ID: 1006620311

View in Genome Browser
Species Human (GRCh38)
Location 6:35359349-35359371
Sequence CTGGTAGTCCCTAAGTATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1006620311_1006620317 16 Left 1006620311 6:35359349-35359371 CCATCATACTTAGGGACTACCAG 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1006620317 6:35359388-35359410 CTTAAAAATATTAGAAGAGGGGG 0: 1
1: 0
2: 2
3: 60
4: 528
1006620311_1006620316 15 Left 1006620311 6:35359349-35359371 CCATCATACTTAGGGACTACCAG 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1006620316 6:35359387-35359409 ACTTAAAAATATTAGAAGAGGGG No data
1006620311_1006620315 14 Left 1006620311 6:35359349-35359371 CCATCATACTTAGGGACTACCAG 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1006620315 6:35359386-35359408 CACTTAAAAATATTAGAAGAGGG 0: 1
1: 0
2: 1
3: 59
4: 627
1006620311_1006620314 13 Left 1006620311 6:35359349-35359371 CCATCATACTTAGGGACTACCAG 0: 1
1: 0
2: 0
3: 6
4: 65
Right 1006620314 6:35359385-35359407 TCACTTAAAAATATTAGAAGAGG 0: 1
1: 0
2: 2
3: 52
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1006620311 Original CRISPR CTGGTAGTCCCTAAGTATGA TGG (reversed) Intronic
906077326 1:43061651-43061673 CTTTTAGTTCCTAAGTAAGATGG + Intergenic
908028517 1:59975418-59975440 AGGGAAGTCCTTAAGTATGAAGG - Intergenic
917997628 1:180457340-180457362 CTGGCAGTCCCAAACTATGCTGG + Intronic
921352662 1:214252498-214252520 CTGGTAGTCACTAATTAGCAGGG + Intergenic
921856198 1:219987587-219987609 TTTGTAGTTCCTAAGTGTGATGG - Intronic
1064629270 10:17293117-17293139 CTAATAGTACCTAAATATGAGGG + Intergenic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1074833111 10:117263684-117263706 CTGTAAGTCCCTAAGTCTCAAGG - Intronic
1077974292 11:7231729-7231751 CTCATTGTCCCTAAGTATGTAGG + Intergenic
1079024672 11:16937000-16937022 CTGGTAGTCCTCAAAGATGAGGG - Intronic
1083916104 11:65744629-65744651 CTGGTAGTCCCGAAGTCGGTTGG - Intergenic
1085810464 11:79676078-79676100 CTGTTGGTACTTAAGTATGAGGG + Intergenic
1086930176 11:92684025-92684047 CTGGTTTTCCCTAAGAATGAAGG + Intronic
1089606705 11:119645518-119645540 CTGTTGGTCCCTGAGCATGAAGG - Intronic
1095122423 12:38435281-38435303 CTGGTAGTGCCTTAGTTTGGTGG + Intergenic
1095274250 12:40260835-40260857 ATCGTGATCCCTAAGTATGAGGG + Intronic
1105727412 13:23178144-23178166 CTGGCAGTCCCTAGGTGTGTAGG + Intergenic
1106320368 13:28631975-28631997 TTGGCAGTGCCTAACTATGAAGG - Intergenic
1107680132 13:42839566-42839588 ATGGTATACCCTAAATATGATGG - Intergenic
1109757785 13:66784219-66784241 CTGGTAATACCTAAATATAAGGG - Intronic
1115883116 14:37942828-37942850 CTTGTAGTGCCAAAGTAAGAAGG - Intronic
1117483878 14:56174431-56174453 CTGGTACTCCCTAAGGGTTATGG - Intronic
1124179522 15:27459260-27459282 CTGGGAGTCCCTGAGCATCAAGG + Intronic
1128696035 15:69763560-69763582 TTAGTTGTCCCTAAGTTTGATGG + Intergenic
1131188250 15:90293475-90293497 CTGGAAGTCCCTGGGCATGAGGG - Intronic
1133877430 16:9748460-9748482 GTGGGAGTCCCTAAGAATCAGGG - Intergenic
1140588582 16:76324073-76324095 TTGGTAGTCCCTCAATAAGAAGG + Intronic
1142998787 17:3777492-3777514 CTGGAAGCCCCTCAGTCTGAAGG + Intronic
