ID: 1006610698

View in Genome Browser
Species Human (GRCh38)
Location 6:35292652-35292674
Sequence CCGCAGGTGCTGCAGGTGTA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006610698_1006610702 -10 Left 1006610698 6:35292652-35292674 CCCTACACCTGCAGCACCTGCGG 0: 1
1: 0
2: 0
3: 12
4: 174
Right 1006610702 6:35292665-35292687 GCACCTGCGGCAAGACCTACCGG 0: 1
1: 0
2: 0
3: 5
4: 69
1006610698_1006610705 6 Left 1006610698 6:35292652-35292674 CCCTACACCTGCAGCACCTGCGG 0: 1
1: 0
2: 0
3: 12
4: 174
Right 1006610705 6:35292681-35292703 CTACCGGCAGACCTCCACCTTGG 0: 1
1: 0
2: 0
3: 10
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006610698 Original CRISPR CCGCAGGTGCTGCAGGTGTA GGG (reversed) Exonic
900115800 1:1027377-1027399 GGGCTGGTGCTGCAGGTGTGAGG + Intronic
901192359 1:7420190-7420212 GGGCAGGTGCTCCAGGTGGATGG - Intronic
901754768 1:11434860-11434882 TCCCAGGTGCTGCAGGTGAATGG - Intergenic
902306363 1:15542679-15542701 CATCAGGTCCTGCAGGTGAAGGG - Intronic
903504580 1:23824460-23824482 GAGCAGGTGGTGCAGGTGAATGG + Intronic
903813791 1:26049827-26049849 CTTCAGGTGGTGCAGGTGCAGGG - Intergenic
903996368 1:27307555-27307577 CCCCAGGGGCTGCAGCTGGAGGG - Exonic
905344653 1:37302964-37302986 CCGCAGGTTCTACAGGTGCTTGG + Intergenic
905491170 1:38344975-38344997 CAGCCTGTGCTGCAGGTGTTAGG - Intergenic
905580795 1:39081714-39081736 CCGCGGGGGCTGCAGGTGCGAGG - Intronic
905901413 1:41584121-41584143 CCACAGGGGCCGCAGGGGTAGGG + Exonic
906240776 1:44240924-44240946 CCACAGTAGCTGCAGGTGGAAGG + Intronic
911973177 1:104462421-104462443 CTTCAGGTGCTGCAGGTTTCAGG + Intergenic
912996771 1:114538391-114538413 CCGGAGGTGCTGCAGTAGTGGGG - Intergenic
913427378 1:118748958-118748980 CCCCAGTTTCTGCATGTGTATGG - Intergenic
915231170 1:154446327-154446349 CCTCTGGTGCTGCTGGTGTGTGG + Intronic
916892989 1:169131398-169131420 CAGCAGGGGCTGCAGGTATTTGG - Exonic
917975389 1:180234657-180234679 ACGCAGGTGCAGCAGGTGAGGGG + Intronic
918177157 1:182056734-182056756 CCGCAGGTGGGGCAGGGGAAGGG + Exonic
919540465 1:198839190-198839212 GGGAAGGTGCTGCAGGTATAGGG + Intergenic
920032604 1:203046261-203046283 CAGCAGCTCCTGCAGGTGTCGGG - Intronic
920034192 1:203055512-203055534 GCGCAGCTGCTTCAGGTTTAGGG - Exonic
1062925924 10:1315239-1315261 CACCAGGTGCTGCAGGTGACAGG + Intronic
1062987029 10:1778734-1778756 CCACAGGTGCTGCACGCGGATGG - Intergenic
1068676651 10:59776548-59776570 CAGCAGATGATGCAGGTTTAAGG - Intergenic
1076698237 10:132257289-132257311 CCCCAGGGGCTGCAGGTGGGAGG - Intronic
1076809528 10:132879383-132879405 CGGGAGGTGCTGCAGGAGCAGGG + Intronic
1076877640 10:133224344-133224366 CCGCAGGGGCTGCAGCTGAGAGG - Intronic
1077319719 11:1935778-1935800 ACCCAGGTGCAGCAGGTGTGGGG + Intronic
