ID: 1006609444

View in Genome Browser
Species Human (GRCh38)
Location 6:35285040-35285062
Sequence AGGAAGAAGAGAAATGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3293
Summary {0: 1, 1: 1, 2: 33, 3: 350, 4: 2908}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006609444_1006609453 13 Left 1006609444 6:35285040-35285062 CCTTTCTCATTTCTCTTCTTCCT 0: 1
1: 1
2: 33
3: 350
4: 2908
Right 1006609453 6:35285076-35285098 GACTCACTGGACACAAGGAAGGG 0: 1
1: 0
2: 2
3: 11
4: 199
1006609444_1006609452 12 Left 1006609444 6:35285040-35285062 CCTTTCTCATTTCTCTTCTTCCT 0: 1
1: 1
2: 33
3: 350
4: 2908
Right 1006609452 6:35285075-35285097 AGACTCACTGGACACAAGGAAGG 0: 1
1: 0
2: 0
3: 16
4: 254
1006609444_1006609446 0 Left 1006609444 6:35285040-35285062 CCTTTCTCATTTCTCTTCTTCCT 0: 1
1: 1
2: 33
3: 350
4: 2908
Right 1006609446 6:35285063-35285085 TCCCCCTCTGTCAGACTCACTGG 0: 1
1: 0
2: 0
3: 13
4: 212
1006609444_1006609451 8 Left 1006609444 6:35285040-35285062 CCTTTCTCATTTCTCTTCTTCCT 0: 1
1: 1
2: 33
3: 350
4: 2908
Right 1006609451 6:35285071-35285093 TGTCAGACTCACTGGACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006609444 Original CRISPR AGGAAGAAGAGAAATGAGAA AGG (reversed) Intronic
Too many off-targets to display for this crispr