ID: 1006612261

View in Genome Browser
Species Human (GRCh38)
Location 6:35301222-35301244
Sequence CAGCCAGCAGGTTTTTGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006612261_1006612271 29 Left 1006612261 6:35301222-35301244 CCAGTCCAAAAACCTGCTGGCTG 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1006612271 6:35301274-35301296 TGTGTGCTACTGGTCTCCCCAGG No data
1006612261_1006612266 19 Left 1006612261 6:35301222-35301244 CCAGTCCAAAAACCTGCTGGCTG 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1006612266 6:35301264-35301286 TCCTGACCCCTGTGTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006612261 Original CRISPR CAGCCAGCAGGTTTTTGGAC TGG (reversed) Intronic
901073669 1:6538367-6538389 CAGCCTGCATGTTTTTGAATTGG - Intronic
903314397 1:22490089-22490111 TATCCAGCAGGGTTTTGAACAGG - Exonic
903348185 1:22701198-22701220 AAGTCAGCAGGGCTTTGGACTGG + Intergenic
907183386 1:52590240-52590262 CAGCCAGGAGGTTTTGGAATAGG + Intergenic
909444847 1:75737650-75737672 CAGCCAGATGGTCTTTTGACAGG - Intronic
909459746 1:75896208-75896230 CAGCTTGCAGGCATTTGGACTGG + Intronic
912185919 1:107275563-107275585 GAGCCTGCTGGTCTTTGGACTGG - Intronic
915389466 1:155528499-155528521 CACCCTGCAGATTTTGGGACTGG - Intronic
919836910 1:201581192-201581214 CAGCGAGCAGGTTTTTGTTACGG + Intergenic
920498480 1:206471605-206471627 CAGCCAGCAGGTCTGGGGGCTGG - Intronic
920545343 1:206811890-206811912 CTGCCAGAAGATTTTTGGACAGG - Intronic
922423878 1:225476525-225476547 GAGCCTGCTGGTTTTTGGACTGG + Intergenic
922685807 1:227638083-227638105 CAGCCCCCACCTTTTTGGACAGG - Intronic
1066057847 10:31698121-31698143 CAGCCAGCAAGTGTCTGCACAGG - Intergenic
1066220500 10:33333958-33333980 CAGCCATCAGATTTTTGAAAGGG + Intronic
1070333766 10:75436762-75436784 CAGTCAGCAGCTTCTTGGCCAGG - Intronic
1071722520 10:88161882-88161904 CAGGCAGCAGATTATTGGGCAGG + Intergenic
1071951938 10:90713172-90713194 CAGCCAGCAGGTGGTTGGGCAGG + Intergenic
1072035478 10:91559316-91559338 AAGCCTGCTGGCTTTTGGACTGG + Intergenic
1072782591 10:98260671-98260693 CATCCAGCAGGTGTTGGGATTGG - Intronic
1073072327 10:100802590-100802612 CTGGCAGAAGGTTTTGGGACTGG - Intronic
1073925752 10:108513325-108513347 CAGCCAGCATTTATTTAGACTGG - Intergenic
1075687881 10:124376733-124376755 ATTCCTGCAGGTTTTTGGACAGG + Intergenic
1075834003 10:125437492-125437514 GAGTCAGCAGGTTTCTGGATTGG - Intergenic
1076620489 10:131784338-131784360 GAGCCTGCTGGATTTTGGACTGG - Intergenic
1077585263 11:3446638-3446660 AAGCCAACAGGTTTTGGGGCTGG + Intergenic
1078564623 11:12403797-12403819 CAGCCAGCTGGTTTTGGGGTTGG + Intronic
1080273625 11:30478148-30478170 AAGCAAGTAGGTTTTTGGAGGGG - Intronic
1081710894 11:45214612-45214634 AAGCCATCAGGCTGTTGGACAGG - Intronic
1083582673 11:63835125-63835147 CAGCCAACAGGCTTTCGGATGGG - Intergenic
1084242167 11:67829201-67829223 AAGCCAACAGGTTTTGGGGCTGG + Intergenic
1084948977 11:72654371-72654393 CAGCCAGCAGGTGCCTGAACTGG + Intronic