1077382581 11:2251211-2251233 CAGCAGGTGCTGGAGGTGGGGGG - Intergenic
1078091611 11:8267948-8267970 CCACAGATCCTGCAGGTGCAGGG - Intronic
1081622921 11:44629574-44629596 CCGCACGTGCTGAATGTGTCTGG + Intergenic
1083769782 11:64860138-64860160 CAGCAGCTGATGCGGGTGTACGG - Exonic
1084692245 11:70734175-70734197 CAGCAGGTGCGGCAGGGGCAAGG + Intronic
1085457121 11:76671314-76671336 CCGCAGATGATGGAGGAGTACGG - Intergenic
1089320771 11:117625287-117625309 GCGAAGGAGCTGCAGGTGTTAGG - Intronic
1091385929 12:94614-94636 CCCAAGGTGCTGCAGGTCTTGGG + Intronic
1091406351 12:211972-211994 CCCCAGGCGCTGCAGGTGCCAGG - Intronic
1097325215 12:58268887-58268909 CAGCAGGTGTTTCAGGTGTGAGG + Intergenic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1102522431 12:113486920-113486942 CCACAGAGGCAGCAGGTGTAGGG - Intergenic
1103209090 12:119153970-119153992 GGGCAGGTGCTGCAGGGGTGAGG - Intronic
1103559003 12:121782522-121782544 CCGCAGCTGTTGCAGGTGCTGGG + Intronic
1104830502 12:131747622-131747644 CAGGAGGTGCTGCAGCTGGAGGG + Intronic
1104880463 12:132067383-132067405 CAGCAGCTGCTGCATGTGCACGG - Exonic
1106079352 13:26487745-26487767 CCAGAGGTCCTGCAGGTGGAGGG - Intergenic
1107184824 13:37505827-37505849 CTGCAGCTGCTGCAGGGGTTGGG - Intergenic
1107947764 13:45434999-45435021 CCCCAGGTGCTATAGGTTTATGG - Intergenic
1118787133 14:69055225-69055247 CCGCAGGGGCCCCAGGTGGAAGG + Exonic
1122293155 14:100690284-100690306 CAGGAGGTGCTGCAGGTGGGAGG + Intergenic
1123050097 14:105537267-105537289 CCGCAGGTGCTGCAGGGCAGTGG - Intergenic
1124069985 15:26382017-26382039 GCCCAGGTGCTGCGGGTGTGTGG - Intergenic
1124216680 15:27813126-27813148 GGGCAGGTGCTGCAGGTCTCTGG + Intronic
1126163598 15:45635269-45635291 CAGCAAGAGCTGCAGGTGTCCGG - Intronic
1128666611 15:69542817-69542839 CCCCAGCTGATCCAGGTGTAGGG + Intergenic
1130862144 15:87900652-87900674 CTGCTGATGCTGCAGGTGTTAGG - Intronic
1132289309 15:100688387-100688409 CCACAGGTGCTGCTGCTGTGAGG + Intergenic
1133046150 16:3089431-3089453 CCGCAGGTGTCGCAGGCGTGGGG + Exonic
1133051494 16:3119747-3119769 CGGCAGGCGGGGCAGGTGTAGGG - Exonic
1138450970 16:57093140-57093162 CCGCAGCTGCTGAAGGCGTGAGG + Intronic
1139542452 16:67628415-67628437 TCGCAGTGGCTGCAGGCGTAAGG - Exonic
1141702072 16:85647131-85647153 CTGCAGGTGCGGCAGGGGTTTGG - Intronic
1142631518 17:1229247-1229269 CTGCAGGAGCTGCCGGTGGACGG + Intergenic
1142764621 17:2058233-2058255 CCGCAGATGGTGCATGGGTAGGG - Exonic
1145886346 17:28384833-28384855 CCCCAGGAGCAGCAGGTGGATGG + Exonic
1147210166 17:38868641-38868663 CCTCTGGTGCTGCTGGTGTGGGG - Intergenic
1148779607 17:50113937-50113959 CCGCAGCTGCTGCAGCTGGACGG - Exonic
1151426046 17:74031782-74031804 CAGCAGGGGCTACAGGTGCACGG + Intergenic
1151730732 17:75909688-75909710 CCGCAGGTGCTGGAGGGGAGAGG + Exonic