1145226277 17:21130864-21130886 CTGGAAGGCCATAAGCATGAGGG + Intronic
1152190624 17:78885360-78885382 CTGGAAGTGCCTTAGGATGAAGG + Intronic
1154105713 18:11521118-11521140 CTGGTACACACTAAGTGTGAAGG - Intergenic
1156303486 18:35855793-35855815 CTGGTTGTTCCTAAGTTTAATGG + Intergenic
1158797655 18:60866954-60866976 CTGGTAGTCCCAAAGCAACAAGG - Intergenic
1163035891 19:14568661-14568683 CTGGCAGTGCTTAAGTATTAGGG + Intronic
1164312960 19:24062126-24062148 CTGGTGGTCTCTCTGTATGAAGG + Intronic
927521200 2:23699398-23699420 CTGGGAGGGCCTAAGTATGGAGG + Intronic
936635469 2:114251407-114251429 TTGATAGTTCCTAAGTATGTTGG - Intergenic
945412268 2:209524902-209524924 CTGATGGTCCCTAATTATCATGG - Intronic
1175894691 20:62330881-62330903 CTGGCAGTCCCTGAGGATGATGG + Exonic
1178464497 21:32834651-32834673 CTTCCAGTCCTTAAGTATGATGG - Intergenic
1183783363 22:40013505-40013527 CTTGTACTACCTAAGTAGGAAGG - Intronic
1183866211 22:40706144-40706166 AGGGAAGTCCCTAAGGATGAAGG - Intergenic
949614040 3:5734234-5734256 CTGAAATTCCCTAAGTAGGATGG + Intergenic
949977685 3:9475909-9475931 CTGATAGTCCGTAAGTCTGATGG - Exonic
950673009 3:14538411-14538433 CTGGTTGACCTTAAGTTTGAAGG + Intronic
959572271 3:107897479-107897501 CTGGTAGTTCATTATTATGATGG + Intergenic
965261386 3:166489824-166489846 CTGGTTGTCCCTATGTATGCTGG - Intergenic
967679832 3:192348108-192348130 CTGCTCGTACCTAAGTAGGAAGG + Intronic
980529629 4:134036032-134036054 CTCGTAATCCCTAAGTGTCAAGG - Intergenic
982636674 4:157905540-157905562 CTGGTAGGCCTTAAGCATGAAGG - Intergenic
985038970 4:185869471-185869493 CTGGTAGGAGCCAAGTATGAGGG - Intronic
988168711 5:27627613-27627635 CTGAAAGTCACTAAGAATGATGG - Intergenic
992018525 5:72599540-72599562 CTGGGAATCCCAAAGTTTGAAGG - Intergenic
993689753 5:90985412-90985434 CTGGTAGTCCCCAACTCAGAAGG - Exonic
999567821 5:152885351-152885373 CTGGTAGTGCTTAAGAATCATGG - Intergenic
1001969339 5:175940935-175940957 CTGGTTATCCCTCACTATGAAGG - Intronic
1002248098 5:177902814-177902836 CTGGTTATCCCTCACTATGAAGG + Intergenic
1006620311 6:35359349-35359371 CTGGTAGTCCCTAAGTATGATGG - Intronic
1015961124 6:138650290-138650312 CTGGAAGTACCTGAGTATGTAGG - Intronic
1021018037 7:15560083-15560105 CTGAAATTGCCTAAGTATGAGGG - Intronic
1026633450 7:72059409-72059431 TTGGGAGTTCCTAAGTATGAGGG - Intronic
1030840508 7:114347424-114347446 CTGGTAGTGCTAATGTATGAAGG - Intronic
1033000880 7:137503010-137503032 CTGGTAGTTTCTGAGTCTGATGG - Intronic
1042218960 8:66454672-66454694 TTGGTAGTTGCTAAGTATTAGGG - Intronic
1048226565 8:132592960-132592982 CTGTTACTTCCTAAATATGACGG - Intronic
1052079748 9:24189498-24189520 CAGGCAGTCCCTGACTATGATGG + Intergenic
1056306316 9:85294376-85294398 CTGGTACTCTCTGAGAATGATGG + Intergenic
1186677981 X:11840643-11840665 CTTTCAGTCTCTAAGTATGATGG + Intergenic
1187098981 X:16172661-16172683 CTGCCAGTCCCTCAGTAGGAGGG + Intergenic
1188281352 X:28273914-28273936 ATTGTAGTCCCTAAGTCCGAAGG + Intergenic
1188548930 X:31340105-31340127 CTGCTAGGCCCTATGTATCAAGG + Intronic
1196998650 X:121413452-121413474 CTTGTAATCCCCATGTATGAGGG + Intergenic