1088361075 11:108990587-108990609 GAGCCTGCTGGCTTTTGGACTGG + Intergenic
1088799948 11:113296557-113296579 CAGCCAGCAGAATTTGGGAGGGG + Intergenic
1089735645 11:120548652-120548674 CAGCTGGGAGGATTTTGGACAGG + Intronic
1091250500 11:134140278-134140300 CACCCAGCTGATTTTTGTACGGG + Intronic
1091693041 12:2610094-2610116 CAGCCTGCTGGATTTAGGACAGG + Intronic
1092412417 12:8263900-8263922 AAGCCAACAGGTTTTGGGGCTGG + Intergenic
1094172545 12:27508910-27508932 CAGCCAGAAGCTATTGGGACAGG - Intergenic
1096801999 12:54116599-54116621 CAGCCAGCAGGTGGTAGAACAGG - Intergenic
1097460737 12:59858711-59858733 CAGCCAGCTGCTGTTTGGACAGG + Intergenic
1099644728 12:85338031-85338053 CAGCCAGCAGCATTTGTGACGGG - Intergenic
1099861691 12:88230863-88230885 CAGCCCCCACCTTTTTGGACAGG + Intergenic
1100442408 12:94628991-94629013 CAACCAGCAGGTTTTTATAGTGG - Intronic
1101823149 12:108199502-108199524 CAGCCAGCAGGTTGCAGAACTGG - Intronic
1102141909 12:110622256-110622278 GAGCCTCCAGGTTTTTGGCCTGG - Intronic
1103928367 12:124436061-124436083 CAGCCTGCAGGTCTGAGGACAGG + Intronic
1111108578 13:83676697-83676719 CAGGCAGAAAGTTTTTTGACAGG - Intergenic
1111719710 13:91926597-91926619 AAGCCGGCATGTTTTTGCACAGG - Intronic
1113684793 13:112275423-112275445 CAGCCTGCTGGCCTTTGGACTGG + Intergenic
1116045083 14:39733742-39733764 CAGCCCTCACTTTTTTGGACAGG + Intergenic
1117062106 14:51973629-51973651 CAGCCAGCAGCCCTTTGGCCTGG + Intronic
1117548590 14:56812185-56812207 CAGCCAGCGGGTCTCCGGACTGG - Intergenic
1118256862 14:64212945-64212967 CTGCCAGGAGGTGTTTGGAAGGG + Exonic
1118350619 14:64971003-64971025 CAGCCAGCAGGTGTTTCCAGGGG + Intronic
1118942083 14:70347516-70347538 CAGCCCCCATCTTTTTGGACAGG + Intronic
1126106166 15:45148299-45148321 CAGCCAGCTGGGCCTTGGACAGG - Exonic
1126904652 15:53351335-53351357 CAGACAGAAGGTTTTAGGATAGG - Intergenic
1127023202 15:54774498-54774520 CACCCATGGGGTTTTTGGACAGG + Intergenic
1127125071 15:55803686-55803708 CAGCCAGCAGGTGATTGAGCAGG - Intergenic
1129234700 15:74217185-74217207 CAGCCTGCAGGCTTTCAGACTGG + Intergenic
1131180139 15:90233843-90233865 CGGCCAGCAGCTCCTTGGACAGG + Exonic
1131423148 15:92324330-92324352 GAGCCAGCATCTTTTTGGCCAGG + Intergenic
1132725926 16:1338352-1338374 CACCCAGCAGGTGTGGGGACAGG + Intronic
1133353681 16:5120135-5120157 AAGCCAACAGGTTTTGGGGCTGG + Intergenic
1133956214 16:10446259-10446281 AACCCAGCAGGTTTCTTGACTGG - Intronic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1137578521 16:49619951-49619973 CAGCCTGCAGCATTTTGGAGGGG - Intronic
1141740393 16:85887852-85887874 GAGCCACCAGGTTTTTTGATTGG - Intergenic
1143287343 17:5800173-5800195 CAGACAGCAGCTCTGTGGACTGG - Intronic
1145743205 17:27293615-27293637 GAGCCAGCAGGTTTTAGGAAGGG - Intergenic
1146380963 17:32327156-32327178 CAGCCCTCAGGTATTTGCACAGG + Intronic
1146694656 17:34899263-34899285 AAGCCTGCAGGTCTTTAGACAGG + Intergenic
1148213376 17:45821236-45821258 CAGCCAGCAGGTGCCTGTACTGG + Intronic