1151746630 17:76015101-76015123 CCGCTGGCGCTGCAGGAGGAGGG + Exonic
1152451917 17:80387013-80387035 CCTCGGGAGCTGCAGGTGTGAGG - Intronic
1152664294 17:81558399-81558421 CTGCAGTTGCTGCAGCTGTGTGG + Exonic
1152713436 17:81886481-81886503 CCGCAGGAGCCGCTGGTGCAGGG + Intergenic
1154139096 18:11807533-11807555 CCGCAGGTGGAGCAGGTTTGGGG + Intronic
1154356283 18:13624997-13625019 CCTCGGGTGCTGCAGGAGAAAGG - Intronic
1154504053 18:15017320-15017342 CTGCAGCTGCTGCTGGTTTAGGG - Intergenic
1160215014 18:76921094-76921116 CAGCAGGTGCTGCAGGGAAAGGG + Intronic
1162564317 19:11436743-11436765 CCGAAGGTGCTGCAGATGGAGGG + Intronic
1166633565 19:44429465-44429487 CCACACTCGCTGCAGGTGTAGGG + Exonic
1166768242 19:45265154-45265176 GGGCAGGTGTTGCATGTGTAGGG + Intronic
1167815087 19:51873247-51873269 CCGCATTTGCTGCATCTGTAGGG + Exonic
1168048265 19:53809659-53809681 GCCCAGGTGCTGCACTTGTATGG - Exonic
1168315462 19:55483054-55483076 CCGCAGATGGGGCAGGTGAAGGG - Exonic
1168344300 19:55642863-55642885 CCGCAGGCGCCGCACGTGAAGGG - Exonic
1168401635 19:56088705-56088727 CCGCAGTCGGGGCAGGTGTAGGG + Exonic
1168405410 19:56107912-56107934 CGGGAGGGGCTGCAGGTGTGTGG + Intronic
1168485645 19:56759927-56759949 GCCCAGGTGCAGCAGGTGCAGGG + Intergenic
1168689416 19:58367891-58367913 CCGCAGTCGCGGCAGATGTAGGG + Exonic
925571181 2:5314242-5314264 CCGCAAGTACTGAAGGTGTTGGG + Intergenic
928198064 2:29229050-29229072 CCGCAGGTGGTGGAGGTGGCTGG - Exonic
928436901 2:31260686-31260708 CAGCAGCTGATGCGGGTGTACGG + Exonic
931650526 2:64464349-64464371 CAGCAGGTCATGCAGGAGTAAGG + Intergenic
935695069 2:105764196-105764218 CAGCAGGTGCTGCAGGGTCAAGG - Intronic
938503240 2:131847511-131847533 CTGCAGCTGCTGCTGGTTTAGGG - Intergenic
939247629 2:139645727-139645749 GGGCAGGTGCTGCAGATGTCTGG + Intergenic
939389925 2:141554813-141554835 ATGCAGGTGCTGCAGGTCTGTGG - Intronic
943832364 2:192478838-192478860 CTGCAGGTTTTCCAGGTGTAGGG - Intergenic
946419573 2:219557420-219557442 AGGCAGGTGCTGCGGGTGCAGGG - Exonic
948455719 2:238103777-238103799 CCTCAGGCTCTGCAGGTGCAGGG + Intronic
948806950 2:240457120-240457142 CCGCAGGGGCTGCAGGTCCAGGG - Intronic
1170986761 20:21266090-21266112 CTGCATGTGCTGCAGATGAAGGG - Intergenic
1171255838 20:23688510-23688532 CAGCAGCTGCTGCAGGTTAAAGG + Intronic
1173690880 20:44960206-44960228 CTGCGGGTGCTGCAGGCGCAAGG - Exonic
1173897830 20:46564054-46564076 CCCCCGGTGCTGCTGGTCTAAGG + Intronic
1174173989 20:48633644-48633666 CCCCAGGTGCTGCTGGTCCAGGG + Intronic
1174268191 20:49347266-49347288 ACTCTGGTGCTGCAGGTGGAGGG - Intergenic
1174439174 20:50535305-50535327 GAGCATGCGCTGCAGGTGTACGG - Intronic
1175176985 20:57118085-57118107 TGGGAGGTGCTGCAGGTGTAGGG - Intergenic
