATTGAGATCCAGACAGAGAAAGG + Intronic
1039411662 8:37360078-37360100 ACTGAGGTCCAGAGAGGGGAAGG - Intergenic
1039861953 8:41466726-41466748 CCTCAGGGCCAGGCTGAGGAGGG + Intergenic
1044634099 8:94305363-94305385 GCTGAAGTCCAGTCTAAGGAAGG - Intergenic
1045009364 8:97944109-97944131 AGGGAGGTCCAGGCGGAGGAGGG + Intronic
1046450422 8:114383331-114383353 ACTGAGGCCCAGAAAGAGGAAGG + Intergenic
1046542635 8:115605894-115605916 ATTGAGGTGCACACTGAGAATGG - Intronic
1047363808 8:124194108-124194130 ACTAAGGTCCAGAGAGATGAAGG + Intergenic
1047511646 8:125520427-125520449 ACTGAGGCCCAGAGAGGGGAAGG + Intergenic
1047520720 8:125593657-125593679 ACTGAGGCCCAGAGAGATGAAGG + Intergenic
1047638680 8:126795054-126795076 ACTGTGGTCCAGAATGTTGATGG - Intergenic
1049313489 8:141946567-141946589 ACTGCACTCCAGCCTGAGGATGG + Intergenic
1049495104 8:142926375-142926397 GCTGAGGTGCAGACTCAGCAGGG - Intergenic
1049552752 8:143267959-143267981 TCTGAGCTCCAGACTGAAGGGGG - Intronic
1049572796 8:143377558-143377580 ACTGAGGCCCAGAGGGAGGGAGG + Intronic
1052088447 9:24296365-24296387 ACTGAGAGCCTGACTGAGAAAGG - Intergenic
1052327287 9:27228833-27228855 AATGAGATTCAGACAGAGGAAGG + Intronic
1052851360 9:33380383-33380405 ACTGAGGCCCAGAGAGTGGAGGG + Intergenic
1052964542 9:34329758-34329780 ACTGAGGTCCTGAGAGCGGATGG - Intronic
1052987244 9:34496637-34496659 ACTCAGTTACAGGCTGAGGAAGG - Intronic
1053267859 9:36728875-36728897 AGTGAGGCCCAGACAGGGGAAGG - Intergenic
1053283920 9:36838558-36838580 ACTGAGGCCCAGCTTGGGGAAGG - Exonic
1053294840 9:36905396-36905418 ACTGAGGTTCAGAGAGGGGAAGG + Intronic
1053307206 9:36993532-36993554 ACTGAGGCCCAGACAGAGAAAGG + Intronic
1053318687 9:37075935-37075957 ACTGTGGTTCACACTGAGGCGGG + Intergenic
1053322879 9:37115987-37116009 ACTGTGGTTCACACTGAGGCGGG + Intergenic
1053416135 9:37947908-37947930 ACTGAGGTCCAGAAAAAGAAGGG - Intronic
1053434720 9:38067512-38067534 ACTGAGGTCCAGAGCAAGGAAGG - Intronic
1053451988 9:38201359-38201381 ACTGAGGCCCAGACACAGGAAGG + Intergenic
1053476610 9:38386450-38386472 ACTGAGGCCCAGAGGGAGGTAGG + Intergenic
1056825677 9:89874838-89874860 ACAAAGGCCCAGCCTGAGGAAGG + Intergenic
1057268884 9:93636109-93636131 ACTCAGGGCCTGAATGAGGAGGG + Intronic
1057802596 9:98199238-98199260 ACTGAGGGCCAGAGAGGGGAAGG + Exonic
1058680032 9:107432577-107432599 ACTGAGGCCCAGAGAGGGGAAGG - Intergenic
1058907348 9:109492406-109492428 CCTGTGGTCCTGGCTGAGGAGGG + Intronic
1059464928 9:114462432-114462454 ACTGAGGCCCAGGGAGAGGAAGG + Intronic
1059672808 9:116507552-116507574 ATTGTGGTCCAGAGGGAGGATGG - Intronic
1059739232 9:117133468-117133490 ACTGAGGCCCAGAGAGTGGAAGG + Intronic