1151266162 17:72957019-72957041 CAGCCAGCAGGCAGTTGGCCAGG + Intronic
1155102996 18:22632279-22632301 AAGCCAGCAGGATTTTGCATGGG + Intergenic
1155166639 18:23237402-23237424 TGGCCAGCAGGATTCTGGACAGG - Intronic
1158105848 18:53884275-53884297 CAGCTAGCAGGTTGTGGGAAAGG + Intergenic
1160969778 19:1762434-1762456 CCCCCAGCAGGTCCTTGGACGGG - Intronic
1165622353 19:37258823-37258845 AAGCCAGCTAGTTTTTGTACTGG + Intergenic
1167391495 19:49197982-49198004 CAGTCACCAGGTTGTTGGCCAGG - Intronic
1167535102 19:50045031-50045053 CAGCCAGCAGGATTCTGTTCAGG + Exonic
1167754815 19:51405811-51405833 CTGCCAGCTGGCTGTTGGACAGG + Intergenic
925030819 2:648881-648903 CAGCCAGCAGGTATTTGCATGGG + Intergenic
927506516 2:23618576-23618598 AAGCCTGCAGGCTTTTGGACTGG + Intronic
931173427 2:59829179-59829201 CATCCAGCAGGGTTTAGGCCAGG + Intergenic
931241821 2:60461042-60461064 CCAGCAGCAGCTTTTTGGACAGG + Exonic
933749776 2:85595879-85595901 CAACCAGCAGGTTTCTGGGCTGG + Intronic
933934392 2:87189405-87189427 CAGCCATCCTGTTTTTGTACTGG + Intergenic
934141007 2:89047302-89047324 CAGCAAGAAGGTTTGTGCACGGG - Intergenic
934228227 2:90153240-90153262 CAGCAAGAAGGTTTGTGCACGGG + Intergenic
935609062 2:105001672-105001694 GAGTCAGCAGGTGTGTGGACAGG - Intergenic
936358750 2:111776490-111776512 CAGCCATCCTGTTTTTGTACTGG - Intronic
936482164 2:112893834-112893856 CAGCCAGTAGGATTTGGGAGTGG - Intergenic
936558655 2:113517685-113517707 CAGGCTGCAGGTTTTTGGTTTGG + Intergenic
938178448 2:129157992-129158014 CAGTCAGCAGGCTTTGAGACAGG - Intergenic
938755282 2:134373646-134373668 CAGACAGCAGGTTGCTGGGCTGG + Intronic
939496566 2:142933795-142933817 CAGCCCCCATCTTTTTGGACAGG - Intronic
941793003 2:169573606-169573628 CACCCAGCACGTTTTCGGGCTGG - Intronic
948471014 2:238179155-238179177 CAGCCAGCAGGAGTTTCCACTGG + Intronic
948935734 2:241163209-241163231 CAGCCAGCAGGTGCCTGGACCGG - Intronic
1168734326 20:116776-116798 CTACCAGCAGGTTTTTTGATGGG - Intergenic
1171255482 20:23686449-23686471 GAACCAGCAGGTTCTTGGAGAGG + Intronic
1171853747 20:30326399-30326421 CAGCCAGCAGGTGGTAGAACAGG - Intergenic
1176514742 21:7775443-7775465 CAGCCCTCAGGTTTTTGGCCTGG + Intergenic
1177450387 21:21258522-21258544 CAGTCAGCAGGTTGTTGCAGGGG - Intronic
1178300887 21:31451929-31451951 CAGCCACCAGATTTTTAGTCTGG - Intronic
1178648855 21:34405967-34405989 CAGCCCTCAGGTTTTTGGCCTGG + Intronic
1180559512 22:16603306-16603328 AAGCCAGCACGTTTATGGATAGG + Intergenic
1180852193 22:19027231-19027253 CTGCCTGGAGGTTTATGGACAGG - Intergenic
1181151763 22:20888860-20888882 CTGCCACCTGGTTTTAGGACTGG + Exonic
1182010342 22:26995428-26995450 AAGCCAGCATTTATTTGGACTGG - Intergenic
1183178758 22:36244471-36244493 CAGCCAGCAGAATTTGGGAGGGG - Intergenic
1185346270 22:50312156-50312178 CAGCCTGCAGGTCTTTGGGCAGG + Exonic
949796278 3:7854820-7854842 CAGCCAGCGGATTTGTGGAGGGG + Intergenic
954163558 3:48739017-48739039 CAGCCAGCGGGTTTAAGGAATGG - Intronic