1175767732 20:61602919-61602941 CCTCAGGTGCTGCATCTCTAAGG - Intronic
1177993177 21:28062616-28062638 CTGCAGCTGCTGCTGGTTTAGGG + Intergenic
1180184978 21:46135023-46135045 CCGCGGGTCCCGCAGGTGGAGGG + Intergenic
1181079757 22:20406024-20406046 TCGCAGGCGCTGCACTTGTAGGG - Exonic
1181284011 22:21739282-21739304 CCGGAGGTGCAGCAGGCGGAGGG - Intergenic
1183596817 22:38817896-38817918 GGGCAGGTGCTGCAGGGGTGGGG + Intergenic
1183662528 22:39230030-39230052 CCCCAGCTGCTGCAGGGGAAGGG + Intronic
1184287855 22:43482018-43482040 CCTCAGGTGCAGCCGGTGTTGGG + Intronic
1184916036 22:47569675-47569697 ACGCAGGTGCTGAGGGTGTGTGG - Intergenic
1185191219 22:49437812-49437834 CCGCACCTGCTGCAGGTGTGGGG - Intronic
950741577 3:15056516-15056538 GGTCAGGTGCTGCAGTTGTAAGG - Intronic
952243695 3:31562304-31562326 CTGCAGGTGATGCATGAGTATGG + Intronic
952990036 3:38823908-38823930 CCACAGGGGCTGCAGCTGCAGGG - Intergenic
953406623 3:42663029-42663051 CCGCAGGTCTCGCAGGTGAAGGG - Exonic
955363649 3:58293583-58293605 CAGCAGGTGCTGGATGTGTCTGG + Exonic
959829358 3:110842016-110842038 CCGCAGCTACTCCATGTGTAGGG + Intergenic
961386859 3:126527624-126527646 CAGCAGGTGGTGGAGGCGTAGGG + Intronic
969849977 4:9948430-9948452 CTGCAGGTGACGCAGGTGTGGGG - Intronic
973888466 4:55346422-55346444 CGGCAGGAGCTGCAGCAGTAGGG - Exonic
976116417 4:81733109-81733131 CAGCAGGTCCTGCAGGTGAGAGG + Intronic
980399732 4:132266473-132266495 TCGCAGGTGTTGAAGCTGTATGG + Intergenic
984620320 4:181944829-181944851 ACACAGGTGCTGCAGGGGTGTGG - Intergenic
984732222 4:183078719-183078741 CTGCAGGTACTGCAGGGGTCGGG - Intergenic
985592713 5:773826-773848 GGGGAGGTGCTGCAGGTGTGTGG - Intergenic
985711281 5:1431342-1431364 AAGCAGGTGCTGCAGGTGGATGG + Intronic
992701154 5:79343110-79343132 CCCCAGGTGCTGCAGGGCTGAGG - Intergenic
997195322 5:131975380-131975402 GGGCAGGTCCTGCAGGTGTGGGG - Intronic
1004494240 6:16148671-16148693 CAGCTGGTGCTGCTGGTGTGTGG + Intergenic
1005072177 6:21872005-21872027 CCTCAGGTGTTGGTGGTGTAGGG + Intergenic
1006610698 6:35292652-35292674 CCGCAGGTGCTGCAGGTGTAGGG - Exonic
1007224454 6:40303086-40303108 CTGCAGGTGCTGCAAGTGGGCGG - Intergenic
1012387002 6:98693646-98693668 CCGCAGGTTTTGGAGGAGTATGG + Intergenic
1013333652 6:109133225-109133247 CCACAGATGCGGCAGGGGTAAGG + Intronic
1017233215 6:152094502-152094524 CCGCTGGTGCTGCTGCTGCAGGG - Exonic
1017827894 6:158095901-158095923 CTGCAGGACCTGCAGGTGGAAGG - Exonic
1018816968 6:167340379-167340401 CCTCATGTGCTTCAGGTGTTTGG - Exonic
1018903311 6:168061880-168061902 CAGCAGGTGCAGCAGGTGCCTGG + Exonic
1019612258 7:1942456-1942478 CAGCAGGTGCTGGAAGTGCAGGG + Intronic
1019715659 7:2538180-2538202 CCGCAGGCCCTCCAGGTCTAGGG + Exonic
1020281934 7:6654336-6654358 CCGCAGTTGGCGCAGGCGTAGGG - Exonic