1060497444 9:124129005-124129027 ACTGAGGTCCGGAGAGAGAAAGG + Intergenic
1060737234 9:126073758-126073780 ACTGAGGACCAGAGGGAGAAGGG + Intergenic
1061087659 9:128408780-128408802 ACTGAGGCCCACAGTGGGGAAGG + Intergenic
1061195188 9:129103521-129103543 ACAGAGGCCCAGAGTGGGGAAGG - Intronic
1061390463 9:130314864-130314886 ACTGAGGCCCAGAGTGAGGATGG + Intronic
1061407828 9:130402559-130402581 ACTGAGGTCCAGAGAGTGGAAGG + Intronic
1061422562 9:130480177-130480199 ACTGAGGCCCAGAGAGAGCAGGG - Intronic
1061759657 9:132841660-132841682 ACTGAGGCCCAGATGGAGGAAGG - Intronic
1061871731 9:133524518-133524540 ACTGAGGTCCAGATAGGGGAAGG + Intronic
1062534211 9:137014469-137014491 ACTGGGGTCAAGACCGGGGATGG - Intronic
1185512589 X:674498-674520 GCAGAGGTCAAGACTGAGGCAGG - Intergenic
1186509230 X:10117743-10117765 TGTGGGGTCCAGAGTGAGGATGG + Intronic
1188260343 X:28016148-28016170 TATGAGGTCCAGACAGAGGCTGG + Intergenic
1189193948 X:39136169-39136191 CATGAGGTCCAGCCTGAAGAAGG - Intergenic
1189296259 X:39920409-39920431 ACTGAGACCCAGACAGGGGAGGG + Intergenic
1189607405 X:42694631-42694653 CCTGAGGCCCTGAGTGAGGATGG + Intergenic
1189705550 X:43755780-43755802 CCTGAAACCCAGACTGAGGATGG - Intergenic
1190145743 X:47890201-47890223 ATTGAGGCCCAGCCTGATGATGG - Intronic
1190714895 X:53094713-53094735 ACTGAGGCCCAGGCTGGTGAAGG - Intergenic
1190744138 X:53311240-53311262 ACTGAGGCCCAGAGAGAGAAAGG - Intronic
1191841167 X:65514383-65514405 ACTGAGGCCCAGAAAGGGGAAGG - Intronic
1191842715 X:65524584-65524606 ACTGAGGTCCAGAGAGGGGAAGG - Exonic
1192005602 X:67208750-67208772 AATGAGGTCCAGAAAGAGGAAGG - Intergenic
1192181437 X:68918188-68918210 ACCGAGGTCCAGAGAGGGGAAGG - Intergenic
1192559123 X:72113886-72113908 ACTGAGGGTCAGAAAGAGGAAGG - Intergenic
1194850136 X:98859302-98859324 AATGAAGTCCAGGCTGAGGTGGG + Intergenic
1195431238 X:104791770-104791792 ACTGAGGTTCAGTAAGAGGAAGG - Intronic
1195431276 X:104792137-104792159 ACTGAGGTTCAGAAAGAGGAAGG + Intronic
1195885431 X:109632643-109632665 ACTGAGGTCCAGAGAGGAGAAGG + Intronic
1196711683 X:118769929-118769951 ATAGAGGTCCAGGCTGATGAAGG - Intronic
1197704022 X:129620830-129620852 ACTAAGGTCCAGAGACAGGAAGG - Intergenic
1197705312 X:129630473-129630495 ATTGAGGTACAGAATGGGGAGGG + Intergenic
1198809176 X:140518147-140518169 AGTGAGATCCAGAGAGAGGAAGG - Intergenic
1198958347 X:142156649-142156671 AGGGAGGTCCAGACTGAGAGCGG + Intergenic
1199880767 X:151973081-151973103 ACTGAGGCCCAGATAGAGGAAGG + Intronic
1200330408 X:155290879-155290901 AATGAGGTACAGACTGACGTGGG - Intronic
1200366929 X:155676469-155676491 ACTAAGGTCCAGAGAGGGGAAGG - Intergenic
1200834289 Y:7717921-7717943 ACTGAGGTCCAGAAGAGGGAAGG + Intergenic