954183358 3:48898746-48898768 CGGCCAGCAGGTTCTTGAGCGGG + Exonic
957057632 3:75456128-75456150 AAGCCGACAGGTTTTGGGACTGG + Intergenic
958790474 3:98645431-98645453 CAGCCAGCAGAATTTGGGAGGGG - Intergenic
961889978 3:130122560-130122582 AAGCCAACAGGTTTTGGGGCTGG + Intergenic
962628387 3:137250082-137250104 CTCCCAGCAGGTTTCTGCACAGG - Intergenic
965254831 3:166393162-166393184 AAGACAGCAGGTATTTGGATTGG + Intergenic
966706976 3:182926842-182926864 AAGCCAGCTGGTTTTTTGATAGG - Intergenic
967971625 3:195003720-195003742 CACCCAGCAGCTTGTTGGAATGG + Intergenic
969753561 4:9132127-9132149 AAGCCAACAGGTTTTGGGGCTGG - Intergenic
969974385 4:11083000-11083022 CTGCAAGGAGGTTTTTTGACAGG + Intergenic
970793979 4:19890699-19890721 CAGCCCCCACCTTTTTGGACAGG + Intergenic
972791463 4:42375254-42375276 CAGGCAGCAGGTGGTTGGTCAGG - Intergenic
974950561 4:68579760-68579782 CAGCCCCCACCTTTTTGGACAGG + Intronic
974958950 4:68675279-68675301 CAGCCCCCACCTTTTTGGACAGG + Intergenic
976704172 4:88004674-88004696 CTGCCAGCAGATTTGTGGTCTGG - Intergenic
978568856 4:110114459-110114481 CAGCCAGGAAGTTTTTAGCCAGG - Intronic
980279283 4:130698537-130698559 CAGCAAGAATGTTTTTGGAAGGG - Intergenic
980987132 4:139706335-139706357 CAGCCAGCAAGTGATAGGACAGG - Intronic
981168219 4:141588496-141588518 CTCCCAGCAGGTCTATGGACAGG + Intergenic
984745990 4:183218635-183218657 CAGGCTGCTGGTCTTTGGACTGG - Intronic
986460815 5:7970152-7970174 CAGGCAGCAGGTTATAGGAAAGG + Intergenic
986553272 5:8982555-8982577 CTGCCAGCAGTTTTCAGGACAGG + Intergenic
988675835 5:33432068-33432090 GAGCCTGCTGGCTTTTGGACTGG + Intergenic
989157335 5:38356631-38356653 CAGCCAGCAGGGCTCTGGGCAGG - Intronic
990185267 5:53204194-53204216 CAGCCCCCACTTTTTTGGACAGG + Intergenic
994436940 5:99748465-99748487 CAGCCAGCATTTTTCTGGGCTGG + Intergenic
998639906 5:143997613-143997635 CAGCCAGAAGGTCTTTGTATTGG - Intergenic
999367490 5:151032714-151032736 CAGCCAGGAGGTTTCTGTAATGG + Intronic
1001049584 5:168403730-168403752 CAGGCAGGAGGTGTCTGGACAGG + Intronic
1001638796 5:173231135-173231157 CAGTCAGCAGGTGCTGGGACCGG - Intergenic
1001754414 5:174157340-174157362 GAGCCAGCAGGTCCTTGGACAGG + Intronic
1002098528 5:176846022-176846044 CATTCAGCAGGTTTCTGGCCAGG + Intronic
1002484496 5:179524833-179524855 CACCCACCAGGTGTGTGGACAGG - Intergenic
1002500083 5:179642655-179642677 CACCCACCAGGTGTGTGGACAGG + Intronic
1002501888 5:179652106-179652128 CACCCACCAGGTGTGTGGACAGG - Intergenic
1002805086 6:566341-566363 CAGCCAGCAGGATGTTGCAGTGG + Intronic
1003679384 6:8236980-8237002 CAGCCAGCCAGTTTCTGGACAGG + Intergenic
1006612261 6:35301222-35301244 CAGCCAGCAGGTTTTTGGACTGG - Intronic
1006918416 6:37611420-37611442 CAGCCAACATGTTTTGGAACAGG - Intergenic
1007832422 6:44648609-44648631 AAGCCTGCTGGCTTTTGGACTGG + Intergenic
1010863085 6:80937672-80937694 CAGCCAGGAGGTTGGTGGCCTGG - Intergenic
1014403782 6:121023505-121023527 AAGACAGAAGGTTTTTGAACTGG + Intergenic