1024279916 7:47710371-47710393 CTGCTGGTGCTGCAGGAGTTGGG - Intronic
1029375005 7:100171909-100171931 CCGCAGGTGTTTCAGGAGTGCGG - Exonic
1029449510 7:100633070-100633092 CCGCAGGTCCTGCAGGTCTTCGG + Exonic
1029548491 7:101223772-101223794 CCGCAGCTGACACAGGTGTAGGG - Exonic
1030628643 7:111871197-111871219 CCACAGGTGCTTAAGGTATAAGG + Intronic
1031483221 7:122302208-122302230 CCGCACGTGGGGCAGGTGAAAGG + Exonic
1034171367 7:149065675-149065697 TCGCAGGATCTGCAGGTGTTGGG - Intergenic
1034224888 7:149474604-149474626 CCGCAGACGGTGCAGGTGAAGGG + Exonic
1035299038 7:157885292-157885314 AGGAACGTGCTGCAGGTGTAAGG - Intronic
1037547571 8:19939550-19939572 CCGCCGGGTCTGCAGGTGGAGGG - Intronic
1039433161 8:37541546-37541568 CCGCAGGTGCAGAAGATGTTTGG - Intergenic
1042761557 8:72276711-72276733 CTGCAGGTTTTCCAGGTGTATGG - Intergenic
1043361253 8:79475141-79475163 CAGTAGGTGCAGCAGTTGTAGGG - Intergenic
1044688662 8:94854707-94854729 TCACAGGTGCTGCTGGTGTGGGG - Intronic
1049323770 8:142011143-142011165 CCCCAGGGGTTGCAGGTGTTGGG + Intergenic
1049554803 8:143276553-143276575 CCGCACTGGCTGCAGGCGTAGGG - Exonic
1049958065 9:711536-711558 GCGGATGTGCTGCAGGTGCATGG - Exonic
1051192968 9:14534240-14534262 CCTCAGGTGCTCTAGGTGGAAGG + Intergenic
1057181805 9:93034649-93034671 CCCCAGGTGCTGCACCTGCAGGG + Exonic
1057208749 9:93188170-93188192 CTGCAGGTGCTGCGGGAGTAGGG - Intronic
1059396334 9:114036302-114036324 CCACAGGCGCCGCAGGTGTAGGG - Exonic
1061015055 9:127976757-127976779 CGGCAGGTGCTGTAGGGGTGGGG + Intronic
1061845606 9:133386479-133386501 GCACAGGGGCTGCAGGAGTAAGG - Intronic
1061943192 9:133893953-133893975 CCTCAGTTTCTGCAGATGTAAGG - Intronic
1062177281 9:135170779-135170801 CGGCAGGAGCTGGAGGTGTGAGG - Intergenic
1062432306 9:136531648-136531670 CCGCGGGTGCTGTGGGTGAAGGG - Intronic
1062580353 9:137226703-137226725 CAGCAGGTGCTGCAGGTTTCAGG + Intergenic
1185647026 X:1623209-1623231 CGGCAGTGGCTGCAGGTGTGAGG + Exonic
1187480113 X:19647783-19647805 TCTCAGGTGCTGCTGGTGCAGGG - Intronic
1189256764 X:39645803-39645825 TCGCTGGTGCTGCACGTGAAAGG + Intergenic
1189371653 X:40433857-40433879 TCGCAGGTGCTACTGGTGTTCGG + Intergenic
1189918879 X:45884022-45884044 CAGCAGCAGCTGCAGGTGAAGGG + Intergenic
1194486368 X:94491930-94491952 CCGCAGCTGGTGCATGTGTGAGG + Intergenic
1197962499 X:132022630-132022652 CCACAAGTTCTGCACGTGTAAGG - Intergenic
1200182637 X:154160042-154160064 CTGCTGCGGCTGCAGGTGTAGGG - Intergenic
1200188291 X:154197156-154197178 CTGCTGCGGCTGCAGGTGTAGGG - Intergenic
1200193941 X:154234296-154234318 CTGCTGCGGCTGCAGGTGTAGGG - Intergenic
1200199696 X:154272100-154272122 CTGCTGCGGCTGCAGGTGTAGGG - Intronic
1202095972 Y:21248536-21248558 CTGCAGCTGCTGCAGCTGTAGGG + Intergenic