1016355745 6:143216347-143216369 CAGTCATCAGGTATATGGACAGG + Intronic
1016914261 6:149230110-149230132 CATCCAGTAGGTATTTGGCCTGG - Intronic
1017173012 6:151475662-151475684 GTGCCAGCAGGTTTGTGGACTGG + Intergenic
1019017582 6:168890980-168891002 CAGCCAGCAACTTCTGGGACAGG - Intergenic
1019107696 6:169682317-169682339 CACCCAGCAGGTCTCTGCACAGG - Intronic
1019280646 7:198146-198168 CAGCCAGCCTGTCCTTGGACGGG - Intronic
1022003435 7:26246481-26246503 CAGCCCCCAACTTTTTGGACAGG + Intergenic
1026455532 7:70569215-70569237 CAGCCAGCACGTTATGGGAAAGG + Intronic
1026582397 7:71629276-71629298 CAGCCCGCAGGATTGTGGGCTGG - Intronic
1028018285 7:85741736-85741758 AACCCAGCAGGTTTCTTGACAGG - Intergenic
1030107020 7:105996057-105996079 CAGCCAGCGGGTTTGGAGACGGG + Intronic
1030241309 7:107329003-107329025 GAGCCTGCAGGCCTTTGGACTGG + Intronic
1030688458 7:112509413-112509435 CAGACAGCATGGTTTTGGAGAGG - Intergenic
1031026978 7:116690080-116690102 CAGTCACCAGGTATTTGGAGTGG + Intronic
1032422952 7:131797863-131797885 CATCCACTAGGTTTATGGACAGG + Intergenic
1032460584 7:132107147-132107169 AAGCCTGCTGGCTTTTGGACTGG + Intergenic
1034617724 7:152434515-152434537 AAGCCAGCACGTTTATGGATAGG - Intronic
1035518199 8:254771-254793 CAACCTGCAGGTTTTTACACAGG - Intergenic
1036787163 8:11695666-11695688 CAGCCATCAGGTTGTTGAAAGGG + Intronic
1037099280 8:15023287-15023309 CAGCCTGCTGGTTTGTGGCCAGG + Intronic
1038507221 8:28094792-28094814 CAGCCAGTAGGCATTGGGACTGG + Intronic
1041153495 8:54960462-54960484 CAGACAGCAGGTTTCTGGGATGG + Intergenic
1042009576 8:64226491-64226513 CATACAGCAGGTTTCTAGACTGG + Intergenic
1047582699 8:126233792-126233814 TAGCCAGCAGGTCTTTGAAATGG - Intergenic
1047619371 8:126590699-126590721 CAGACAGCAGGTCTTGGGATAGG + Intergenic
1048294896 8:133206843-133206865 CTGCCAGGGGGTTCTTGGACAGG + Intronic
1049353063 8:142174547-142174569 CAGCAGGAAGGTTTTTGGTCTGG - Intergenic
1053791545 9:41689692-41689714 CAGCCAGCAGGTGGTAGAACAGG - Intergenic
1054153612 9:61625079-61625101 CAGCCAGCAGGTGGTAGAACAGG + Intergenic
1054473394 9:65556207-65556229 CAGCCAGCAGGTGGTAGAACAGG + Intergenic
1054858873 9:69929504-69929526 AACCCAGCAGGTTTCTTGACAGG - Intergenic
1057128019 9:92634354-92634376 CACACAGCAAGTTTTTGGATGGG + Intronic
1062011141 9:134267501-134267523 GAGCCAGCAGGTGTGTGGGCCGG + Intergenic
1188742400 X:33801353-33801375 CAGCCAGCAGGATTAGGGAGGGG - Intergenic
1192946044 X:75966469-75966491 CAGCCCTCACCTTTTTGGACAGG - Intergenic
1195231231 X:102850751-102850773 TAGCCAGCAAGCTTTTGGCCTGG - Intergenic
1196114159 X:111981205-111981227 AAGCCTGCTGGTTTTTGAACTGG - Intronic
1196195287 X:112832853-112832875 CATCCAGCAGGTGTATGGACAGG + Intronic
1199008787 X:142733667-142733689 GAGCCTGCTGGCTTTTGGACTGG + Intergenic
1200296685 X:154926711-154926733 CAATCAGCAGGTTTTGGGAAGGG + Intronic
1200673136 Y:6119535-6119557 CAGACAGCATGTCTTTGGAGAGG + Intergenic
1201454739 Y:14157732-14157754 CAGCTAAAAGGTGTTTGGACAGG - Intergenic